Starting /dee2/code/volunteer_pipeline.sh SRR14125743 current disk space = 1506881683456 free memory = 1366744968 SRR14125743 SRAfilesize de18d2522528567860882ad9c0cfe865 SRR14125743.sra SRR14125743.sra file validated SRR14125743 is single end SRR14125743 is conventional basespace SRR14125743 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14125743_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.015 34.0 33.0 34.0 32.0 34.0 2 33.192 34.0 33.0 34.0 32.0 34.0 3 33.2145 34.0 33.0 34.0 33.0 34.0 4 33.17525 34.0 33.0 34.0 32.0 34.0 5 33.27525 34.0 33.0 34.0 33.0 34.0 6 36.88375 38.0 38.0 38.0 35.0 38.0 7 36.9455 38.0 38.0 38.0 35.0 38.0 8 36.9995 38.0 38.0 38.0 36.0 38.0 9 37.01 38.0 38.0 38.0 36.0 38.0 10 37.105 38.0 38.0 38.0 36.0 38.0 11 37.1495 38.0 38.0 38.0 36.0 38.0 12 37.2155 38.0 38.0 38.0 36.0 38.0 13 37.171 38.0 38.0 38.0 36.0 38.0 14 37.0485 38.0 38.0 38.0 36.0 38.0 15 37.1495 38.0 38.0 38.0 36.0 38.0 16 37.22525 38.0 38.0 38.0 36.0 38.0 17 37.204 38.0 38.0 38.0 36.0 38.0 18 37.14475 38.0 38.0 38.0 36.0 38.0 19 37.1635 38.0 38.0 38.0 36.0 38.0 20 37.15275 38.0 38.0 38.0 36.0 38.0 21 37.1545 38.0 38.0 38.0 36.0 38.0 22 37.1105 38.0 38.0 38.0 36.0 38.0 23 37.163 38.0 38.0 38.0 36.0 38.0 24 37.23425 38.0 38.0 38.0 36.0 38.0 25 37.21425 38.0 38.0 38.0 37.0 38.0 26 37.2505 38.0 38.0 38.0 37.0 38.0 27 37.1535 38.0 38.0 38.0 36.0 38.0 28 37.15975 38.0 38.0 38.0 36.0 38.0 29 37.22425 38.0 38.0 38.0 36.0 38.0 30 37.181 38.0 38.0 38.0 36.0 38.0 31 37.0965 38.0 38.0 38.0 36.0 38.0 32 37.08075 38.0 38.0 38.0 36.0 38.0 33 37.1685 38.0 38.0 38.0 37.0 38.0 34 37.23025 38.0 38.0 38.0 36.0 38.0 35 37.21225 38.0 38.0 38.0 36.0 38.0 36 37.14675 38.0 38.0 38.0 36.0 38.0 37 37.172 38.0 38.0 38.0 36.0 38.0 38 37.147 38.0 38.0 38.0 36.0 38.0 39 37.1115 38.0 38.0 38.0 36.0 38.0 40 37.19125 38.0 38.0 38.0 36.0 38.0 41 37.1555 38.0 38.0 38.0 36.0 38.0 42 37.124 38.0 38.0 38.0 36.0 38.0 43 37.2085 38.0 38.0 38.0 36.0 38.0 44 37.132 38.0 38.0 38.0 36.0 38.0 45 37.11675 38.0 38.0 38.0 36.0 38.0 46 37.21625 38.0 38.0 38.0 36.0 38.0 47 37.17975 38.0 38.0 38.0 36.0 38.0 48 37.04 38.0 38.0 38.0 36.0 38.0 49 37.21075 38.0 38.0 38.0 36.0 38.0 50 37.1805 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 2.0 24 0.0 25 2.0 26 7.0 27 8.0 28 11.0 29 38.0 30 30.0 31 24.0 32 73.0 33 70.0 34 129.0 35 218.0 36 481.0 37 2905.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.240684793554884 10.171198388721049 8.534743202416918 29.053373615307148 2 22.536268134067033 11.205602801400701 36.26813406703352 29.989994997498748 3 19.75 18.025 27.800000000000004 34.425 4 26.700000000000003 23.400000000000002 23.025000000000002 26.875 5 25.55 29.225 24.65 20.575 6 21.275 29.625 25.650000000000002 23.45 7 19.025 23.724999999999998 37.475 19.775000000000002 8 19.35 22.7 32.75 25.2 9 20.25 22.325 32.275 25.15 10 21.875 32.875 25.7 19.55 11 25.95 25.174999999999997 22.375 26.5 12 23.625 23.724999999999998 25.724999999999998 26.924999999999997 13 22.650000000000002 24.5 28.249999999999996 24.6 14 21.275 24.825 28.299999999999997 25.6 15 22.5 24.85 25.45 27.200000000000003 16 24.2 25.275 24.675 25.85 17 23.400000000000002 26.525 25.75 24.325 18 24.275 26.05 24.625 25.05 19 24.025 26.325 23.825 25.825 20 22.575 25.45 26.325 25.650000000000002 21 22.525000000000002 26.0 26.474999999999998 25.0 22 23.45 25.674999999999997 25.4 25.474999999999998 23 24.425 26.025 24.625 24.925 24 24.025 25.624999999999996 25.224999999999998 25.124999999999996 25 23.825 26.474999999999998 24.474999999999998 25.224999999999998 26 24.15 25.4 25.05 25.4 27 22.725 25.974999999999998 25.775 25.525 28 24.85 26.825 23.225 25.1 29 23.200000000000003 26.650000000000002 25.650000000000002 24.5 30 22.2 26.775 26.0 25.025 31 24.474999999999998 24.45 25.05 26.025 32 23.150000000000002 25.974999999999998 25.650000000000002 25.224999999999998 33 23.45 24.6 25.2 26.75 34 24.325 26.5 23.400000000000002 25.775 35 22.55 25.575 26.5 25.374999999999996 36 23.474999999999998 25.224999999999998 24.825 26.474999999999998 37 25.0 26.05 23.325000000000003 25.624999999999996 38 23.549999999999997 26.35 26.275 23.825 39 23.175 24.8 25.75 26.275 40 25.3 24.975 24.8 24.925 41 22.7 26.625 25.624999999999996 25.05 42 23.75 25.25 26.200000000000003 24.8 43 23.825 25.874999999999996 24.775 25.525 44 24.125 24.625 26.025 25.224999999999998 45 22.1 25.674999999999997 25.124999999999996 27.1 46 23.75 26.575 24.725 24.95 47 23.95 24.975 25.974999999999998 25.1 48 23.549999999999997 24.775 25.1 26.575 49 24.474999999999998 25.775 24.25 25.5 50 22.0 26.174999999999997 25.825 26.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 1.5 18 2.0 19 2.5 20 3.0 21 4.0 22 5.0 23 5.5 24 6.0 25 6.0 26 6.0 27 14.0 28 22.0 29 24.5 30 27.0 31 45.0 32 63.0 33 80.5 34 98.0 35 116.0 36 134.0 37 158.0 38 182.0 39 212.5 40 243.0 41 275.0 42 307.0 43 315.0 44 323.0 45 345.5 46 368.0 47 343.5 48 319.0 49 321.5 50 324.0 51 313.5 52 303.0 53 264.0 54 225.0 55 212.5 56 200.0 57 176.5 58 153.0 59 150.5 60 148.0 61 136.0 62 124.0 63 115.0 64 106.0 65 91.0 66 76.0 67 70.5 68 65.0 69 58.0 70 51.0 71 46.5 72 42.0 73 34.0 74 26.0 75 26.5 76 27.0 77 19.0 78 11.0 79 9.0 80 7.0 81 4.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004698 READS because READLEN < 1 Read 1004698 spots for SRR14125743.sra Written 1004698 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra Rejected 1004686 READS because READLEN < 1 Read 1004686 spots for SRR14125743.sra Written 1004686 spots for SRR14125743.sra SRR ids: ['SRR14125743.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_opzsx21k SRR14125743.sra spots: 20093732 blocks: [[1, 1004686], [1004687, 2009372], [2009373, 3014058], [3014059, 4018744], [4018745, 5023430], [5023431, 6028116], [6028117, 7032802], [7032803, 8037488], [8037489, 9042174], [9042175, 10046860], [10046861, 11051546], [11051547, 12056232], [12056233, 13060918], [13060919, 14065604], [14065605, 15070290], [15070291, 16074976], [16074977, 17079662], [17079663, 18084348], [18084349, 19089034], [19089035, 20093732]] SRR14125743 file size 2823603 SRR14125743 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14125743 SRR14125743_1.fastq Input file: SRR14125743_1.fastq trimmed: SRR14125743-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sun Dec 8 15:51:56 2024 >> started Sun Dec 8 15:52:38 2024 >> done (41.654s) 20093732 reads processed; of these: 320 ( 0.00%) short reads filtered out after trimming by size control 6766 ( 0.03%) empty reads filtered out after trimming by size control 20086646 (99.96%) reads available; of these: 3234 ( 0.02%) trimmed reads available after processing 20083412 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 5 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 29 0.00% 45 786 0.00% 46 173 0.00% 47 1222 0.01% 48 385 0.00% 49 627 0.00% 50 20083412 99.98% 20086646 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=23 prefix-density=0.00 prefix-fanout=1.0 sequence=TTTTTTTTTTGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=20 fanout-score=201.31 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=21.5 sequence=TCTTCTTCTTGTC Started job on | Dec 08 15:53:52 Started mapping on | Dec 08 15:53:53 Finished on | Dec 08 15:56:10 Mapping speed, Million of reads per hour | 527.82 Number of input reads | 20086646 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 18631595 Uniquely mapped reads % | 92.76% Average mapped length | 49.81 Number of splices: Total | 2845289 Number of splices: Annotated (sjdb) | 2749142 Number of splices: GT/AG | 2804665 Number of splices: GC/AG | 35217 Number of splices: AT/AC | 1915 Number of splices: Non-canonical | 3492 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 548318 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 626110 % of reads mapped to too many loci | 3.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 906733 906733 906733 N_multimapping 548318 548318 548318 N_noFeature 747393 18250509 856690 N_ambiguous 290605 1315 20328 UnstrandedReadsAssigned:17593597 PositiveStrandReadsAssigned:379771 NegativeStrandReadsAssigned:17754577 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR14125743 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR14125743-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,086,646 reads, 17,695,079 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 SRR14125743.ke.tsv 35125 SRR14125743.se.tsv 88098 total ==> SRR14125743.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 70.5621 7.89392 PNS24247 1044 945 36.2331 3.59021 PNS24249 1928 1829 94.4352 4.83467 PNS24246 1044 945 36.2331 3.59021 PNS24248 1044 945 36.2331 3.59021 PNS24244 1471 1372 175.303 11.9642 PNS24243 293 194 0 0 KQK14069 1603 1504 288.817 17.9813 KQK14071 474 375 52.7204 13.1642 ==> SRR14125743.se.tsv <== BRADI_1g14170v3 413 BRADI_1g53295v3 107 BRADI_1g59795v3 299 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 1561 BRADI_1g74790v3 490 BRADI_1g09890v3 0 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR14125743 completed mapping pipeline successfully