Starting /dee2/code/volunteer_pipeline.sh SRR14125744 current disk space = 1506684432384 free memory = 1370760476 SRR14125744 SRAfilesize 11d9fcc7b6581b500329476f50c35b97 SRR14125744.sra SRR14125744.sra file validated SRR14125744 is single end SRR14125744 is conventional basespace SRR14125744 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14125744_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92175 34.0 33.0 34.0 32.0 34.0 2 33.16325 34.0 33.0 34.0 32.0 34.0 3 33.20775 34.0 33.0 34.0 32.0 34.0 4 33.15775 34.0 33.0 34.0 32.0 34.0 5 33.242 34.0 33.0 34.0 33.0 34.0 6 36.744 38.0 38.0 38.0 34.0 38.0 7 36.98425 38.0 38.0 38.0 36.0 38.0 8 36.9665 38.0 38.0 38.0 36.0 38.0 9 37.0585 38.0 38.0 38.0 36.0 38.0 10 36.9725 38.0 38.0 38.0 36.0 38.0 11 36.981 38.0 38.0 38.0 36.0 38.0 12 37.13075 38.0 38.0 38.0 36.0 38.0 13 37.14175 38.0 38.0 38.0 36.0 38.0 14 37.01075 38.0 38.0 38.0 36.0 38.0 15 37.0925 38.0 38.0 38.0 36.0 38.0 16 37.17225 38.0 38.0 38.0 36.0 38.0 17 37.1895 38.0 38.0 38.0 36.0 38.0 18 37.12775 38.0 38.0 38.0 36.0 38.0 19 37.174 38.0 38.0 38.0 36.0 38.0 20 37.14925 38.0 38.0 38.0 36.0 38.0 21 37.17575 38.0 38.0 38.0 36.0 38.0 22 37.13 38.0 38.0 38.0 36.0 38.0 23 37.195 38.0 38.0 38.0 36.0 38.0 24 37.0835 38.0 38.0 38.0 36.0 38.0 25 37.151 38.0 38.0 38.0 36.0 38.0 26 37.13575 38.0 38.0 38.0 36.0 38.0 27 37.135 38.0 38.0 38.0 36.0 38.0 28 37.06825 38.0 38.0 38.0 36.0 38.0 29 37.1355 38.0 38.0 38.0 36.0 38.0 30 37.0825 38.0 38.0 38.0 36.0 38.0 31 37.1055 38.0 38.0 38.0 36.0 38.0 32 36.98925 38.0 38.0 38.0 36.0 38.0 33 37.076 38.0 38.0 38.0 36.0 38.0 34 37.07975 38.0 38.0 38.0 36.0 38.0 35 37.10875 38.0 38.0 38.0 36.0 38.0 36 37.15775 38.0 38.0 38.0 36.0 38.0 37 36.99575 38.0 38.0 38.0 36.0 38.0 38 37.07225 38.0 38.0 38.0 36.0 38.0 39 37.09875 38.0 38.0 38.0 36.0 38.0 40 37.10725 38.0 38.0 38.0 36.0 38.0 41 37.17325 38.0 38.0 38.0 36.0 38.0 42 37.102 38.0 38.0 38.0 36.0 38.0 43 37.1615 38.0 38.0 38.0 37.0 38.0 44 37.12375 38.0 38.0 38.0 36.0 38.0 45 37.1675 38.0 38.0 38.0 36.0 38.0 46 37.1105 38.0 38.0 38.0 36.0 38.0 47 37.13425 38.0 38.0 38.0 36.0 38.0 48 36.968 38.0 38.0 38.0 36.0 38.0 49 37.09925 38.0 38.0 38.0 36.0 38.0 50 37.081 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 4.0 26 12.0 27 14.0 28 17.0 29 30.0 30 46.0 31 46.0 32 62.0 33 78.0 34 100.0 35 195.0 36 446.0 37 2946.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.39536056480081 10.64044377206253 7.690368129097328 29.27382753403933 2 22.48062015503876 9.877469367341837 37.05926481620405 30.582645661415352 3 22.275 17.825 25.1 34.8 4 26.924999999999997 22.825 23.375 26.875 5 26.375 29.075 23.549999999999997 21.0 6 21.075 29.849999999999998 26.325 22.75 7 18.7 23.549999999999997 39.225 18.525 8 19.15 22.575 32.45 25.825 9 20.4 21.75 33.7 24.15 10 21.65 32.45 25.174999999999997 20.724999999999998 11 26.8 23.95 22.325 26.924999999999997 12 23.425 21.825 26.8 27.950000000000003 13 22.650000000000002 25.45 27.35 24.55 14 22.325 25.174999999999997 27.950000000000003 24.55 15 23.375 24.55 26.150000000000002 25.924999999999997 16 23.075000000000003 25.5 25.474999999999998 25.95 17 22.775000000000002 24.775 27.425 25.025 18 23.200000000000003 25.224999999999998 26.174999999999997 25.4 19 23.200000000000003 25.75 26.05 25.0 20 21.4 26.275 26.224999999999998 26.1 21 23.275000000000002 24.8 26.200000000000003 25.724999999999998 22 23.025000000000002 27.35 25.374999999999996 24.25 23 24.375 25.85 25.35 24.425 24 23.075000000000003 25.25 24.925 26.75 25 23.225 25.324999999999996 25.1 26.35 26 22.725 25.275 25.75 26.25 27 22.6 25.624999999999996 25.974999999999998 25.8 28 23.474999999999998 24.9 25.85 25.775 29 23.1 26.075 25.724999999999998 25.1 30 22.225 26.224999999999998 26.125 25.424999999999997 31 24.775 24.4 25.624999999999996 25.2 32 22.825 26.424999999999997 26.3 24.45 33 22.75 24.825 25.75 26.674999999999997 34 24.125 25.424999999999997 25.424999999999997 25.025 35 23.150000000000002 25.75 26.125 24.975 36 23.474999999999998 25.5 25.275 25.75 37 25.25 25.924999999999997 24.099999999999998 24.725 38 22.85 26.950000000000003 25.474999999999998 24.725 39 23.175 25.55 24.2 27.075 40 24.75 26.424999999999997 23.75 25.074999999999996 41 22.825 26.85 26.05 24.275 42 23.625 25.1 24.725 26.55 43 24.55 25.2 24.45 25.8 44 23.5 25.374999999999996 25.074999999999996 26.05 45 23.599999999999998 25.0 25.4 26.0 46 24.15 25.674999999999997 24.25 25.924999999999997 47 24.2 24.474999999999998 26.325 25.0 48 22.575 26.8 24.099999999999998 26.525 49 25.1 23.7 24.675 26.525 50 23.055763940985248 26.806701675418854 25.10627656914228 25.03125781445361 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 2.0 21 2.5 22 3.0 23 5.5 24 8.0 25 11.0 26 14.0 27 15.0 28 16.0 29 27.5 30 39.0 31 49.5 32 60.0 33 69.5 34 79.0 35 116.0 36 153.0 37 170.5 38 188.0 39 209.5 40 231.0 41 245.5 42 260.0 43 293.0 44 326.0 45 337.0 46 348.0 47 357.0 48 366.0 49 342.0 50 318.0 51 303.5 52 289.0 53 267.0 54 245.0 55 223.0 56 201.0 57 192.0 58 183.0 59 161.5 60 140.0 61 127.5 62 115.0 63 112.0 64 109.0 65 106.5 66 104.0 67 79.5 68 55.0 69 47.5 70 40.0 71 40.5 72 41.0 73 39.0 74 37.0 75 25.0 76 13.0 77 11.0 78 9.0 79 5.0 80 1.0 81 1.0 82 1.0 83 1.0 84 1.0 85 1.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7576064908722 97.375 2 1.0649087221095335 2.1 3 0.17748478701825557 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980822 READS because READLEN < 1 Read 980822 spots for SRR14125744.sra Written 980822 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra Rejected 980810 READS because READLEN < 1 Read 980810 spots for SRR14125744.sra Written 980810 spots for SRR14125744.sra SRR ids: ['SRR14125744.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q8ftw_j3 SRR14125744.sra spots: 19616212 blocks: [[1, 980810], [980811, 1961620], [1961621, 2942430], [2942431, 3923240], [3923241, 4904050], [4904051, 5884860], [5884861, 6865670], [6865671, 7846480], [7846481, 8827290], [8827291, 9808100], [9808101, 10788910], [10788911, 11769720], [11769721, 12750530], [12750531, 13731340], [13731341, 14712150], [14712151, 15692960], [15692961, 16673770], [16673771, 17654580], [17654581, 18635390], [18635391, 19616212]] SRR14125744 file size 2755985 SRR14125744 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14125744 SRR14125744_1.fastq Input file: SRR14125744_1.fastq trimmed: SRR14125744-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sun Dec 8 16:05:11 2024 >> started Sun Dec 8 16:05:55 2024 >> done (43.565s) 19616212 reads processed; of these: 292 ( 0.00%) short reads filtered out after trimming by size control 9084 ( 0.05%) empty reads filtered out after trimming by size control 19606836 (99.95%) reads available; of these: 3189 ( 0.02%) trimmed reads available after processing 19603647 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 28 0.00% 45 792 0.00% 46 162 0.00% 47 1213 0.01% 48 387 0.00% 49 597 0.00% 50 19603647 99.98% 19606836 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=25 prefix-density=0.00 prefix-fanout=1.0 sequence=TTTTTTTTTTGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=154.56 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=18.3 sequence=TCTTCTTCTTGTC Started job on | Dec 08 16:07:12 Started mapping on | Dec 08 16:07:13 Finished on | Dec 08 16:09:42 Mapping speed, Million of reads per hour | 473.72 Number of input reads | 19606836 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 17485694 Uniquely mapped reads % | 89.18% Average mapped length | 49.81 Number of splices: Total | 2606258 Number of splices: Annotated (sjdb) | 2517872 Number of splices: GT/AG | 2569110 Number of splices: GC/AG | 32073 Number of splices: AT/AC | 1719 Number of splices: Non-canonical | 3356 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 548359 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 1295948 % of reads mapped to too many loci | 6.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1572783 1572783 1572783 N_multimapping 548359 548359 548359 N_noFeature 685782 17129769 787053 N_ambiguous 272444 1294 18994 UnstrandedReadsAssigned:16527468 PositiveStrandReadsAssigned:354631 NegativeStrandReadsAssigned:16679647 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR14125744 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR14125744-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,606,836 reads, 16,625,083 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR14125744.ke.tsv 35125 SRR14125744.se.tsv 88098 total ==> SRR14125744.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 85.5499 9.98597 PNS24247 1044 945 23.4562 2.42506 PNS24249 1928 1829 74.7247 3.9916 PNS24246 1044 945 23.4562 2.42506 PNS24248 1044 945 23.4562 2.42506 PNS24244 1471 1372 170.357 12.1311 PNS24243 293 194 0 0 KQK14069 1603 1504 81.917 5.32135 KQK14071 474 375 12.1507 3.16567 ==> SRR14125744.se.tsv <== BRADI_1g14170v3 114 BRADI_1g53295v3 103 BRADI_1g59795v3 307 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1528 BRADI_1g74790v3 452 BRADI_1g09890v3 0 BRADI_1g77505v3 168 BRADI_1g48960v3 0 SRR14125744 completed mapping pipeline successfully