Starting /dee2/code/volunteer_pipeline.sh SRR13844651 current disk space = 1551209213952 free memory = 1603217536 SRR13844651 SRAfilesize d25932f912717ab1a882e720b418b98e SRR13844651.sra SRR13844651.sra file validated SRR13844651 is paired end SRR13844651 is conventional basespace SRR13844651 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844651_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2525 34.0 33.0 34.0 31.0 34.0 2 33.36175 34.0 34.0 34.0 31.0 34.0 3 33.36925 34.0 34.0 34.0 31.0 34.0 4 36.65525 37.0 37.0 37.0 35.0 37.0 5 36.544 37.0 37.0 37.0 35.0 37.0 6 36.58625 37.0 37.0 37.0 35.0 37.0 7 36.5435 37.0 37.0 37.0 35.0 37.0 8 36.5615 37.0 37.0 37.0 35.0 37.0 9 38.5325 39.0 39.0 39.0 37.0 39.0 10-11 38.429125 39.0 39.0 39.0 37.0 39.0 12-13 38.51325 39.0 39.0 39.0 37.0 39.0 14-15 40.12575 41.0 40.0 41.0 38.0 41.0 16-17 40.075125 41.0 40.0 41.0 38.0 41.0 18-19 39.857124999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.654624999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.557875 41.0 40.0 41.0 37.0 41.0 24-25 39.205875000000006 41.0 40.0 41.0 36.5 41.0 26-27 38.962375 41.0 39.5 41.0 36.0 41.0 28-29 38.844875 41.0 40.0 41.0 36.0 41.0 30-31 38.80475 41.0 40.0 41.0 36.5 41.0 32-33 38.623000000000005 41.0 40.0 41.0 36.0 41.0 34-35 38.545375 41.0 40.0 41.0 36.0 41.0 36-37 38.502375 41.0 39.5 41.0 36.0 41.0 38-39 38.45375 41.0 39.5 41.0 35.0 41.0 40-41 38.339625 41.0 39.0 41.0 35.0 41.0 42-43 38.161375 41.0 38.5 41.0 35.0 41.0 44-45 38.051625 40.5 38.0 41.0 35.0 41.0 46-47 37.926874999999995 40.0 38.0 41.0 34.0 41.0 48-49 37.853750000000005 40.0 38.0 41.0 34.0 41.0 50-51 37.836124999999996 40.0 38.0 41.0 34.5 41.0 52-53 37.70925 40.0 38.0 41.0 34.0 41.0 54-55 37.521875 40.0 37.5 41.0 33.5 41.0 56-57 37.307874999999996 40.0 37.0 41.0 33.5 41.0 58-59 36.83825 40.0 36.0 41.0 32.5 41.0 60-61 36.78425 39.0 36.0 41.0 33.0 41.0 62-63 36.811375 39.0 35.5 41.0 33.0 41.0 64-65 36.530375 39.0 35.0 41.0 33.0 41.0 66-67 36.2445 38.5 35.0 41.0 33.0 41.0 68-69 35.91825 37.0 35.0 40.0 33.0 41.0 70-71 35.611999999999995 37.0 35.0 39.5 33.0 41.0 72-73 35.2685 36.0 35.0 39.0 33.0 41.0 74-75 34.75125 36.0 35.0 38.5 32.0 40.5 76-77 34.045125 35.0 34.5 37.0 30.5 39.0 78-79 34.013125 35.0 35.0 37.0 31.0 39.0 80-81 33.873125 35.0 35.0 36.0 31.5 39.0 82-83 33.607 35.0 35.0 36.0 31.0 37.0 84-85 33.259 35.0 35.0 36.0 31.0 37.0 86-87 33.252625 35.0 35.0 35.5 31.0 36.5 88-89 33.0845 35.0 35.0 35.0 31.0 36.0 90-91 32.9985 35.0 35.0 35.0 31.0 36.0 92-93 32.7745 35.0 34.5 35.0 30.5 36.0 94-95 32.803 35.0 35.0 35.0 31.0 36.0 96-97 32.713375 35.0 35.0 35.0 31.0 36.0 98-99 32.573499999999996 35.0 34.0 35.0 31.0 35.0 100-101 31.3335 34.5 32.5 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 4.0 8 10.0 9 33.0 10 27.0 11 28.0 12 18.0 13 5.0 14 4.0 15 5.0 16 3.0 17 5.0 18 1.0 19 3.0 20 7.0 21 7.0 22 9.0 23 6.0 24 2.0 25 6.0 26 7.0 27 8.0 28 9.0 29 18.0 30 34.0 31 27.0 32 38.0 33 53.0 34 105.0 35 159.0 36 377.0 37 925.0 38 1587.0 39 470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.33108277069267 14.90372593148287 8.30207551887972 52.46311577894473 2 17.849999999999998 19.125 49.125 13.900000000000002 3 22.025 23.400000000000002 28.475 26.1 4 25.374999999999996 27.85 25.424999999999997 21.349999999999998 5 25.25 30.8 29.099999999999998 14.85 6 20.599999999999998 33.575 30.775000000000002 15.049999999999999 7 17.1 18.025 47.55 17.325 8 18.25 20.325 38.4 23.025000000000002 9 19.375 19.900000000000002 41.175 19.55 10-11 23.0375 29.299999999999997 28.599999999999998 19.0625 12-13 21.175 24.887500000000003 33.2375 20.7 14-15 20.9125 26.737499999999997 32.525 19.825 16-17 22.5125 26.737499999999997 29.8375 20.9125 18-19 22.25 27.212500000000002 30.85 19.6875 20-21 22.0625 26.325 30.25 21.3625 22-23 22.175 27.5125 29.3875 20.925 24-25 22.237499999999997 27.487499999999997 28.6875 21.587500000000002 26-27 22.8625 27.250000000000004 28.537499999999998 21.349999999999998 28-29 21.5625 28.725 27.5625 22.15 30-31 22.7375 27.450000000000003 28.199999999999996 21.6125 32-33 22.15 27.650000000000002 28.549999999999997 21.65 34-35 21.725 28.0875 28.075 22.112499999999997 36-37 22.237499999999997 27.6625 27.3125 22.787499999999998 38-39 22.0125 27.35 28.1375 22.5 40-41 21.91797949487372 27.644411102775695 28.119529882470616 22.31807951987997 42-43 22.400000000000002 28.275 27.950000000000003 21.375 44-45 21.75 28.249999999999996 27.0125 22.9875 46-47 22.0625 27.8625 27.425 22.650000000000002 48-49 21.6625 27.1625 28.287499999999998 22.8875 50-51 22.6125 27.55 27.35 22.4875 52-53 22.25 28.3875 27.575 21.7875 54-55 23.425 27.1625 27.8125 21.6 56-57 23.2125 27.712500000000002 27.3375 21.7375 58-59 23.1 27.750000000000004 27.9375 21.212500000000002 60-61 22.5125 28.1875 26.987499999999997 22.3125 62-63 22.787499999999998 27.650000000000002 27.450000000000003 22.112499999999997 64-65 23.6625 27.975 26.7125 21.65 66-67 23.1875 26.875 27.6 22.3375 68-69 22.175 27.287499999999998 28.012500000000003 22.525000000000002 70-71 23.275000000000002 27.775 26.887499999999996 22.0625 72-73 21.775 28.9 27.450000000000003 21.875 74-75 22.6 27.0625 28.0875 22.25 76-77 21.8125 27.6375 26.875 23.674999999999997 78-79 22.650000000000002 27.3625 27.5625 22.425 80-81 23.2125 26.875 27.575 22.3375 82-83 21.6125 28.487499999999997 26.950000000000003 22.95 84-85 23.0125 27.200000000000003 27.212500000000002 22.575 86-87 22.825 27.650000000000002 26.4625 23.0625 88-89 22.3375 28.199999999999996 27.237499999999997 22.225 90-91 22.6875 28.0875 26.087500000000002 23.1375 92-93 22.35 28.3125 27.224999999999998 22.112499999999997 94-95 22.912499999999998 27.4125 27.1375 22.537499999999998 96-97 22.287499999999998 27.8875 27.025 22.8 98-99 22.55 28.1875 27.212500000000002 22.05 100-101 21.944201176029026 28.90028775178281 26.873514325034403 22.28199674715376 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 1.5 12 2.0 13 2.5 14 3.5 15 5.5 16 4.5 17 3.0 18 3.0 19 3.0 20 4.5 21 6.5 22 8.5 23 7.0 24 6.5 25 8.5 26 12.0 27 14.0 28 13.0 29 16.5 30 23.5 31 35.0 32 50.5 33 56.5 34 65.0 35 84.0 36 94.5 37 117.0 38 160.5 39 191.5 40 207.5 41 234.0 42 235.5 43 228.0 44 208.5 45 187.5 46 195.0 47 194.5 48 176.0 49 144.5 50 137.5 51 116.5 52 96.0 53 87.5 54 61.0 55 53.5 56 51.0 57 40.5 58 30.0 59 26.5 60 34.0 61 32.0 62 25.5 63 23.5 64 20.0 65 19.5 66 18.5 67 14.5 68 13.5 69 10.5 70 9.5 71 14.5 72 14.5 73 9.5 74 7.0 75 6.0 76 5.5 77 3.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.94379639448569 90.47500000000001 2 2.9692470837751856 5.6000000000000005 3 0.6362672322375398 1.7999999999999998 4 0.23860021208907742 0.8999999999999999 5 0.10604453870625664 0.5 6 0.07953340402969247 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02651113467656416 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTATTCCACATCATAAACACCATACATCATCCAACTCGCAGACTCTCT 11 0.27499999999999997 No Hit CCGCAATGTGTTCAATGGACTTCTTCGTCGAGGGCAGCTGTTAATCATAC 6 0.15 No Hit CTCACATTTATTTTGCCGGAAAACTGTCACGTACAAAACGTACACGGTAC 6 0.15 No Hit GTTGAATAATTTTACATGTGTGTTCGTAAGTGTCTTAGCTAGGTAACTTC 6 0.15 No Hit ATTTATTTTGCCGGAAAACTGTCACGTACAAAACGTACACGGTACACGTA 5 0.125 No Hit CTTGTAGTAGATAGATAGGGATCACCGCTGTTTTAGTCGATGTAGCAGCA 5 0.125 No Hit CTGTGAGTGAGTGAAGCTAGCTGCCAGAGAGGGGCAGTGACGGCAGTGCG 5 0.125 No Hit CGGAGAGTGAAGGATACCAGTATATCGCTTTCAAGACCAACGCAAACTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844651 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844651_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.908 34.0 33.0 34.0 31.0 34.0 2 32.9525 34.0 33.0 34.0 31.0 34.0 3 32.859 34.0 33.0 34.0 31.0 34.0 4 36.236 37.0 37.0 37.0 35.0 37.0 5 36.15825 37.0 37.0 37.0 35.0 37.0 6 36.178 37.0 37.0 37.0 35.0 37.0 7 36.19425 37.0 37.0 37.0 35.0 37.0 8 36.19325 37.0 37.0 37.0 35.0 37.0 9 38.02625 39.0 39.0 39.0 37.0 39.0 10-11 37.81525 39.0 39.0 39.0 37.0 39.0 12-13 37.609125 39.0 39.0 39.0 36.0 39.0 14-15 39.164 41.0 40.0 41.0 37.0 41.0 16-17 39.1445 41.0 40.0 41.0 37.0 41.0 18-19 38.642125 41.0 40.0 41.0 35.5 41.0 20-21 38.367625000000004 41.0 40.0 41.0 35.5 41.0 22-23 38.029624999999996 41.0 39.5 41.0 34.5 41.0 24-25 38.164875 41.0 39.5 41.0 34.5 41.0 26-27 38.067625 41.0 39.5 41.0 34.5 41.0 28-29 37.865750000000006 41.0 39.5 41.0 33.5 41.0 30-31 37.74375 41.0 39.0 41.0 33.0 41.0 32-33 37.690875000000005 41.0 39.0 41.0 33.0 41.0 34-35 37.452 41.0 38.5 41.0 32.0 41.0 36-37 37.4525 41.0 38.5 41.0 32.5 41.0 38-39 37.2295 40.5 38.0 41.0 30.5 41.0 40-41 37.0025 40.0 38.0 41.0 30.0 41.0 42-43 36.863875 40.0 38.0 41.0 30.0 41.0 44-45 36.583124999999995 40.0 38.0 41.0 30.0 41.0 46-47 36.2535 40.0 37.0 41.0 29.5 41.0 48-49 35.943 40.0 37.0 41.0 27.5 41.0 50-51 35.194375 39.5 36.0 40.5 25.0 41.0 52-53 35.32275 39.5 36.0 40.5 23.5 41.0 54-55 35.808625000000006 40.0 36.0 41.0 26.5 41.0 56-57 36.002625 40.0 36.0 41.0 29.5 41.0 58-59 35.981375 40.0 36.0 41.0 30.0 41.0 60-61 35.869125 39.5 35.0 41.0 31.0 41.0 62-63 35.297125 39.0 35.0 41.0 28.0 41.0 64-65 35.195375 39.0 35.0 41.0 29.0 41.0 66-67 34.683125000000004 37.5 35.0 40.5 28.0 41.0 68-69 34.09 37.0 35.0 39.5 24.5 41.0 70-71 33.629875 36.5 35.0 39.0 21.5 41.0 72-73 33.0615 36.0 35.0 39.0 15.5 41.0 74-75 32.427125000000004 35.0 34.0 37.0 8.5 40.0 76-77 32.398624999999996 35.0 34.0 37.0 17.0 39.0 78-79 32.235875 35.0 34.5 37.0 13.0 39.0 80-81 31.7945 35.0 34.0 36.0 6.5 38.5 82-83 31.355125 35.0 34.0 36.0 2.0 37.0 84-85 27.672625 35.0 28.5 35.0 2.0 37.0 86-87 27.91725 35.0 30.5 35.0 2.0 36.0 88-89 28.148125 35.0 30.0 35.0 2.0 36.0 90-91 28.49125 35.0 31.0 35.0 2.0 36.0 92-93 28.688499999999998 35.0 31.5 35.0 2.0 36.0 94-95 28.515375 35.0 31.5 35.0 2.0 35.5 96-97 28.38875 35.0 31.0 35.0 2.0 35.0 98-99 28.236 35.0 31.0 35.0 2.0 35.0 100-101 27.1605 34.0 27.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 7.0 5 5.0 6 36.0 7 28.0 8 37.0 9 39.0 10 39.0 11 25.0 12 9.0 13 13.0 14 8.0 15 8.0 16 13.0 17 7.0 18 9.0 19 10.0 20 10.0 21 7.0 22 13.0 23 24.0 24 22.0 25 23.0 26 20.0 27 19.0 28 20.0 29 41.0 30 56.0 31 82.0 32 155.0 33 104.0 34 89.0 35 197.0 36 354.0 37 795.0 38 1311.0 39 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.575 14.875 8.85 51.7 2 17.525 19.675 48.25 14.549999999999999 3 22.575 23.65 27.825 25.95 4 24.775 27.925 26.0 21.3 5 25.724999999999998 30.175 29.299999999999997 14.799999999999999 6 20.65 32.5 30.825000000000003 16.025 7 18.35 17.875 47.099999999999994 16.675 8 18.675 21.224999999999998 38.6 21.5 9 18.998748435544428 19.749687108886107 40.10012515644556 21.151439299123904 10-11 22.880181428751417 30.288522111629078 28.297845533576922 18.533450926042587 12-13 21.20293151377306 24.639878695981803 33.484963356077834 20.6722264341673 14-15 21.281435612283584 26.134209528623785 33.22380892202704 19.360545937065588 16-17 22.317705042335398 25.944648047516743 31.16390749399722 20.573739416150637 18-19 22.313839908664214 26.956742356970697 29.55727514905493 21.172142585310162 20-21 21.45579268292683 26.880081300813007 29.776422764227643 21.88770325203252 22-23 22.761146899077932 26.840975116837186 29.000884173297965 21.396993810786913 24-25 22.71703777833375 27.820865649236925 27.75831873905429 21.70377783337503 26-27 23.5 28.075 27.2625 21.1625 28-29 22.15 28.8625 26.6625 22.325 30-31 22.412499999999998 28.1625 26.937499999999996 22.4875 32-33 22.662499999999998 28.7375 27.175 21.425 34-35 23.1125 27.625 27.237499999999997 22.025 36-37 22.35 27.825 27.762500000000003 22.0625 38-39 22.662499999999998 27.6375 27.775 21.925 40-41 22.894736842105264 27.644110275689222 26.829573934837093 22.63157894736842 42-43 22.472051249842984 27.38349453586233 27.270443411631707 22.87401080266298 44-45 22.707203229468902 28.72461208527816 27.135107859215342 21.433076826037592 46-47 22.429078014184398 28.102836879432623 26.811043566362713 22.657041540020266 48-49 22.464418515194257 27.977945890498784 27.465059623028594 22.092575971278368 50-51 22.58064516129032 28.283870967741937 26.541935483870965 22.593548387096774 52-53 21.212893362211744 27.251879220282838 27.965345903936807 23.569881513568607 54-55 22.452068617558023 27.888496468213926 27.762361251261353 21.8970736629667 56-57 22.53928346951603 27.919547454431175 27.919547454431175 21.62162162162162 58-59 22.629391764261428 28.006548293665784 27.26356882004785 22.100491122024934 60-61 21.923318667504716 28.698931489629164 27.03959773727216 22.338152105593966 62-63 22.40471414242728 28.560682046138414 27.106318956870613 21.92828485456369 64-65 22.8996095226099 26.993324096233785 27.119284544652977 22.987781836503338 66-67 22.47992863514719 27.513699502994776 27.322543647253728 22.683828214604308 68-69 23.180592991913745 27.287896290591707 27.557438069567446 21.974072647927095 70-71 22.747167868177137 27.947991761071062 27.188465499485066 22.116374871266736 72-73 21.99330414627865 28.496008241050735 27.710533092969353 21.800154519701263 74-75 22.56568778979907 28.129829984544045 27.52447192168985 21.780010303967025 76-77 22.006430868167204 27.408360128617364 27.961414790996784 22.62379421221865 78-79 22.300953362535427 27.853645967534142 27.69904663746457 22.146354032465858 80-81 23.125240353800795 27.047814382771442 27.21445968465581 22.612485578771953 82-83 21.724312042413533 27.6445342085332 28.174703357737947 22.456450391315325 84-85 21.434833430742255 29.061952074810055 27.250146113383988 22.253068381063706 86-87 22.756041426927503 27.977560414269277 27.330264672036826 21.936133486766398 88-89 22.508445945945947 28.744369369369373 26.872184684684687 21.875 90-91 22.23143923683119 28.632655882759572 26.627955205309 22.507949675100235 92-93 22.58375844478147 28.04356817868468 26.88542671997794 22.48724665655591 94-95 22.409505388228794 28.778668140370268 26.80298424979276 22.00884222160818 96-97 22.494887525562373 28.384458077709613 27.02113156100886 22.099522835719153 98-99 21.740896168945444 28.88858806010559 26.627859753621223 22.74265601732774 100-101 23.682097939523683 28.37837837837838 26.3045223441263 21.635001337971634 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 3.5 8 3.0 9 2.5 10 3.0 11 3.0 12 4.0 13 5.0 14 4.5 15 4.0 16 6.0 17 8.0 18 12.5 19 14.5 20 12.5 21 11.5 22 10.0 23 12.5 24 17.0 25 18.0 26 19.0 27 22.5 28 27.5 29 34.0 30 41.0 31 49.5 32 57.0 33 63.0 34 71.5 35 92.0 36 118.5 37 130.5 38 146.0 39 183.0 40 204.5 41 201.5 42 215.5 43 219.5 44 203.5 45 189.5 46 174.0 47 159.5 48 153.0 49 140.0 50 122.0 51 110.5 52 97.5 53 85.5 54 70.5 55 53.5 56 44.0 57 41.5 58 36.0 59 27.0 60 26.0 61 27.5 62 24.0 63 20.0 64 17.0 65 15.5 66 11.5 67 8.0 68 6.0 69 6.5 70 12.0 71 14.5 72 10.5 73 10.5 74 9.5 75 6.5 76 5.0 77 4.0 78 2.0 79 1.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.125 10-11 0.7875 12-13 1.075 14-15 1.0875 16-17 1.0875 18-19 1.4625000000000001 20-21 1.6 22-23 1.0375 24-25 0.075 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.25 42-43 0.4875 44-45 0.9125 46-47 1.3 48-49 2.5125 50-51 3.125 52-53 1.8875 54-55 0.8999999999999999 56-57 0.5625 58-59 0.7374999999999999 60-61 0.5625 62-63 0.3 64-65 0.7625 66-67 1.9124999999999999 68-69 2.6125 70-71 2.9000000000000004 72-73 2.9250000000000003 74-75 2.9499999999999997 76-77 2.8125 78-79 2.9749999999999996 80-81 2.4875000000000003 82-83 0.975 84-85 14.45 86-87 13.100000000000001 88-89 11.200000000000001 90-91 9.5875 92-93 9.3375 94-95 9.525 96-97 8.3125 98-99 7.6625 100-101 6.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 96.44830307813733 91.64999999999999 2 2.6308866087871614 5.0 3 0.5787950539331754 1.6500000000000001 4 0.13154433043935806 0.5 5 0.13154433043935806 0.625 6 0.026308866087871613 0.15 7 0.0 0.0 8 0.026308866087871613 0.2 9 0.026308866087871613 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit CGGAGAGTGAAGGATACCAGTATATCGCTTTCAAGACCAACGCAAACTCC 8 0.2 No Hit CTCCATTGAGCTACCAGAGTTTTGAGGAATCGGCTTCAAGTCGCAAGGCA 6 0.15 No Hit CGTGTGTTTAGGCTTTGGGTTTGCGTACGTAGTACTGGTACTACTACTAT 5 0.125 No Hit ATTTATTTTGCCGGAAAACTGTCACGTACAAAACGTACACGGTACACGTA 5 0.125 No Hit CTTTATTCCACATCATAAACACCATACATCATCCAACTCGCAGACTCTCT 5 0.125 No Hit AAACGCCCTTGTTTTTATTTATATAAACGGGCACATGCCATGGTACCTTA 5 0.125 No Hit CTCACATTTATTTTGCCGGAAAACTGTCACGTACAAAACGTACACGGTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 45 2.0340485E-7 61.041668 1 >>END_MODULE Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080298 spots for SRR13844651.sra Written 1080298 spots for SRR13844651.sra Read 1080302 spots for SRR13844651.sra Written 1080302 spots for SRR13844651.sra SRR ids: ['SRR13844651.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pg0wmj5 SRR13844651.sra spots: 21605964 blocks: [[1, 1080298], [1080299, 2160596], [2160597, 3240894], [3240895, 4321192], [4321193, 5401490], [5401491, 6481788], [6481789, 7562086], [7562087, 8642384], [8642385, 9722682], [9722683, 10802980], [10802981, 11883278], [11883279, 12963576], [12963577, 14043874], [14043875, 15124172], [15124173, 16204470], [16204471, 17284768], [17284769, 18365066], [18365067, 19445364], [19445365, 20525662], [20525663, 21605964]] SRR13844651 file size 5210994 SRR13844651 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844651 SRR13844651_1.fastq SRR13844651_2.fastq Input file: SRR13844651_1.fastq Paired file: SRR13844651_2.fastq trimmed: SRR13844651-trimmed-pair1.fastq, SRR13844651-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:09:57 2024 >> started Fri Dec 6 13:10:19 2024 >> done (21.999s) 21605964 read pairs processed; of these: 209720 ( 0.97%) short read pairs filtered out after trimming by size control 116031 ( 0.54%) empty read pairs filtered out after trimming by size control 21280213 (98.49%) read pairs available; of these: 4382937 (20.60%) trimmed read pairs available after processing 16897276 (79.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 73 0.00% 20 127 0.00% 21 209 0.00% 22 244 0.00% 23 306 0.00% 24 381 0.00% 25 420 0.00% 26 523 0.00% 27 588 0.00% 28 685 0.00% 29 842 0.00% 30 919 0.00% 31 1036 0.00% 32 1153 0.01% 33 1283 0.01% 34 1440 0.01% 35 1623 0.01% 36 1769 0.01% 37 1846 0.01% 38 1961 0.01% 39 2054 0.01% 40 2328 0.01% 41 2589 0.01% 42 2823 0.01% 43 3058 0.01% 44 3214 0.02% 45 3411 0.02% 46 3698 0.02% 47 3837 0.02% 48 4194 0.02% 49 4390 0.02% 50 4857 0.02% 51 5284 0.02% 52 5955 0.03% 53 6910 0.03% 54 7288 0.03% 55 8315 0.04% 56 9187 0.04% 57 10826 0.05% 58 12575 0.06% 59 155781 0.73% 60 208550 0.98% 61 222143 1.04% 62 264772 1.24% 63 229035 1.08% 64 161486 0.76% 65 106457 0.50% 66 74844 0.35% 67 59014 0.28% 68 51720 0.24% 69 45246 0.21% 70 42758 0.20% 71 40888 0.19% 72 39374 0.19% 73 44084 0.21% 74 39175 0.18% 75 45719 0.21% 76 45044 0.21% 77 45135 0.21% 78 42935 0.20% 79 40601 0.19% 80 39581 0.19% 81 38802 0.18% 82 40712 0.19% 83 45125 0.21% 84 44005 0.21% 85 43753 0.21% 86 44323 0.21% 87 46245 0.22% 88 49660 0.23% 89 53291 0.25% 90 57741 0.27% 91 70009 0.33% 92 134185 0.63% 93 79058 0.37% 94 86741 0.41% 95 99080 0.47% 96 113299 0.53% 97 140601 0.66% 98 185031 0.87% 99 242527 1.14% 100 600155 2.82% 101 16897276 79.40% 21280213 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=1.02 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=173.90 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=28.9 sequence=TTTTTTTTTACCGGAGAAGAGGCGCAAAACGCCCTTGTTTTTATTTATATAAACGGGCACATGCCATGGTACCTTACATCGTCATACAGATCGAGCCAGCACTTATTTACGCTAGTACTCACTACACACACAAGTCCAAACTCTTTCACCCGCTCTGGCTCACAGCTCACCCATGCGCACGTCCGCTACCACACAAACGACAATGCCACGCACTGCCGTCACTGCCCCTCTCTGGCAGCTAGCTTCACTCACTCACAGCACTCCGGTGGCCATCCGGAGGAACGTCTCCATGTCGCCGCCGCGGCCGCCGCGGCGCCTCTCTCCCTCCTCGCCCTGCTGCTCCTGCTGCT criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.97 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=157.27 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=23.7 sequence=TTTTTTTTTACCGGAGAAGAGGCGCAAAACGCCCTTGTTTTTATTTATATAAACGGGCACATGCCATGGTACCTTACATCGTCATACAGATCGAGCCAGCACTTATTTACGCTAGTACTCACTACACACACAAGTCCAAACTCTTTCACCCGCTCTGGCTCACAGCTCACCCATGCGCACGTCCGCTACCACACAAACGACAATGCCACGCACTGCCGTCACTGCCCCTCTCTGGCAGCTAGCTTCACTCACTCACAGCACTCCGGTGGCCATCCGGAGGAACGTCTCCATGTCGCCGCCGCGGCCGCCGCGGCGCCTCTCTCCCTCCTCGCCCTGCTGCTCCTGCTGCT SRR13844651 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:11:05 Started mapping on | Dec 06 13:11:06 Finished on | Dec 06 13:12:02 Mapping speed, Million of reads per hour | 1368.01 Number of input reads | 21280213 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 19830992 Uniquely mapped reads % | 93.19% Average mapped length | 191.48 Number of splices: Total | 4575790 Number of splices: Annotated (sjdb) | 4158571 Number of splices: GT/AG | 4430706 Number of splices: GC/AG | 69094 Number of splices: AT/AC | 1915 Number of splices: Non-canonical | 74075 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 1.73 Insertion rate per base | 0.02% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 951648 % of reads mapped to multiple loci | 4.47% Number of reads mapped to too many loci | 19085 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1829245 1829245 1829245 N_multimapping 951648 951648 951648 N_noFeature 1005352 10295046 10118898 N_ambiguous 477235 30803 29995 UnstrandedReadsAssigned:18348405 PositiveStrandReadsAssigned:9505143 NegativeStrandReadsAssigned:9682099 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844651 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844651-trimmed-pair1.fastq SRR13844651-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,280,213 reads, 19,687,035 reads pseudoaligned [quant] estimated average fragment length: 161.897 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR13844651.ke.tsv 35125 SRR13844651.se.tsv 88098 total ==> SRR13844651.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.151 0 0 PNS24247 1044 883.103 0.802167 0.0576388 PNS24249 1928 1767.1 0 0 PNS24246 1044 883.103 0.802167 0.0576388 PNS24248 1044 883.103 0.802167 0.0576388 PNS24244 1471 1310.1 1120.59 54.2756 PNS24243 293 136.585 0 0 KQK14069 1603 1442.1 1381.64 60.794 KQK14071 474 313.785 22.062 4.46144 ==> SRR13844651.se.tsv <== BRADI_1g14170v3 1838 BRADI_1g53295v3 599 BRADI_1g59795v3 543 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 400 BRADI_1g74790v3 2 BRADI_1g09890v3 4 BRADI_1g77505v3 586 BRADI_1g48960v3 3 SRR13844651 completed mapping pipeline successfully