Starting /dee2/code/volunteer_pipeline.sh SRR14125745 current disk space = 1506463260672 free memory = 1349522528 SRR14125745 SRAfilesize ee1633ba4b500258548246aad74dd0a3 SRR14125745.sra SRR14125745.sra file validated SRR14125745 is single end SRR14125745 is conventional basespace SRR14125745 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14125745_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.977 34.0 33.0 34.0 32.0 34.0 2 33.11475 34.0 33.0 34.0 32.0 34.0 3 33.21625 34.0 33.0 34.0 32.0 34.0 4 33.15025 34.0 33.0 34.0 32.0 34.0 5 33.225 34.0 33.0 34.0 32.0 34.0 6 36.56825 38.0 38.0 38.0 34.0 38.0 7 36.901 38.0 38.0 38.0 35.0 38.0 8 36.86275 38.0 38.0 38.0 35.0 38.0 9 37.04575 38.0 38.0 38.0 36.0 38.0 10 36.9565 38.0 38.0 38.0 36.0 38.0 11 37.0875 38.0 38.0 38.0 36.0 38.0 12 36.94525 38.0 38.0 38.0 36.0 38.0 13 37.04075 38.0 38.0 38.0 36.0 38.0 14 36.9665 38.0 38.0 38.0 36.0 38.0 15 36.983 38.0 38.0 38.0 36.0 38.0 16 37.08 38.0 38.0 38.0 36.0 38.0 17 37.029 38.0 38.0 38.0 36.0 38.0 18 37.0105 38.0 38.0 38.0 36.0 38.0 19 37.005 38.0 38.0 38.0 36.0 38.0 20 37.06325 38.0 38.0 38.0 36.0 38.0 21 37.1425 38.0 38.0 38.0 36.0 38.0 22 37.01675 38.0 38.0 38.0 36.0 38.0 23 37.12175 38.0 38.0 38.0 36.0 38.0 24 37.11725 38.0 38.0 38.0 36.0 38.0 25 37.131 38.0 38.0 38.0 36.0 38.0 26 37.06975 38.0 38.0 38.0 36.0 38.0 27 37.10875 38.0 38.0 38.0 36.0 38.0 28 37.09625 38.0 38.0 38.0 36.0 38.0 29 37.04725 38.0 38.0 38.0 36.0 38.0 30 36.979 38.0 38.0 38.0 36.0 38.0 31 37.01675 38.0 38.0 38.0 36.0 38.0 32 36.9825 38.0 38.0 38.0 36.0 38.0 33 37.01975 38.0 38.0 38.0 36.0 38.0 34 37.08625 38.0 38.0 38.0 36.0 38.0 35 37.0645 38.0 38.0 38.0 36.0 38.0 36 37.06675 38.0 38.0 38.0 36.0 38.0 37 37.021 38.0 38.0 38.0 36.0 38.0 38 37.02325 38.0 38.0 38.0 36.0 38.0 39 37.04975 38.0 38.0 38.0 36.0 38.0 40 37.10775 38.0 38.0 38.0 36.0 38.0 41 37.099 38.0 38.0 38.0 36.0 38.0 42 37.06525 38.0 38.0 38.0 36.0 38.0 43 37.1565 38.0 38.0 38.0 36.0 38.0 44 37.011 38.0 38.0 38.0 36.0 38.0 45 37.0405 38.0 38.0 38.0 36.0 38.0 46 36.98375 38.0 38.0 38.0 36.0 38.0 47 37.08925 38.0 38.0 38.0 36.0 38.0 48 36.931 38.0 38.0 38.0 35.0 38.0 49 37.06175 38.0 38.0 38.0 36.0 38.0 50 37.1 38.0 38.0 38.0 36.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 0.0 24 4.0 25 3.0 26 5.0 27 15.0 28 22.0 29 23.0 30 32.0 31 57.0 32 54.0 33 105.0 34 124.0 35 218.0 36 509.0 37 2822.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.49370277078086 9.874055415617129 9.118387909319898 28.513853904282115 2 23.111555777888945 11.330665332666333 34.61730865432716 30.940470235117555 3 21.349999999999998 19.525000000000002 26.05 33.074999999999996 4 25.575 24.275 24.175 25.974999999999998 5 25.424999999999997 29.875 24.4 20.3 6 19.825 33.25 25.074999999999996 21.85 7 18.5 24.15 37.925 19.425 8 19.15 22.95 31.424999999999997 26.474999999999998 9 19.625 22.7 33.074999999999996 24.6 10 21.675 32.550000000000004 25.324999999999996 20.45 11 25.3 24.9 23.25 26.55 12 23.849999999999998 23.95 26.075 26.125 13 25.6 25.4 25.95 23.05 14 21.825 26.575 27.0 24.6 15 22.45 25.874999999999996 26.85 24.825 16 24.474999999999998 25.85 24.725 24.95 17 23.674999999999997 24.675 25.900000000000002 25.75 18 23.35 26.150000000000002 25.650000000000002 24.85 19 23.7 25.374999999999996 25.174999999999997 25.75 20 23.775 27.025 25.474999999999998 23.724999999999998 21 23.474999999999998 24.8 25.650000000000002 26.075 22 23.225 26.8 24.349999999999998 25.624999999999996 23 23.075000000000003 25.724999999999998 25.974999999999998 25.224999999999998 24 23.3 25.324999999999996 26.075 25.3 25 24.3 26.05 24.575 25.074999999999996 26 23.275000000000002 25.7 25.174999999999997 25.85 27 21.6 25.124999999999996 25.95 27.325 28 23.25 24.875 25.6 26.275 29 23.799999999999997 25.55 25.05 25.6 30 23.525 25.45 25.25 25.775 31 23.425 25.35 26.025 25.2 32 25.025 24.6 25.624999999999996 24.75 33 22.725 24.725 26.700000000000003 25.85 34 24.7 25.45 24.4 25.45 35 23.375 24.375 24.6 27.650000000000002 36 22.825 24.099999999999998 26.950000000000003 26.125 37 23.974999999999998 25.900000000000002 24.7 25.424999999999997 38 23.175 26.650000000000002 24.65 25.525 39 22.05 25.85 26.075 26.025 40 24.0 26.400000000000002 24.4 25.2 41 23.674999999999997 25.5 24.65 26.174999999999997 42 22.125 23.875 27.125 26.875 43 24.099999999999998 25.474999999999998 25.124999999999996 25.3 44 22.400000000000002 26.25 25.124999999999996 26.224999999999998 45 22.275 26.424999999999997 25.55 25.75 46 24.65 25.650000000000002 25.35 24.349999999999998 47 23.3 26.025 25.324999999999996 25.35 48 23.275000000000002 25.575 25.374999999999996 25.775 49 23.724999999999998 26.35 24.875 25.05 50 23.7 24.875 25.974999999999998 25.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 4.5 20 7.0 21 6.0 22 5.0 23 6.5 24 8.0 25 8.5 26 9.0 27 18.0 28 27.0 29 33.5 30 40.0 31 47.5 32 55.0 33 73.0 34 91.0 35 120.5 36 150.0 37 180.5 38 211.0 39 223.5 40 236.0 41 261.0 42 286.0 43 298.5 44 311.0 45 332.0 46 353.0 47 339.0 48 325.0 49 321.0 50 317.0 51 285.5 52 254.0 53 246.5 54 239.0 55 228.5 56 218.0 57 195.5 58 173.0 59 160.5 60 148.0 61 135.5 62 123.0 63 113.0 64 103.0 65 96.0 66 89.0 67 79.0 68 69.0 69 68.0 70 67.0 71 44.5 72 22.0 73 24.5 74 27.0 75 22.0 76 17.0 77 13.0 78 9.0 79 7.0 80 5.0 81 4.0 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962467 READS because READLEN < 1 Read 962467 spots for SRR14125745.sra Written 962467 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra Rejected 962466 READS because READLEN < 1 Read 962466 spots for SRR14125745.sra Written 962466 spots for SRR14125745.sra SRR ids: ['SRR14125745.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n4fv_ba7 SRR14125745.sra spots: 19249321 blocks: [[1, 962466], [962467, 1924932], [1924933, 2887398], [2887399, 3849864], [3849865, 4812330], [4812331, 5774796], [5774797, 6737262], [6737263, 7699728], [7699729, 8662194], [8662195, 9624660], [9624661, 10587126], [10587127, 11549592], [11549593, 12512058], [12512059, 13474524], [13474525, 14436990], [14436991, 15399456], [15399457, 16361922], [16361923, 17324388], [17324389, 18286854], [18286855, 19249321]] SRR14125745 file size 2704033 SRR14125745 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14125745 SRR14125745_1.fastq Input file: SRR14125745_1.fastq trimmed: SRR14125745-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sun Dec 8 16:14:23 2024 >> started Sun Dec 8 16:15:05 2024 >> done (41.681s) 19249321 reads processed; of these: 305 ( 0.00%) short reads filtered out after trimming by size control 13663 ( 0.07%) empty reads filtered out after trimming by size control 19235353 (99.93%) reads available; of these: 3254 ( 0.02%) trimmed reads available after processing 19232099 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 6 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 32 0.00% 45 862 0.00% 46 151 0.00% 47 1167 0.01% 48 381 0.00% 49 640 0.00% 50 19232099 99.98% 19235353 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=21 prefix-density=0.00 prefix-fanout=1.0 sequence=TTTTTTTTTTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=182.45 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=20.1 sequence=TCTTCTTCTTGTC Started job on | Dec 08 16:16:21 Started mapping on | Dec 08 16:16:21 Finished on | Dec 08 16:18:34 Mapping speed, Million of reads per hour | 520.66 Number of input reads | 19235353 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 17763255 Uniquely mapped reads % | 92.35% Average mapped length | 49.80 Number of splices: Total | 2679568 Number of splices: Annotated (sjdb) | 2589034 Number of splices: GT/AG | 2641075 Number of splices: GC/AG | 33021 Number of splices: AT/AC | 1856 Number of splices: Non-canonical | 3616 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 517850 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 685225 % of reads mapped to too many loci | 3.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 954248 954248 954248 N_multimapping 517850 517850 517850 N_noFeature 718394 17397040 823102 N_ambiguous 279171 1328 18940 UnstrandedReadsAssigned:16765690 PositiveStrandReadsAssigned:364887 NegativeStrandReadsAssigned:16921213 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR14125745 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR14125745-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,235,353 reads, 16,869,108 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR14125745.ke.tsv 35125 SRR14125745.se.tsv 88098 total ==> SRR14125745.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 56.4673 6.55192 PNS24247 1044 945 36.7833 3.78021 PNS24249 1928 1829 74.733 3.96821 PNS24246 1044 945 36.7833 3.78021 PNS24248 1044 945 36.7833 3.78021 PNS24244 1471 1372 171.45 12.1361 PNS24243 293 194 0 0 KQK14069 1603 1504 113.781 7.34712 KQK14071 474 375 13.4744 3.4896 ==> SRR14125745.se.tsv <== BRADI_1g14170v3 133 BRADI_1g53295v3 120 BRADI_1g59795v3 296 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 1545 BRADI_1g74790v3 509 BRADI_1g09890v3 0 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR14125745 completed mapping pipeline successfully