Starting /dee2/code/volunteer_pipeline.sh SRR1425915 current disk space = 1526111526912 free memory = 1430116472 SRR1425915 SRAfilesize 716b4b0d6f6976915eafd3174ab9af0f SRR1425915.sra SRR1425915.sra file validated SRR1425915 is single end SRR1425915 is conventional basespace SRR1425915 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1425915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.27275 31.0 30.0 34.0 25.0 34.0 2 30.24825 31.0 31.0 34.0 26.0 34.0 3 30.7285 31.0 31.0 34.0 27.0 34.0 4 34.16525 37.0 35.0 37.0 30.0 37.0 5 33.88475 37.0 35.0 37.0 30.0 37.0 6 33.778 37.0 35.0 37.0 29.0 37.0 7 33.7945 37.0 35.0 37.0 29.0 37.0 8 33.7155 37.0 35.0 37.0 28.0 37.0 9 35.17875 39.0 35.0 39.0 29.0 39.0 10-11 34.708 38.5 35.0 39.0 26.0 39.0 12-13 34.757875 38.5 35.0 39.0 27.0 39.0 14-15 35.88312500000001 40.0 36.0 41.0 27.0 41.0 16-17 35.885999999999996 40.0 36.0 41.0 27.0 41.0 18-19 35.843625 40.0 36.0 41.0 27.0 41.0 20-21 35.58 39.0 35.5 41.0 26.5 41.0 22-23 35.288125 39.0 35.0 41.0 25.5 41.0 24-25 35.0195 39.0 34.5 41.0 24.5 41.0 26-27 34.756625 39.0 34.0 41.0 23.0 41.0 28-29 34.443124999999995 38.5 34.0 40.0 21.5 41.0 30-31 34.108125 38.0 33.0 40.0 19.0 41.0 32-33 33.898375 38.0 33.0 40.0 18.5 41.0 34-35 33.64775 38.0 33.0 40.0 16.0 41.0 36-37 33.50475 38.0 32.5 40.0 16.0 41.0 38-39 33.19625 38.0 32.5 40.0 10.0 41.0 40-41 33.000125 38.0 32.5 40.0 10.5 41.0 42-43 32.30175 38.0 31.0 40.0 8.5 41.0 44-45 32.496624999999995 37.5 31.0 40.0 6.0 41.0 46-47 32.691375 38.0 32.0 40.0 2.0 41.0 48-49 32.633625 38.0 32.0 40.0 2.0 41.0 50-51 32.416 37.5 31.0 40.0 2.0 41.0 52-53 32.238375000000005 37.0 31.5 40.0 2.0 41.0 54-55 31.617874999999998 36.5 30.5 40.0 2.0 41.0 56-57 31.135 36.0 29.5 40.0 2.0 41.0 58-59 30.912875 36.0 30.0 39.0 2.0 41.0 60-61 29.633125 34.5 27.0 38.5 2.0 40.5 62-63 29.63175 35.0 27.5 39.0 2.0 40.0 64-65 29.546625 35.0 27.5 38.0 2.0 40.0 66-67 29.347625 34.5 28.0 37.5 2.0 40.0 68-69 28.81575 34.0 27.0 37.0 2.0 39.0 70-71 28.222749999999998 34.0 26.0 36.5 2.0 39.0 72-73 27.7655 34.0 25.5 36.0 2.0 39.0 74-75 27.372 34.0 25.0 35.0 2.0 37.5 76-77 26.232125 31.5 23.5 34.5 2.0 36.0 78-79 26.757375 33.0 24.5 35.0 2.0 36.5 80-81 26.587875 33.0 24.0 35.0 2.0 36.0 82-83 26.323875 33.0 23.5 35.0 2.0 36.0 84-85 25.921875 33.0 23.5 35.0 2.0 35.0 86-87 25.5235 32.0 20.0 35.0 2.0 35.0 88-89 25.170125 32.0 19.0 35.0 2.0 35.0 90-91 24.509500000000003 32.0 11.0 35.0 2.0 35.0 92-93 23.905875 31.0 4.5 34.0 2.0 35.0 94-95 23.525875 31.0 2.0 34.0 2.0 35.0 96-97 22.703125 30.5 2.0 34.0 2.0 35.0 98-99 21.64 29.5 2.0 34.0 2.0 35.0 100-101 20.561 28.5 2.0 33.5 2.0 34.5 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 106.0 3 39.0 4 22.0 5 15.0 6 29.0 7 27.0 8 16.0 9 30.0 10 37.0 11 24.0 12 27.0 13 27.0 14 36.0 15 25.0 16 25.0 17 39.0 18 28.0 19 40.0 20 31.0 21 37.0 22 39.0 23 41.0 24 51.0 25 51.0 26 83.0 27 71.0 28 92.0 29 119.0 30 125.0 31 150.0 32 167.0 33 205.0 34 259.0 35 346.0 36 476.0 37 651.0 38 379.0 39 35.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.939646201873046 29.084287200832463 16.519250780437044 26.456815816857436 2 27.900000000000002 25.75 16.45 29.9 3 27.800000000000004 26.700000000000003 16.3 29.2 4 29.825000000000003 26.200000000000003 13.975000000000001 30.0 5 30.7 26.224999999999998 14.35 28.725 6 30.675 28.599999999999998 16.025 24.7 7 32.175 23.625 20.5 23.7 8 35.0 25.174999999999997 23.125 16.7 9 33.650000000000006 27.200000000000003 23.45 15.7 10-11 34.5625 27.125 21.2375 17.075000000000003 12-13 30.85 27.250000000000004 24.4375 17.4625 14-15 27.55 28.212500000000002 24.8625 19.375 16-17 27.425 27.075 24.887500000000003 20.6125 18-19 25.575 28.999999999999996 25.525 19.900000000000002 20-21 25.424999999999997 27.725 26.200000000000003 20.65 22-23 25.7228689447991 28.16372512204281 24.396044561271747 21.717361371886344 24-25 25.5415049455365 27.407036434205583 26.142481532490297 20.90897708776762 26-27 25.12198173401726 27.4990616789691 25.647441511322405 21.73151507569123 28-29 25.8125 26.5125 25.124999999999996 22.55 30-31 25.8625 26.8125 25.95 21.375 32-33 24.625 28.349999999999998 24.637500000000003 22.3875 34-35 25.587500000000002 28.025 25.25 21.1375 36-37 26.3625 27.525 25.1875 20.925 38-39 25.362499999999997 26.5625 26.325 21.75 40-41 26.375 27.400000000000002 24.525 21.7 42-43 26.575 27.250000000000004 24.762500000000003 21.4125 44-45 24.775 27.425 25.95 21.85 46-47 27.0125 26.4625 24.337500000000002 22.1875 48-49 26.174999999999997 27.212500000000002 24.3875 22.225 50-51 25.45 27.5625 24.3 22.6875 52-53 25.8625 27.9375 23.625 22.575 54-55 26.525 28.1875 23.5375 21.75 56-57 25.4625 27.712500000000002 24.2625 22.5625 58-59 26.1625 28.1875 23.2875 22.3625 60-61 25.474999999999998 27.975 25.2125 21.337500000000002 62-63 25.35 28.262500000000003 23.5625 22.825 64-65 25.412499999999998 27.487499999999997 23.8125 23.2875 66-67 26.224999999999998 28.075 23.4375 22.2625 68-69 25.025 28.575 23.6125 22.787499999999998 70-71 26.650000000000002 27.1375 23.724999999999998 22.4875 72-73 25.874999999999996 28.625 22.6375 22.8625 74-75 24.8125 28.9875 23.625 22.575 76-77 26.05 28.425 23.025000000000002 22.5 78-79 25.8625 27.0625 24.325 22.75 80-81 25.7625 28.349999999999998 23.0125 22.875 82-83 26.137500000000003 28.0875 22.900000000000002 22.875 84-85 25.0 27.9125 23.2875 23.799999999999997 86-87 25.95 27.775 22.85 23.425 88-89 25.3125 28.1625 23.1375 23.3875 90-91 25.124999999999996 27.5875 23.525 23.7625 92-93 24.725 28.212500000000002 23.275000000000002 23.7875 94-95 25.137500000000003 27.3875 23.549999999999997 23.925 96-97 25.025 28.212500000000002 22.1875 24.575 98-99 24.349999999999998 28.599999999999998 22.925 24.125 100-101 25.45 27.500000000000004 22.55 24.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.0 23 2.5 24 0.5 25 3.0 26 7.5 27 6.5 28 6.5 29 13.0 30 15.5 31 23.5 32 28.0 33 25.0 34 34.5 35 48.0 36 46.0 37 55.5 38 75.0 39 95.0 40 115.0 41 136.0 42 156.5 43 176.5 44 209.5 45 214.5 46 222.0 47 228.5 48 213.0 49 199.5 50 174.5 51 160.5 52 150.5 53 122.0 54 111.5 55 103.5 56 75.5 57 63.0 58 65.0 59 57.5 60 46.5 61 37.5 62 34.0 63 41.5 64 41.0 65 34.0 66 34.0 67 32.0 68 27.5 69 31.5 70 31.0 71 22.0 72 20.0 73 23.0 74 19.5 75 11.0 76 8.0 77 10.5 78 7.5 79 5.5 80 8.5 81 7.5 82 4.0 83 2.5 84 2.0 85 2.5 86 4.0 87 2.5 88 0.5 89 1.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.13749999999999998 24-25 0.1625 26-27 0.08750000000000001 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4918200408998 96.325 2 1.1758691206543967 2.3 3 0.1278118609406953 0.375 4 0.07668711656441718 0.3 5 0.07668711656441718 0.375 6 0.025562372188139063 0.15 7 0.025562372188139063 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACGTGGTGGACTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAAC 7 0.17500000000000002 No Hit AGGCGGAAGAGTCCTCTTAATATTTATCTAATCTTATATAGGTTTCAGTA 6 0.15 No Hit GCAGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGT 5 0.125 No Hit CCCCAGCAAGTTAAGGCCACCATGTCGAGCGGCTGCGGCAACTGCGACTG 5 0.125 No Hit AGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0125 0.0 0.0 0.0 0.0 26-27 0.07500000000000001 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.2875 0.0 0.0 0.0 0.0 34-35 0.4 0.0 0.0 0.0 0.0 36-37 0.525 0.0 0.0 0.0 0.0 38-39 0.65 0.0 0.0 0.0 0.0 40-41 0.7875 0.0 0.0 0.0 0.0 42-43 0.9375 0.0 0.0 0.0 0.0 44-45 1.0625 0.0 0.0 0.0 0.0 46-47 1.3250000000000002 0.0 0.0 0.0 0.0 48-49 1.6 0.0 0.0 0.0 0.0 50-51 1.9 0.0 0.0 0.0 0.0 52-53 2.3875 0.0 0.0 0.0 0.0 54-55 2.9625 0.0 0.0 0.0 0.0 56-57 3.2375 0.0 0.0 0.0 0.0 58-59 3.7375 0.0 0.0 0.0 0.0 60-61 4.199999999999999 0.0 0.0 0.0 0.0 62-63 4.6375 0.0 0.0 0.0 0.0 64-65 5.1375 0.0 0.0 0.0 0.0 66-67 5.8125 0.0 0.0 0.0 0.0 68-69 6.6 0.0 0.0 0.0 0.0 70-71 7.3125 0.0 0.0 0.0 0.0 72-73 8.1625 0.0 0.0 0.0 0.0 74-75 9.225000000000001 0.0 0.0 0.0 0.0 76-77 10.1375 0.0 0.0 0.0 0.0 78-79 10.8 0.0 0.0 0.0 0.0 80-81 11.524999999999999 0.0 0.0 0.0 0.0 82-83 12.525 0.0 0.0 0.0 0.0 84-85 13.4375 0.0 0.0 0.0 0.0 86-87 14.075 0.0 0.0 0.0 0.0 88-89 15.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614347 spots for SRR1425915.sra Written 31614347 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra Read 31614343 spots for SRR1425915.sra Written 31614343 spots for SRR1425915.sra skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1425915 SRR1425915_1.fastq Input file: SRR1425915_1.fastq trimmed: SRR1425915-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 06:22:43 2024 >> started Tue Dec 10 06:24:06 2024 >> done (83.059s) 133794400 reads processed; of these: 3495902 ( 2.61%) short reads filtered out after trimming by size control 3493382 ( 2.61%) empty reads filtered out after trimming by size control 126805116 (94.78%) reads available; of these: 40324313 (31.80%) trimmed reads available after processing 86480803 (68.20%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 148118 0.12% 19 150923 0.12% 20 155489 0.12% 21 162632 0.13% 22 187657 0.15% 23 166720 0.13% 24 171940 0.14% 25 179463 0.14% 26 186305 0.15% 27 190688 0.15% 28 202044 0.16% 29 207868 0.16% 30 212541 0.17% 31 230026 0.18% 32 228254 0.18% 33 233162 0.18% 34 242998 0.19% 35 245787 0.19% 36 254393 0.20% 37 258306 0.20% 38 266606 0.21% 39 273443 0.22% 40 285943 0.23% 41 285157 0.22% 42 291443 0.23% 43 298543 0.24% 44 305709 0.24% 45 308159 0.24% 46 322160 0.25% 47 339278 0.27% 48 348884 0.28% 49 362908 0.29% 50 381485 0.30% 51 403573 0.32% 52 403422 0.32% 53 419988 0.33% 54 414610 0.33% 55 436234 0.34% 56 454066 0.36% 57 459068 0.36% 58 483262 0.38% 59 492213 0.39% 60 497485 0.39% 61 514737 0.41% 62 533397 0.42% 63 533910 0.42% 64 557713 0.44% 65 572916 0.45% 66 592593 0.47% 67 603321 0.48% 68 633010 0.50% 69 631526 0.50% 70 355460 0.28% 71 374980 0.30% 72 370290 0.29% 73 382446 0.30% 74 389779 0.31% 75 396013 0.31% 76 228455 0.18% 77 255916 0.20% 78 304171 0.24% 79 341765 0.27% 80 366860 0.29% 81 374345 0.30% 82 397601 0.31% 83 422331 0.33% 84 448950 0.35% 85 462439 0.36% 86 541086 0.43% 87 529010 0.42% 88 560933 0.44% 89 628471 0.50% 90 656796 0.52% 91 720381 0.57% 92 818655 0.65% 93 917741 0.72% 94 1056496 0.83% 95 1188847 0.94% 96 1371469 1.08% 97 1555329 1.23% 98 1752337 1.38% 99 1890005 1.49% 100 2542880 2.01% 101 86480803 68.20% 126805116 reads passed initial QC criterion=sequence-density sequence-density=7.05 sequence-density-rank=1 fanout-score=49.60 fanout-score-rank=1 prefix-density=8.50 prefix-fanout=41.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT criterion=fanout-score sequence-density=7.05 sequence-density-rank=1 fanout-score=49.60 fanout-score-rank=1 prefix-density=8.50 prefix-fanout=41.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT -o SRR1425915 - Input file: STDIN trimmed: SRR1425915-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 06:31:42 2024 >> started Tue Dec 10 06:33:41 2024 >> done (118.836s) 95103837 reads processed; of these: 8991 ( 0.01%) short reads filtered out after trimming by size control 62 ( 0.00%) empty reads filtered out after trimming by size control 95094784 (99.99%) reads available; of these: 11356834 (11.94%) trimmed reads available after processing 83737950 (88.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 111343 0.12% 19 113480 0.12% 20 116184 0.12% 21 122005 0.13% 22 140130 0.15% 23 125167 0.13% 24 129270 0.14% 25 134695 0.14% 26 139954 0.15% 27 143470 0.15% 28 152070 0.16% 29 156651 0.16% 30 159521 0.17% 31 172745 0.18% 32 171193 0.18% 33 175341 0.18% 34 182836 0.19% 35 185415 0.19% 36 191916 0.20% 37 194502 0.20% 38 200325 0.21% 39 204984 0.22% 40 215202 0.23% 41 214913 0.23% 42 219907 0.23% 43 225083 0.24% 44 232601 0.24% 45 232845 0.24% 46 243864 0.26% 47 253655 0.27% 48 262651 0.28% 49 271981 0.29% 50 287951 0.30% 51 303278 0.32% 52 303776 0.32% 53 315762 0.33% 54 313925 0.33% 55 328234 0.35% 56 342449 0.36% 57 343678 0.36% 58 362981 0.38% 59 369574 0.39% 60 374545 0.39% 61 386918 0.41% 62 402144 0.42% 63 401512 0.42% 64 419743 0.44% 65 432884 0.46% 66 446636 0.47% 67 444251 0.47% 68 468502 0.49% 69 469996 0.49% 70 491362 0.52% 71 522526 0.55% 72 520898 0.55% 73 534854 0.56% 74 550632 0.58% 75 549673 0.58% 76 438137 0.46% 77 471920 0.50% 78 508624 0.53% 79 542388 0.57% 80 577631 0.61% 81 576694 0.61% 82 593551 0.62% 83 621182 0.65% 84 639713 0.67% 85 659783 0.69% 86 721550 0.76% 87 726103 0.76% 88 738423 0.78% 89 843273 0.89% 90 804985 0.85% 91 848348 0.89% 92 937893 0.99% 93 1004813 1.06% 94 1097914 1.15% 95 1197741 1.26% 96 1357336 1.43% 97 1686345 1.77% 98 2890973 3.04% 99 1256740 1.32% 100 1691079 1.78% 101 55177062 58.02% criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.50 fanout-score-rank=32 prefix-density=0.25 prefix-fanout=1.5 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTACCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=190.59 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=24.8 sequence=AAGAAGAAGAAA Started job on | Dec 10 06:34:53 Started mapping on | Dec 10 06:34:53 Finished on | Dec 10 06:37:28 Mapping speed, Million of reads per hour | 2944.94 Number of input reads | 126796063 Average input read length | 90 UNIQUE READS: Uniquely mapped reads number | 112275352 Uniquely mapped reads % | 88.55% Average mapped length | 90.24 Number of splices: Total | 38803075 Number of splices: Annotated (sjdb) | 36725428 Number of splices: GT/AG | 38175853 Number of splices: GC/AG | 533837 Number of splices: AT/AC | 22213 Number of splices: Non-canonical | 71172 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.02% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 12148731 % of reads mapped to multiple loci | 9.58% Number of reads mapped to too many loci | 479587 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.45% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2371980 2371980 2371980 N_multimapping 12148731 12148731 12148731 N_noFeature 6469934 10705112 106177847 N_ambiguous 2399877 541863 31629 UnstrandedReadsAssigned:103405541 PositiveStrandReadsAssigned:101028377 NegativeStrandReadsAssigned:6065876 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=80 echo kmer=75 SRR1425915 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR1425915-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 126,796,063 reads, 106,902,949 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,327 rounds 52973 SRR1425915.ke.tsv 35125 SRR1425915.se.tsv 88098 total ==> SRR1425915.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.169056 0.00317273 PNS24247 1044 945 377.374 6.27287 PNS24249 1928 1829 740.099 6.35628 PNS24246 1044 945 377.374 6.27287 PNS24248 1044 945 377.374 6.27287 PNS24244 1471 1372 1369.61 15.6808 PNS24243 293 194 0 0 KQK14069 1603 1504 20134.8 210.294 KQK14071 474 375 3505.44 146.838 ==> SRR1425915.se.tsv <== BRADI_1g14170v3 58946 BRADI_1g53295v3 7463 BRADI_1g59795v3 1274 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 1974 BRADI_1g74790v3 2419 BRADI_1g09890v3 0 BRADI_1g77505v3 3593 BRADI_1g48960v3 0 SRR1425915 completed mapping pipeline successfully