Starting /dee2/code/volunteer_pipeline.sh SRR13844650 current disk space = 1551227834368 free memory = 1603357364 SRR13844650 SRAfilesize a30f1a7e3f3e60d5552bf03ecd27e78a SRR13844650.sra SRR13844650.sra file validated SRR13844650 is paired end SRR13844650 is conventional basespace SRR13844650 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844650_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29525 34.0 33.0 34.0 31.0 34.0 2 33.409 34.0 34.0 34.0 31.0 34.0 3 33.4325 34.0 34.0 34.0 31.0 34.0 4 36.681 37.0 37.0 37.0 35.0 37.0 5 36.60875 37.0 37.0 37.0 35.0 37.0 6 36.62625 37.0 37.0 37.0 35.0 37.0 7 36.616 37.0 37.0 37.0 35.0 37.0 8 36.6 37.0 37.0 37.0 35.0 37.0 9 38.54475 39.0 39.0 39.0 37.0 39.0 10-11 38.491375 39.0 39.0 39.0 37.0 39.0 12-13 38.528625 39.0 39.0 39.0 37.0 39.0 14-15 40.157125 41.0 40.0 41.0 38.0 41.0 16-17 40.162875 41.0 40.0 41.0 38.5 41.0 18-19 39.994375 41.0 40.0 41.0 38.0 41.0 20-21 39.847875 41.0 40.0 41.0 38.0 41.0 22-23 39.80475 41.0 40.0 41.0 38.0 41.0 24-25 39.462875 41.0 40.0 41.0 37.5 41.0 26-27 39.2095 41.0 40.0 41.0 37.5 41.0 28-29 39.1535 41.0 40.0 41.0 37.5 41.0 30-31 39.076125000000005 41.0 40.0 41.0 38.0 41.0 32-33 39.048 41.0 40.0 41.0 37.5 41.0 34-35 39.011875 41.0 40.0 41.0 37.5 41.0 36-37 38.979375000000005 41.0 40.0 41.0 37.0 41.0 38-39 38.903999999999996 41.0 40.0 41.0 37.0 41.0 40-41 38.889375 41.0 40.0 41.0 37.0 41.0 42-43 38.721500000000006 41.0 39.5 41.0 36.0 41.0 44-45 38.664 41.0 39.0 41.0 36.0 41.0 46-47 38.511 41.0 39.0 41.0 35.0 41.0 48-49 38.514125 40.5 39.0 41.0 35.5 41.0 50-51 38.476625 41.0 39.0 41.0 35.0 41.0 52-53 38.344125000000005 41.0 39.0 41.0 35.0 41.0 54-55 38.255125 40.5 39.0 41.0 35.0 41.0 56-57 38.068 40.0 38.0 41.0 35.0 41.0 58-59 37.73225 40.0 37.0 41.0 34.0 41.0 60-61 37.57875 40.0 37.0 41.0 34.0 41.0 62-63 37.633125 40.0 37.0 41.0 35.0 41.0 64-65 37.420625 39.0 36.0 41.0 35.0 41.0 66-67 37.113 39.0 36.0 41.0 34.5 41.0 68-69 36.775999999999996 38.5 35.0 41.0 34.0 41.0 70-71 36.369875 37.0 35.0 40.0 34.0 41.0 72-73 36.00125 37.0 35.0 39.0 34.0 41.0 74-75 35.497375000000005 36.0 35.0 39.0 33.5 41.0 76-77 34.73650000000001 35.0 34.5 37.0 32.0 39.0 78-79 34.590875 35.0 35.0 37.0 32.5 39.0 80-81 34.365875 35.0 35.0 37.0 33.0 39.0 82-83 34.156125 35.0 35.0 36.0 33.0 37.0 84-85 33.84375 35.0 35.0 36.0 32.0 37.0 86-87 33.74325 35.0 35.0 36.0 32.5 37.0 88-89 33.59475 35.0 35.0 35.0 32.5 36.0 90-91 33.525875 35.0 35.0 35.0 32.5 36.0 92-93 33.39475 35.0 35.0 35.0 32.0 36.0 94-95 33.374125 35.0 35.0 35.0 33.0 36.0 96-97 33.315375 35.0 35.0 35.0 32.5 36.0 98-99 33.13375 35.0 35.0 35.0 32.0 36.0 100-101 32.016375000000004 34.5 33.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 3.0 8 10.0 9 28.0 10 24.0 11 17.0 12 8.0 13 4.0 14 6.0 15 1.0 16 4.0 17 0.0 18 4.0 19 4.0 20 1.0 21 4.0 22 0.0 23 8.0 24 4.0 25 5.0 26 4.0 27 11.0 28 10.0 29 18.0 30 21.0 31 23.0 32 22.0 33 48.0 34 61.0 35 105.0 36 300.0 37 929.0 38 1782.0 39 530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.630657664416105 15.55388847211803 7.576894223555889 54.23855963990998 2 15.625 19.1 51.075 14.2 3 21.2 23.3 28.799999999999997 26.700000000000003 4 25.6 29.125 25.424999999999997 19.85 5 25.5 31.5 27.500000000000004 15.5 6 20.325 34.4 29.775000000000002 15.5 7 16.950000000000003 19.0 47.825 16.225 8 16.675 21.725 37.85 23.75 9 18.575 20.200000000000003 40.825 20.4 10-11 22.6 30.0875 28.6375 18.675 12-13 21.3125 25.0625 33.3125 20.3125 14-15 20.8125 27.237499999999997 31.7625 20.1875 16-17 21.1625 27.800000000000004 30.0375 21.0 18-19 21.762500000000003 28.0875 29.299999999999997 20.849999999999998 20-21 21.762500000000003 27.375 29.562500000000004 21.3 22-23 21.425 28.425 29.7375 20.4125 24-25 21.837500000000002 28.725 28.775000000000002 20.6625 26-27 21.912499999999998 28.287499999999998 28.975 20.825 28-29 22.6375 29.6875 27.425 20.25 30-31 22.525000000000002 29.037499999999998 28.1375 20.3 32-33 22.425 29.012500000000003 27.025 21.5375 34-35 21.587500000000002 29.1875 27.3625 21.8625 36-37 22.15 28.675 27.437499999999996 21.7375 38-39 22.175 28.425 28.512500000000003 20.8875 40-41 21.3875 28.299999999999997 27.725 22.5875 42-43 21.95 28.1125 27.5125 22.425 44-45 22.3625 28.475 27.487499999999997 21.675 46-47 22.0 28.4125 27.9125 21.675 48-49 22.400000000000002 28.375 27.55 21.675 50-51 22.7625 28.8375 27.3375 21.0625 52-53 22.425 28.125 27.8875 21.5625 54-55 22.3625 28.299999999999997 27.725 21.6125 56-57 23.275000000000002 27.1625 27.437499999999996 22.125 58-59 22.35 29.4375 26.7125 21.5 60-61 22.3125 27.9125 28.225 21.55 62-63 22.2625 27.85 28.025 21.8625 64-65 22.3125 27.6 27.650000000000002 22.4375 66-67 21.85 28.3125 27.9375 21.9 68-69 21.9625 27.675 27.975 22.3875 70-71 22.3375 28.237499999999997 27.375 22.05 72-73 22.2125 27.525 27.762500000000003 22.5 74-75 22.8125 28.1625 26.674999999999997 22.35 76-77 22.1 28.9 27.35 21.65 78-79 22.5875 27.5125 27.487499999999997 22.412499999999998 80-81 21.875 27.525 28.3625 22.237499999999997 82-83 22.8375 28.275 26.875 22.0125 84-85 23.525 28.237499999999997 26.924999999999997 21.3125 86-87 22.1875 28.95 26.9625 21.9 88-89 22.3625 28.1 27.962500000000002 21.575 90-91 22.4625 29.575000000000003 27.187499999999996 20.775 92-93 20.7375 28.8375 28.787499999999998 21.637500000000003 94-95 20.95 28.575 28.299999999999997 22.175 96-97 21.075 28.762500000000003 27.8375 22.325 98-99 22.375 28.6625 27.0625 21.9 100-101 21.892973243310827 28.369592398099524 28.132033008252062 21.605401350337583 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 2.0 13 1.5 14 0.0 15 2.5 16 5.0 17 5.5 18 5.0 19 5.5 20 5.0 21 5.0 22 5.5 23 5.0 24 5.5 25 6.0 26 11.5 27 11.0 28 11.5 29 15.5 30 20.0 31 31.5 32 44.5 33 54.0 34 75.0 35 93.0 36 118.5 37 152.0 38 186.5 39 216.5 40 211.5 41 208.5 42 231.5 43 244.0 44 223.0 45 211.0 46 196.0 47 166.5 48 159.0 49 147.0 50 130.0 51 121.5 52 108.5 53 91.5 54 75.0 55 61.0 56 48.5 57 46.0 58 41.0 59 31.0 60 24.0 61 21.0 62 22.0 63 16.5 64 11.0 65 12.0 66 10.0 67 7.0 68 5.5 69 4.5 70 2.5 71 2.0 72 3.0 73 1.5 74 0.5 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68053793453439 97.225 2 1.1672164425272773 2.3 3 0.12687135244861708 0.375 4 0.025374270489723422 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 25 0.0046641747 57.0 1 >>END_MODULE SRR13844650 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844650_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97825 34.0 33.0 34.0 31.0 34.0 2 33.03875 34.0 33.0 34.0 31.0 34.0 3 32.942 34.0 33.0 34.0 31.0 34.0 4 36.3475 37.0 37.0 37.0 35.0 37.0 5 36.27425 37.0 37.0 37.0 35.0 37.0 6 36.29075 37.0 37.0 37.0 35.0 37.0 7 36.3175 37.0 37.0 37.0 35.0 37.0 8 36.30275 37.0 37.0 37.0 35.0 37.0 9 38.16 39.0 39.0 39.0 37.0 39.0 10-11 37.98975 39.0 39.0 39.0 37.0 39.0 12-13 37.82275 39.0 39.0 39.0 36.0 39.0 14-15 39.402 41.0 40.0 41.0 37.5 41.0 16-17 39.35975 41.0 40.0 41.0 37.0 41.0 18-19 38.900999999999996 41.0 40.0 41.0 36.0 41.0 20-21 38.65712499999999 41.0 40.0 41.0 36.0 41.0 22-23 38.37975 41.0 40.0 41.0 35.5 41.0 24-25 38.434124999999995 41.0 40.0 41.0 36.0 41.0 26-27 38.35225 41.0 40.0 41.0 35.0 41.0 28-29 38.2955 41.0 40.0 41.0 35.5 41.0 30-31 38.119875 41.0 40.0 41.0 35.0 41.0 32-33 38.0055 41.0 40.0 41.0 35.0 41.0 34-35 37.892875000000004 41.0 39.5 41.0 34.5 41.0 36-37 37.81925 41.0 39.0 41.0 34.0 41.0 38-39 37.678749999999994 41.0 39.0 41.0 33.5 41.0 40-41 37.428125 40.5 38.0 41.0 33.0 41.0 42-43 37.2655 40.0 38.5 41.0 32.5 41.0 44-45 37.116875 40.0 38.0 41.0 32.5 41.0 46-47 36.878375 40.0 38.0 41.0 31.0 41.0 48-49 36.75475 40.0 38.0 41.0 31.5 41.0 50-51 36.052625000000006 39.5 37.5 40.5 30.5 41.0 52-53 36.200874999999996 39.5 38.0 40.5 30.5 41.0 54-55 36.635625 40.0 38.0 41.0 31.0 41.0 56-57 36.807874999999996 40.0 37.0 41.0 32.5 41.0 58-59 36.752375 40.0 37.0 41.0 32.5 41.0 60-61 36.6475 40.0 37.0 41.0 32.0 41.0 62-63 36.15375 39.0 36.0 41.0 31.0 41.0 64-65 36.10125 39.0 36.0 41.0 31.5 41.0 66-67 35.59325 39.0 35.0 41.0 31.5 41.0 68-69 35.039874999999995 37.5 35.0 40.5 30.0 41.0 70-71 34.661375 37.0 35.0 39.5 30.0 41.0 72-73 34.134875 36.5 35.0 39.0 28.5 41.0 74-75 33.467625 36.0 35.0 38.5 26.0 40.5 76-77 33.386375 35.5 35.0 37.0 27.5 39.0 78-79 33.125 35.0 35.0 37.0 29.0 39.0 80-81 32.649625 35.0 35.0 36.5 25.5 38.0 82-83 32.2505 35.0 34.5 36.0 25.0 37.0 84-85 29.274375 35.0 32.5 35.5 2.0 37.0 86-87 29.437125 35.0 33.0 35.0 2.0 36.0 88-89 29.561125 35.0 33.0 35.0 2.0 36.0 90-91 29.68975 35.0 33.0 35.0 2.0 36.0 92-93 29.854125 35.0 33.0 35.0 2.0 36.0 94-95 29.664250000000003 35.0 33.0 35.0 2.0 35.5 96-97 29.53725 35.0 33.0 35.0 2.0 35.0 98-99 29.458125 35.0 33.0 35.0 2.0 35.0 100-101 28.393625 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 4.0 5 4.0 6 33.0 7 21.0 8 38.0 9 34.0 10 33.0 11 27.0 12 12.0 13 7.0 14 3.0 15 2.0 16 14.0 17 3.0 18 5.0 19 3.0 20 6.0 21 12.0 22 6.0 23 15.0 24 16.0 25 11.0 26 21.0 27 17.0 28 17.0 29 29.0 30 40.0 31 62.0 32 131.0 33 100.0 34 71.0 35 149.0 36 334.0 37 828.0 38 1463.0 39 419.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.15 14.875 7.675 53.300000000000004 2 16.2 19.400000000000002 50.349999999999994 14.05 3 21.224999999999998 24.474999999999998 27.6 26.700000000000003 4 24.224999999999998 29.549999999999997 25.224999999999998 21.0 5 25.474999999999998 31.95 27.675 14.899999999999999 6 19.8 34.525 30.9 14.774999999999999 7 17.549999999999997 17.875 47.8 16.775000000000002 8 16.55 20.724999999999998 40.425 22.3 9 19.459729864932466 21.435717858929465 40.09504752376188 19.009504752376188 10-11 22.59972316597458 29.58349062539323 28.89140556184724 18.92538064678495 12-13 21.144874542932797 26.26402723490102 32.467532467532465 20.123565754633717 14-15 21.233135796242593 26.95750851090657 32.54318497036944 19.2661707224814 16-17 21.591625677891287 27.304830369529576 30.356917644091308 20.74662630848783 18-19 21.87658067779464 27.642893272635305 29.274152756702076 21.20637329286798 20-21 22.426237811827278 27.060909206027606 28.82107129289604 21.691781689249083 22-23 21.118951612903224 29.17086693548387 28.881048387096776 20.829133064516128 24-25 21.823411705852926 29.30215107553777 27.60130065032516 21.273136568284144 26-27 21.912499999999998 27.700000000000003 28.762500000000003 21.625 28-29 21.987499999999997 29.599999999999998 26.9625 21.45 30-31 22.4875 28.7375 27.150000000000002 21.625 32-33 21.212500000000002 29.612500000000004 27.450000000000003 21.725 34-35 21.4375 28.1625 28.3125 22.0875 36-37 22.35 29.099999999999998 27.0125 21.5375 38-39 21.6625 29.612500000000004 27.3625 21.3625 40-41 22.36693800876644 28.515967438948024 27.639323731997496 21.47777082028804 42-43 21.81612660135644 28.48530519969857 27.61868877166541 22.07987942727958 44-45 21.256768668933386 28.233219997481424 28.976199471099356 21.533811862485834 46-47 21.925944648047516 28.48477189435107 28.080374067989382 21.50890938961203 48-49 21.587867975022302 29.106664967503505 26.787307251178795 22.518159806295397 50-51 21.852610030706245 28.37768679631525 27.533265097236438 22.23643807574207 52-53 21.337054420905748 29.06253964226817 27.527591018647723 22.072814918178356 54-55 22.318731117824772 28.751258811681772 27.278449144008054 21.6515609264854 56-57 22.078411661221413 28.512188992209097 26.95400854486052 22.455390801708973 58-59 22.45000628851717 28.411520563451138 26.952584580555904 22.18588856747579 60-61 21.36666247958799 28.388393417912322 27.44630071599045 22.798643386509234 62-63 21.704260651629074 27.79448621553885 28.208020050125317 22.293233082706767 64-65 21.369242386106215 28.05184998741505 27.661716586961994 22.917191039516737 66-67 22.0995176440721 27.900482355927902 27.506981467377507 22.493018532622493 68-69 21.65710643722116 27.96685787125558 28.476736775015933 21.89929891650733 70-71 22.05056179775281 28.804902962206334 27.77068437180797 21.373850868232893 72-73 22.13418530351438 28.728434504792332 26.543130990415335 22.594249201277954 74-75 23.415132924335378 28.20807770961145 26.95552147239264 21.42126789366053 76-77 22.396630934150078 28.968861664114343 26.761102603369064 21.873404798366515 78-79 22.41247124968055 27.702530028111422 27.446971633018148 22.43802708918988 80-81 22.07080998471727 27.81456953642384 27.62353540499236 22.491085073866532 82-83 21.604938271604937 28.36986646510456 27.2108843537415 22.814310909549004 84-85 21.14301801801802 28.448761261261264 28.265765765765767 22.142454954954953 86-87 21.989966555183944 28.34448160535117 27.57803790412486 22.087513935340024 88-89 21.92344628892852 28.549869666620936 27.45232542186857 22.074358622581972 90-91 21.281495529666756 28.285017610403685 28.244378217285288 22.18910864264427 92-93 21.930773391022175 28.90751757706869 26.67658193618172 22.48512709572742 94-95 21.8504470333243 28.867515578434027 27.607694391763747 21.674342996477918 96-97 22.289318303811058 29.38808373590982 26.99946323134729 21.32313472893183 98-99 21.814052898744325 28.653486508148546 27.464600587763826 22.067860005343306 100-101 21.985440105890138 27.849106551952353 27.597617471872933 22.56783587028458 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 2.0 8 3.5 9 4.0 10 5.0 11 5.0 12 6.5 13 5.5 14 4.0 15 5.0 16 6.5 17 7.5 18 8.0 19 7.5 20 10.5 21 10.5 22 9.0 23 9.0 24 10.5 25 14.5 26 18.0 27 22.0 28 25.0 29 29.5 30 30.5 31 34.0 32 51.0 33 71.0 34 74.5 35 91.0 36 121.0 37 154.5 38 175.0 39 184.0 40 202.0 41 212.0 42 225.0 43 216.0 44 211.0 45 197.5 46 178.0 47 182.5 48 174.0 49 151.5 50 122.0 51 102.0 52 108.5 53 105.5 54 71.0 55 57.5 56 50.0 57 36.5 58 29.0 59 24.0 60 21.5 61 16.0 62 14.0 63 11.0 64 11.0 65 9.5 66 7.5 67 8.5 68 6.0 69 3.5 70 2.0 71 3.0 72 6.0 73 4.5 74 2.0 75 1.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-11 0.6625 12-13 0.8625 14-15 0.8625 16-17 0.8875 18-19 1.15 20-21 1.2874999999999999 22-23 0.8 24-25 0.05 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.1875 42-43 0.475 44-45 0.7374999999999999 46-47 1.0875 48-49 1.9124999999999999 50-51 2.3 52-53 1.4625000000000001 54-55 0.7000000000000001 56-57 0.525 58-59 0.6125 60-61 0.4875 62-63 0.25 64-65 0.675 66-67 1.525 68-69 1.9375 70-71 2.1 72-73 2.1875 74-75 2.1999999999999997 76-77 2.0500000000000003 78-79 2.175 80-81 1.8499999999999999 82-83 0.775 84-85 11.200000000000001 86-87 10.299999999999999 88-89 8.8875 90-91 7.725 92-93 7.55 94-95 7.725 96-97 6.8500000000000005 98-99 6.425 100-101 5.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8342625443487 97.5 2 0.9883426254434872 1.95 3 0.15205271160669032 0.44999999999999996 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 25 0.005186396 55.4925 1 >>END_MODULE Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841167 spots for SRR13844650.sra Written 841167 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra Read 841161 spots for SRR13844650.sra Written 841161 spots for SRR13844650.sra SRR ids: ['SRR13844650.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dt9lk2ab SRR13844650.sra spots: 16823226 blocks: [[1, 841161], [841162, 1682322], [1682323, 2523483], [2523484, 3364644], [3364645, 4205805], [4205806, 5046966], [5046967, 5888127], [5888128, 6729288], [6729289, 7570449], [7570450, 8411610], [8411611, 9252771], [9252772, 10093932], [10093933, 10935093], [10935094, 11776254], [11776255, 12617415], [12617416, 13458576], [13458577, 14299737], [14299738, 15140898], [15140899, 15982059], [15982060, 16823226]] SRR13844650 file size 4052674 SRR13844650 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844650 SRR13844650_1.fastq SRR13844650_2.fastq Input file: SRR13844650_1.fastq Paired file: SRR13844650_2.fastq trimmed: SRR13844650-trimmed-pair1.fastq, SRR13844650-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:07:30 2024 >> started Fri Dec 6 13:07:49 2024 >> done (18.874s) 16823226 read pairs processed; of these: 157545 ( 0.94%) short read pairs filtered out after trimming by size control 82989 ( 0.49%) empty read pairs filtered out after trimming by size control 16582692 (98.57%) read pairs available; of these: 2961405 (17.86%) trimmed read pairs available after processing 13621287 (82.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 31 0.00% 20 75 0.00% 21 99 0.00% 22 140 0.00% 23 183 0.00% 24 181 0.00% 25 212 0.00% 26 270 0.00% 27 294 0.00% 28 357 0.00% 29 415 0.00% 30 510 0.00% 31 553 0.00% 32 561 0.00% 33 708 0.00% 34 736 0.00% 35 813 0.00% 36 869 0.01% 37 950 0.01% 38 1085 0.01% 39 1156 0.01% 40 1198 0.01% 41 1320 0.01% 42 1498 0.01% 43 1668 0.01% 44 1823 0.01% 45 1965 0.01% 46 2124 0.01% 47 2219 0.01% 48 2412 0.01% 49 2578 0.02% 50 2980 0.02% 51 3338 0.02% 52 3879 0.02% 53 4276 0.03% 54 4712 0.03% 55 5337 0.03% 56 6119 0.04% 57 7214 0.04% 58 8668 0.05% 59 117294 0.71% 60 154572 0.93% 61 161414 0.97% 62 185155 1.12% 63 154704 0.93% 64 103861 0.63% 65 68195 0.41% 66 48243 0.29% 67 37848 0.23% 68 33140 0.20% 69 28476 0.17% 70 26422 0.16% 71 24563 0.15% 72 24105 0.15% 73 23264 0.14% 74 22327 0.13% 75 23805 0.14% 76 23423 0.14% 77 23476 0.14% 78 23109 0.14% 79 22367 0.13% 80 22722 0.14% 81 23749 0.14% 82 24925 0.15% 83 27871 0.17% 84 27791 0.17% 85 28118 0.17% 86 29535 0.18% 87 31027 0.19% 88 33072 0.20% 89 35455 0.21% 90 38971 0.24% 91 47630 0.29% 92 99119 0.60% 93 53468 0.32% 94 57781 0.35% 95 65800 0.40% 96 78519 0.47% 97 98175 0.59% 98 126920 0.77% 99 173421 1.05% 100 432038 2.61% 101 13621287 82.14% 16582692 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=3.0 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=147.34 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.9 sequence=TGCTGCTGCTAGCTAGAAATAAAGTTCGTGTCCAAATAAAACCGTGTGCAATGATGTAATGGCAATGGCGTGTCTGTGTCCGTGTCGCTCTGTGAGCTGAGCGTAATTTCCATGCGAGGAGAGGAGGGGCCCCTGGTTTCTGAAGATGAACTCTGATTGCCTTGATTGTAATCAGTCTGTGTTTCCTAGTACTAG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=2.9 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=68.53 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.9 sequence=TTTGTTGGTGAGAGCATGGGTGATGATGCCAGCGTGGTGTTTGCATACTACAAGGAAGGAGCCACTGACCCGACATTCCTGTATTTCGCGCATGGGCTTAAGGAGGTCAAGTGCTAAGCGCACTGTATGCTAAAACTATCAGTTGTCCGTATTTTTGATCTGGTCTGTGGTTGTCAGTAGACTCACCAATGTTGGTGGCGTAACTGTTATCAGATGTTGAGTGTCTTGGAAACTTTTCGATAATTGTGGTGTTTGCTTTGTGTAATGGATCCGTGAAATTGGTGTGACGTTAGTATTTCTGTGTTCTGCATGAACAGTACCTTTCTTTTGCTTGACAAGTGGAAT SRR13844650 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:08:27 Started mapping on | Dec 06 13:08:27 Finished on | Dec 06 13:09:11 Mapping speed, Million of reads per hour | 1356.77 Number of input reads | 16582692 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 15813093 Uniquely mapped reads % | 95.36% Average mapped length | 192.99 Number of splices: Total | 5831473 Number of splices: Annotated (sjdb) | 5454596 Number of splices: GT/AG | 5702344 Number of splices: GC/AG | 71475 Number of splices: AT/AC | 2755 Number of splices: Non-canonical | 54899 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.78 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515994 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 2840 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1174336 1174336 1174336 N_multimapping 515994 515994 515994 N_noFeature 727384 8101322 8090652 N_ambiguous 391582 23430 23034 UnstrandedReadsAssigned:14694127 PositiveStrandReadsAssigned:7688341 NegativeStrandReadsAssigned:7699407 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844650 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844650-trimmed-pair1.fastq SRR13844650-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,582,692 reads, 15,514,963 reads pseudoaligned [quant] estimated average fragment length: 166.753 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR13844650.ke.tsv 35125 SRR13844650.se.tsv 88098 total ==> SRR13844650.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.327 0 0 PNS24247 1044 878.247 2.18117 0.22068 PNS24249 1928 1762.25 7.71224 0.388871 PNS24246 1044 878.247 2.18117 0.22068 PNS24248 1044 878.247 2.18117 0.22068 PNS24244 1471 1305.25 910.744 62.0005 PNS24243 293 132.999 0 0 KQK14069 1603 1437.25 232.089 14.3488 KQK14071 474 309.236 6.96694 2.0019 ==> SRR13844650.se.tsv <== BRADI_1g14170v3 382 BRADI_1g53295v3 139 BRADI_1g59795v3 278 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 911 BRADI_1g74790v3 15 BRADI_1g09890v3 0 BRADI_1g77505v3 659 BRADI_1g48960v3 1 SRR13844650 completed mapping pipeline successfully