Starting /dee2/code/volunteer_pipeline.sh SRR13844652 current disk space = 1551035572224 free memory = 1591171092 SRR13844652 SRAfilesize 37636a6023d6473a5ae0a5a9293fb643 SRR13844652.sra SRR13844652.sra file validated SRR13844652 is paired end SRR13844652 is conventional basespace SRR13844652 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.292 34.0 33.0 34.0 31.0 34.0 2 33.408 34.0 34.0 34.0 31.0 34.0 3 33.42 34.0 34.0 34.0 31.0 34.0 4 36.66875 37.0 37.0 37.0 35.0 37.0 5 36.5785 37.0 37.0 37.0 35.0 37.0 6 36.617 37.0 37.0 37.0 35.0 37.0 7 36.569 37.0 37.0 37.0 35.0 37.0 8 36.547 37.0 37.0 37.0 35.0 37.0 9 38.54625 39.0 39.0 39.0 37.0 39.0 10-11 38.42125 39.0 39.0 39.0 37.0 39.0 12-13 38.51049999999999 39.0 39.0 39.0 37.0 39.0 14-15 40.15225 41.0 40.0 41.0 38.0 41.0 16-17 40.152874999999995 41.0 40.0 41.0 38.0 41.0 18-19 40.04075 41.0 40.0 41.0 38.0 41.0 20-21 39.887 41.0 40.0 41.0 38.0 41.0 22-23 39.894125 41.0 40.0 41.0 38.0 41.0 24-25 39.759375000000006 41.0 40.0 41.0 37.5 41.0 26-27 39.62075 41.0 40.0 41.0 37.5 41.0 28-29 39.588375 41.0 40.0 41.0 37.5 41.0 30-31 39.553125 41.0 40.0 41.0 38.0 41.0 32-33 39.5145 41.0 40.0 41.0 37.5 41.0 34-35 39.442125 41.0 40.0 41.0 37.0 41.0 36-37 39.370125 41.0 40.0 41.0 37.0 41.0 38-39 39.30075 41.0 40.0 41.0 37.0 41.0 40-41 39.262875 41.0 40.0 41.0 36.5 41.0 42-43 39.0395 41.0 39.0 41.0 35.5 41.0 44-45 38.960499999999996 41.0 39.0 41.0 35.0 41.0 46-47 38.854 40.5 39.0 41.0 35.0 41.0 48-49 38.832375 40.5 38.5 41.0 35.0 41.0 50-51 38.82575 41.0 39.0 41.0 35.0 41.0 52-53 38.673500000000004 40.5 38.0 41.0 35.0 41.0 54-55 38.558125000000004 40.0 38.0 41.0 35.0 41.0 56-57 38.316375 40.0 37.5 41.0 35.0 41.0 58-59 37.90575 40.0 37.0 41.0 34.0 41.0 60-61 37.860125 39.5 36.5 41.0 34.0 41.0 62-63 37.792625 39.0 36.0 41.0 35.0 41.0 64-65 37.52425 39.0 35.5 41.0 34.0 41.0 66-67 37.21425 38.5 35.0 41.0 34.0 41.0 68-69 36.886125 37.0 35.0 40.5 34.0 41.0 70-71 36.464749999999995 37.0 35.0 39.5 34.0 41.0 72-73 36.120000000000005 36.5 35.0 39.0 34.0 41.0 74-75 35.576499999999996 36.0 35.0 38.5 33.5 40.5 76-77 34.799875 35.0 34.5 37.0 31.5 39.0 78-79 34.772875 35.0 35.0 37.0 32.0 39.0 80-81 34.627125 35.0 35.0 36.5 33.0 39.0 82-83 34.369749999999996 35.0 35.0 36.0 33.0 37.0 84-85 34.0305 35.0 35.0 36.0 32.0 37.0 86-87 34.0 35.0 35.0 35.5 32.5 36.5 88-89 33.83125 35.0 35.0 35.0 32.0 36.0 90-91 33.827124999999995 35.0 35.0 35.0 33.0 36.0 92-93 33.635374999999996 35.0 35.0 35.0 32.0 36.0 94-95 33.601749999999996 35.0 35.0 35.0 32.5 36.0 96-97 33.516 35.0 35.0 35.0 32.5 36.0 98-99 33.36575 35.0 35.0 35.0 32.0 35.0 100-101 32.131625 34.5 33.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 6.0 9 6.0 10 6.0 11 5.0 12 7.0 13 2.0 14 1.0 15 0.0 16 3.0 17 3.0 18 4.0 19 3.0 20 4.0 21 6.0 22 2.0 23 9.0 24 9.0 25 5.0 26 6.0 27 11.0 28 16.0 29 24.0 30 22.0 31 34.0 32 40.0 33 57.0 34 86.0 35 156.0 36 358.0 37 977.0 38 1656.0 39 474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.47247247247247 17.61761761761762 10.51051051051051 49.3993993993994 2 16.625 20.025000000000002 48.525 14.825 3 21.0 23.849999999999998 26.85 28.299999999999997 4 25.25 28.775000000000002 25.3 20.674999999999997 5 26.150000000000002 30.875000000000004 27.125 15.85 6 19.325 35.325 30.099999999999998 15.25 7 16.8 18.4 47.375 17.424999999999997 8 17.150000000000002 22.5 38.25 22.1 9 19.650000000000002 20.474999999999998 38.375 21.5 10-11 22.0125 31.125000000000004 27.462500000000002 19.400000000000002 12-13 19.8 26.6125 33.15 20.4375 14-15 21.575 27.0625 31.2 20.1625 16-17 21.8 26.7625 29.562500000000004 21.875 18-19 21.7875 27.712500000000002 28.9375 21.5625 20-21 22.3875 27.875 28.262500000000003 21.475 22-23 22.900000000000002 27.9125 28.6375 20.549999999999997 24-25 22.6 27.975 27.6125 21.8125 26-27 22.9625 27.775 27.737499999999997 21.525 28-29 22.400000000000002 27.0625 28.5875 21.95 30-31 22.4875 29.075 27.1375 21.3 32-33 22.475 27.9375 27.3875 22.2 34-35 22.6875 27.875 27.500000000000004 21.9375 36-37 22.45 28.4 26.775 22.375 38-39 23.6375 27.237499999999997 27.187499999999996 21.9375 40-41 22.175 27.025 28.825 21.975 42-43 22.325 27.575 27.6125 22.4875 44-45 22.45 27.437499999999996 27.437499999999996 22.675 46-47 22.5625 28.1875 27.437499999999996 21.8125 48-49 22.1875 27.5625 28.3875 21.8625 50-51 22.375 28.075 28.15 21.4 52-53 22.2 27.55 27.925 22.325 54-55 23.0625 27.6 27.8625 21.475 56-57 22.05 28.037499999999998 28.287499999999998 21.625 58-59 22.425 27.5125 28.1 21.9625 60-61 22.75 26.700000000000003 27.975 22.575 62-63 21.675 27.712500000000002 27.8625 22.75 64-65 22.3125 28.1875 27.037499999999998 22.4625 66-67 22.237499999999997 28.287499999999998 26.5 22.975 68-69 21.3875 28.3625 27.450000000000003 22.8 70-71 23.150000000000002 27.6625 27.6875 21.5 72-73 21.987499999999997 28.3625 27.187499999999996 22.4625 74-75 21.2625 28.5625 27.6875 22.4875 76-77 22.6 28.000000000000004 28.125 21.275 78-79 22.4875 28.199999999999996 27.125 22.1875 80-81 22.525000000000002 27.987499999999997 27.6125 21.875 82-83 22.925 28.012500000000003 27.200000000000003 21.8625 84-85 22.2125 27.487499999999997 28.000000000000004 22.3 86-87 21.9375 27.6875 28.0875 22.287499999999998 88-89 22.0875 28.3625 27.712500000000002 21.837500000000002 90-91 22.8 28.237499999999997 26.700000000000003 22.2625 92-93 22.3625 28.3125 27.125 22.2 94-95 22.8875 28.15 26.724999999999998 22.237499999999997 96-97 22.3875 29.275000000000002 26.625 21.712500000000002 98-99 22.3375 29.912499999999998 26.5625 21.1875 100-101 21.820682756033513 28.83581343003626 27.235213204951858 22.10829060897837 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.5 22 3.0 23 2.5 24 1.5 25 3.5 26 7.0 27 7.5 28 12.5 29 18.0 30 18.0 31 26.0 32 41.5 33 70.0 34 88.5 35 89.5 36 115.0 37 149.0 38 174.5 39 198.5 40 215.5 41 212.5 42 214.0 43 242.0 44 239.0 45 212.0 46 197.5 47 177.0 48 159.0 49 165.0 50 146.0 51 108.0 52 98.5 53 81.5 54 72.0 55 74.5 56 64.5 57 49.5 58 33.5 59 26.5 60 24.5 61 22.5 62 21.0 63 22.0 64 19.5 65 13.0 66 10.5 67 7.5 68 5.5 69 7.0 70 6.5 71 5.5 72 5.5 73 3.5 74 2.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 96.94277501959759 92.75 2 2.273321139273582 4.35 3 0.5487326887901751 1.575 4 0.10452051215050953 0.4 5 0.026130128037627383 0.125 6 0.026130128037627383 0.15 7 0.026130128037627383 0.17500000000000002 8 0.0 0.0 9 0.026130128037627383 0.22499999999999998 >10 0.026130128037627383 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACATACGTAC 10 0.25 No Hit CGATCATCTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACA 9 0.22499999999999998 No Hit CTGGTTTTCTCTTTGTGATTGAATCAATTGAGGAGAGGATACGACTTCTC 7 0.17500000000000002 No Hit CTGTGTTCCGTGTGTGTTTCAGCAGTGTGCTGTGCTGAGTGCTACCTTGA 6 0.15 No Hit GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844652 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99075 34.0 33.0 34.0 31.0 34.0 2 33.01525 34.0 33.0 34.0 31.0 34.0 3 32.94125 34.0 33.0 34.0 31.0 34.0 4 36.3125 37.0 37.0 37.0 35.0 37.0 5 36.244 37.0 37.0 37.0 35.0 37.0 6 36.2845 37.0 37.0 37.0 35.0 37.0 7 36.36075 37.0 37.0 37.0 35.0 37.0 8 36.31875 37.0 37.0 37.0 35.0 37.0 9 38.21075 39.0 39.0 39.0 37.0 39.0 10-11 38.008375 39.0 39.0 39.0 37.0 39.0 12-13 37.847125 39.0 39.0 39.0 37.0 39.0 14-15 39.39725 41.0 40.0 41.0 37.5 41.0 16-17 39.406875 41.0 40.0 41.0 37.5 41.0 18-19 39.053375 41.0 40.0 41.0 37.0 41.0 20-21 38.906625 41.0 40.0 41.0 37.0 41.0 22-23 38.741125 41.0 40.0 41.0 36.5 41.0 24-25 38.917 41.0 40.0 41.0 37.0 41.0 26-27 38.833625 41.0 40.0 41.0 36.5 41.0 28-29 38.85325 41.0 40.0 41.0 36.0 41.0 30-31 38.723 41.0 40.0 41.0 36.0 41.0 32-33 38.663624999999996 41.0 40.0 41.0 36.0 41.0 34-35 38.450375 41.0 39.5 41.0 34.5 41.0 36-37 38.361125 41.0 39.0 41.0 35.0 41.0 38-39 38.21825 41.0 39.0 41.0 34.5 41.0 40-41 37.971625 40.5 38.5 41.0 33.5 41.0 42-43 37.841125 40.0 38.5 41.0 33.5 41.0 44-45 37.62175 40.0 38.0 41.0 33.5 41.0 46-47 37.34825 40.0 38.0 41.0 33.0 41.0 48-49 37.12175 40.0 38.0 41.0 33.0 41.0 50-51 36.344750000000005 39.5 37.0 40.5 32.0 41.0 52-53 36.50425 39.5 37.0 40.5 31.5 41.0 54-55 36.880250000000004 40.0 37.0 41.0 32.0 41.0 56-57 36.964 40.0 37.0 41.0 32.5 41.0 58-59 37.01625 40.0 37.0 41.0 33.0 41.0 60-61 36.84125 40.0 36.0 41.0 33.0 41.0 62-63 36.305 39.0 35.0 41.0 31.5 41.0 64-65 36.192 39.0 35.0 41.0 32.0 41.0 66-67 35.64125 38.0 35.0 41.0 31.5 41.0 68-69 35.135625000000005 37.0 35.0 40.0 31.0 41.0 70-71 34.75475 36.5 35.0 39.0 31.0 41.0 72-73 34.143 36.0 35.0 39.0 29.5 41.0 74-75 33.415125 35.0 35.0 37.5 26.5 40.0 76-77 33.342875 35.0 35.0 37.0 28.5 39.0 78-79 33.20025 35.0 35.0 37.0 29.0 39.0 80-81 32.833375000000004 35.0 34.5 36.0 28.5 38.0 82-83 32.368125000000006 35.0 34.5 36.0 27.0 37.0 84-85 28.819125 35.0 31.5 35.0 2.0 37.0 86-87 28.985 35.0 32.0 35.0 2.0 36.0 88-89 29.12775 35.0 33.0 35.0 2.0 36.0 90-91 29.350749999999998 35.0 32.5 35.0 2.0 36.0 92-93 29.557875000000003 35.0 33.0 35.0 2.0 36.0 94-95 29.405375 35.0 33.0 35.0 2.0 35.5 96-97 29.34525 35.0 32.5 35.0 2.0 35.0 98-99 29.248375 35.0 32.5 35.0 2.0 35.0 100-101 28.177750000000003 34.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 3.0 5 4.0 6 24.0 7 16.0 8 27.0 9 13.0 10 23.0 11 8.0 12 14.0 13 9.0 14 6.0 15 7.0 16 13.0 17 3.0 18 2.0 19 7.0 20 9.0 21 12.0 22 12.0 23 19.0 24 22.0 25 23.0 26 12.0 27 17.0 28 18.0 29 29.0 30 53.0 31 89.0 32 166.0 33 93.0 34 118.0 35 188.0 36 364.0 37 853.0 38 1340.0 39 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.55 16.725 10.725 48.0 2 16.900000000000002 19.5 48.9 14.7 3 21.625 24.025 26.700000000000003 27.650000000000002 4 24.725 29.849999999999998 24.7 20.724999999999998 5 24.875 31.0 27.950000000000003 16.175 6 18.475 36.425000000000004 28.749999999999996 16.35 7 17.025000000000002 17.925 47.575 17.474999999999998 8 16.400000000000002 23.9 37.824999999999996 21.875 9 19.034517258629315 20.485242621310658 38.494247123561784 21.98599299649825 10-11 22.572937625754527 30.91046277665996 27.71629778672032 18.800301810865193 12-13 20.29459901800327 25.242351756263375 33.463426916782076 20.999622308951277 14-15 21.5311004784689 26.580206497104005 31.64190380256862 20.246789221858474 16-17 21.926952141057935 26.03274559193955 30.45340050377834 21.58690176322418 18-19 22.492093611638204 27.42567994939911 29.69006957621758 20.392156862745097 20-21 22.589636386671735 28.379576840238187 28.848346636259976 20.182440136830103 22-23 22.51480408214691 28.008063500062995 27.680483810003782 21.796648607786317 24-25 22.814258911819888 28.417761100687933 27.091932457786115 21.676047529706068 26-27 21.6125 28.787499999999998 26.974999999999998 22.625 28-29 22.275 29.037499999999998 26.337500000000002 22.35 30-31 23.05 26.8375 28.000000000000004 22.112499999999997 32-33 22.775000000000002 27.975 27.025 22.225 34-35 22.662499999999998 28.3625 26.8 22.175 36-37 23.0125 27.474999999999998 27.3375 22.175 38-39 22.7375 28.075 27.450000000000003 21.7375 40-41 22.11646837820914 28.165309956167818 27.78960551033187 21.92861615529117 42-43 22.0534705660851 28.793774319066145 26.446592192795283 22.706162922053473 44-45 22.70725877468864 27.299031324694926 28.0035224556548 21.99018744496163 46-47 22.33169129720854 27.800934697486422 28.10407982821776 21.763294177087282 48-49 21.84670322662926 28.988649406963397 27.10113505930366 22.063512307103686 50-51 21.43223819301848 28.003080082135522 28.298254620123203 22.26642710472279 52-53 22.497459349593495 28.074186991869922 27.38821138211382 22.040142276422763 54-55 21.61006289308176 27.861635220125784 28.138364779874216 22.38993710691824 56-57 22.72898605352431 28.295011936172887 26.448046236964444 22.52795577333836 58-59 21.69159230865904 28.47806962423024 27.007666205856477 22.822671861254243 60-61 21.429468659716118 29.355608591885442 26.54189172214546 22.673031026252982 62-63 22.133099385887956 27.710239378368218 27.38438400802106 22.772277227722775 64-65 21.37289414131255 28.94141312547146 26.91727432738245 22.768418405833543 66-67 23.49504699009398 27.774955549911102 27.114554229108457 21.61544323088646 68-69 22.127170582226764 28.000510725229827 27.872829417773236 21.999489274770173 70-71 22.34872713317129 28.27171549187668 27.427401816553665 21.952155558398363 72-73 22.1852183937492 28.70500832586141 26.719610605866528 22.390162674522866 74-75 22.323258196721312 27.779200819672127 27.39497950819672 22.502561475409834 76-77 22.341513292433536 28.514826175869118 26.444274028629856 22.699386503067483 78-79 21.685666709363392 28.833098501344946 27.47534264121942 22.005892148072242 80-81 22.052067381317 27.603369065849925 27.37366003062787 22.97090352220521 82-83 22.521728177352312 29.0590754503086 26.72880715455347 21.690389217785615 84-85 23.11456534254462 27.677029360967186 26.899827288428323 22.30857800805987 86-87 22.160625444207536 27.590618336886997 27.40582800284293 22.842928216062543 88-89 22.738693467336685 28.8107202680067 27.568397543271917 20.8821887213847 90-91 22.551440329218106 28.25788751714678 27.105624142661178 22.08504801097394 92-93 22.462380300957594 28.01641586867305 27.428180574555405 22.093023255813954 94-95 22.621332602138743 28.598848368522074 26.802851658897726 21.976967370441457 96-97 22.850954379315013 28.996886422092867 25.653174495735755 22.49898470285637 98-99 22.86367918180595 29.161620239537072 26.833535190418516 21.141165388238463 100-101 23.003194888178914 28.10170394036209 26.757188498402556 22.13791267305644 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 2.0 10 3.5 11 4.0 12 3.5 13 4.0 14 4.5 15 4.0 16 3.0 17 2.5 18 3.0 19 6.0 20 8.0 21 6.0 22 7.5 23 8.0 24 11.0 25 19.0 26 17.5 27 15.0 28 23.0 29 29.5 30 35.0 31 45.5 32 57.5 33 68.5 34 87.5 35 112.0 36 126.0 37 137.5 38 161.0 39 195.0 40 210.0 41 226.5 42 226.0 43 198.0 44 189.0 45 186.5 46 178.5 47 161.0 48 161.5 49 160.5 50 131.5 51 108.0 52 102.0 53 86.5 54 68.0 55 61.0 56 53.0 57 40.0 58 33.5 59 30.5 60 22.5 61 18.0 62 16.0 63 15.5 64 16.5 65 15.0 66 9.5 67 11.5 68 11.5 69 8.5 70 8.0 71 6.0 72 4.0 73 4.0 74 2.5 75 1.0 76 2.5 77 2.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-11 0.6 12-13 0.7125 14-15 0.7250000000000001 16-17 0.75 18-19 1.1875 20-21 1.3375 22-23 0.7875 24-25 0.0625 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.1875 42-43 0.41250000000000003 44-45 0.6375 46-47 1.0375 48-49 1.9875 50-51 2.6 52-53 1.6 54-55 0.625 56-57 0.5125000000000001 58-59 0.5375 60-61 0.4875 62-63 0.2625 64-65 0.575 66-67 1.575 68-69 2.1 70-71 2.2875 72-73 2.4125 74-75 2.4 76-77 2.1999999999999997 78-79 2.4125 80-81 2.0500000000000003 82-83 0.7625 84-85 13.15 86-87 12.0625 88-89 10.45 90-91 8.875 92-93 8.625 94-95 8.825 96-97 7.6625 98-99 7.112499999999999 100-101 6.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 96.85369690613528 92.35 2 2.3335081279496594 4.45 3 0.4457262716308337 1.275 4 0.13109596224436287 0.5 5 0.1048767697954903 0.5 6 0.026219192448872573 0.15 7 0.05243838489774515 0.35000000000000003 8 0.026219192448872573 0.2 9 0.026219192448872573 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGTTTTCTCTTTGTGATTGAATCAATTGAGGAGAGGATACGACTTCTC 9 0.22499999999999998 No Hit GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 8 0.2 No Hit CTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACATACGTAC 7 0.17500000000000002 No Hit GTGCAATTTGTTTTGACTTATTTCCCTTCGGTTATTCTGTGAAGCAGCCA 7 0.17500000000000002 No Hit GTGTGTTTCAGCAGTGTGCTGTGCTGAGTGCTACCTTGATGTGGCGTGTG 6 0.15 No Hit CGATCATCTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACA 5 0.125 No Hit CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 5 0.125 No Hit GGCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTT 5 0.125 No Hit CTGTGTTCCGTGTGTGTTTCAGCAGTGTGCTGTGCTGAGTGCTACCTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018505 spots for SRR13844652.sra Written 1018505 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra Read 1018495 spots for SRR13844652.sra Written 1018495 spots for SRR13844652.sra SRR ids: ['SRR13844652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9wp45f9_ SRR13844652.sra spots: 20369910 blocks: [[1, 1018495], [1018496, 2036990], [2036991, 3055485], [3055486, 4073980], [4073981, 5092475], [5092476, 6110970], [6110971, 7129465], [7129466, 8147960], [8147961, 9166455], [9166456, 10184950], [10184951, 11203445], [11203446, 12221940], [12221941, 13240435], [13240436, 14258930], [14258931, 15277425], [15277426, 16295920], [16295921, 17314415], [17314416, 18332910], [18332911, 19351405], [19351406, 20369910]] SRR13844652 file size 4911637 SRR13844652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844652 SRR13844652_1.fastq SRR13844652_2.fastq Input file: SRR13844652_1.fastq Paired file: SRR13844652_2.fastq trimmed: SRR13844652-trimmed-pair1.fastq, SRR13844652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:16:31 2024 >> started Fri Dec 6 13:16:53 2024 >> done (21.335s) 20369910 read pairs processed; of these: 187856 ( 0.92%) short read pairs filtered out after trimming by size control 121089 ( 0.59%) empty read pairs filtered out after trimming by size control 20060965 (98.48%) read pairs available; of these: 3261142 (16.26%) trimmed read pairs available after processing 16799823 (83.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 21 0.00% 20 42 0.00% 21 92 0.00% 22 77 0.00% 23 128 0.00% 24 150 0.00% 25 181 0.00% 26 226 0.00% 27 421 0.00% 28 358 0.00% 29 387 0.00% 30 490 0.00% 31 618 0.00% 32 675 0.00% 33 822 0.00% 34 860 0.00% 35 1059 0.01% 36 1226 0.01% 37 1395 0.01% 38 1577 0.01% 39 1858 0.01% 40 2149 0.01% 41 2381 0.01% 42 2737 0.01% 43 3126 0.02% 44 3494 0.02% 45 4147 0.02% 46 4935 0.02% 47 5340 0.03% 48 5971 0.03% 49 6762 0.03% 50 7058 0.04% 51 7781 0.04% 52 8096 0.04% 53 8658 0.04% 54 9422 0.05% 55 10217 0.05% 56 11320 0.06% 57 11766 0.06% 58 13207 0.07% 59 71889 0.36% 60 78570 0.39% 61 68339 0.34% 62 69197 0.34% 63 67294 0.34% 64 53927 0.27% 65 43591 0.22% 66 36384 0.18% 67 33332 0.17% 68 32199 0.16% 69 30209 0.15% 70 30613 0.15% 71 30233 0.15% 72 30612 0.15% 73 31317 0.16% 74 32816 0.16% 75 39552 0.20% 76 47182 0.24% 77 46528 0.23% 78 42923 0.21% 79 39795 0.20% 80 38492 0.19% 81 37677 0.19% 82 38562 0.19% 83 40904 0.20% 84 41083 0.20% 85 42115 0.21% 86 43713 0.22% 87 46056 0.23% 88 48843 0.24% 89 51625 0.26% 90 57930 0.29% 91 70316 0.35% 92 132919 0.66% 93 77075 0.38% 94 84078 0.42% 95 92910 0.46% 96 110078 0.55% 97 133594 0.67% 98 169548 0.85% 99 231711 1.16% 100 574164 2.86% 101 16799823 83.74% 20060965 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=26 prefix-density=0.90 prefix-fanout=2.3 sequence=TACGTACGCGCGTACGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=115.56 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.2 sequence=TGTGTGTGTATGTGTGAGCTGGGGGTGTCCGGTTCGTGTGCGCCCCGTGGTTATACTTGCAGGGGGTGGTTGTTAATTTTGCTTTCTTCATACTATGTCAACAAGATGAGGTGATGCTTAATTTGGCTTGGCCCGGGGGTTAACGTAGGCCAGACCAAAGATAAGGCACACGATCAA criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=30 prefix-density=0.91 prefix-fanout=2.0 sequence=ACCGTACGTACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=78.26 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.0 sequence=TGTGTGTATGTGTGAGCTGGGGGTGTCCGGTTCGTGTGCGCCCCGTGGTTATACTTGCAGGGGGTGGTTGTTAATTTTGCTTTCTTCATACTATGTCAACAAGATGAGGTGATGCTTAATTTGGCTTGGCCCGGGGGTTAACGTAGGCCAGACCAAAGATAAGGCACACGATCA SRR13844652 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:17:39 Started mapping on | Dec 06 13:17:39 Finished on | Dec 06 13:18:26 Mapping speed, Million of reads per hour | 1536.58 Number of input reads | 20060965 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 18772844 Uniquely mapped reads % | 93.58% Average mapped length | 196.34 Number of splices: Total | 4303138 Number of splices: Annotated (sjdb) | 3954494 Number of splices: GT/AG | 4188030 Number of splices: GC/AG | 56207 Number of splices: AT/AC | 1469 Number of splices: Non-canonical | 57432 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.02% Deletion average length | 1.70 Insertion rate per base | 0.02% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 765874 % of reads mapped to multiple loci | 3.82% Number of reads mapped to too many loci | 6013 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 918663 918663 918663 N_multimapping 765874 765874 765874 N_noFeature 659924 9622813 9261092 N_ambiguous 648155 50829 52586 UnstrandedReadsAssigned:17464765 PositiveStrandReadsAssigned:9099202 NegativeStrandReadsAssigned:9459166 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844652-trimmed-pair1.fastq SRR13844652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,060,965 reads, 18,898,115 reads pseudoaligned [quant] estimated average fragment length: 157.449 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR13844652.ke.tsv 35125 SRR13844652.se.tsv 88098 total ==> SRR13844652.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.592 0 0 PNS24247 1044 887.551 0.382454 0.0292718 PNS24249 1928 1771.55 3.87648 0.148644 PNS24246 1044 887.551 0.382454 0.0292718 PNS24248 1044 887.551 0.382454 0.0292718 PNS24244 1471 1314.55 375.976 19.4288 PNS24243 293 139.854 0 0 KQK14069 1603 1446.55 7322.45 343.864 KQK14071 474 318.107 50.2312 10.7267 ==> SRR13844652.se.tsv <== BRADI_1g14170v3 7869 BRADI_1g53295v3 59 BRADI_1g59795v3 301 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 517 BRADI_1g74790v3 201 BRADI_1g09890v3 220 BRADI_1g77505v3 417 BRADI_1g48960v3 0 SRR13844652 completed mapping pipeline successfully