Starting /dee2/code/volunteer_pipeline.sh SRR14458896 current disk space = 1540543332352 free memory = 1602353704 SRR14458896 SRAfilesize 8544de0b5af11695b7d68f860260da55 SRR14458896.sra SRR14458896.sra file validated SRR14458896 is paired end SRR14458896 is conventional basespace SRR14458896 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0455 32.0 32.0 32.0 32.0 32.0 2 31.14125 32.0 32.0 32.0 32.0 32.0 3 31.26375 32.0 32.0 32.0 32.0 32.0 4 31.312 32.0 32.0 32.0 32.0 32.0 5 31.385 32.0 32.0 32.0 32.0 32.0 6 34.312 36.0 36.0 36.0 32.0 36.0 7 34.5185 36.0 36.0 36.0 32.0 36.0 8 34.3755 36.0 36.0 36.0 32.0 36.0 9 34.503 36.0 36.0 36.0 32.0 36.0 10-14 34.53190000000001 36.0 36.0 36.0 32.0 36.0 15-19 34.56689999999999 36.0 36.0 36.0 32.0 36.0 20-24 34.48075 36.0 36.0 36.0 32.0 36.0 25-29 34.23725 36.0 36.0 36.0 32.0 36.0 30-34 34.06095 36.0 36.0 36.0 32.0 36.0 35-39 34.03465 36.0 36.0 36.0 32.0 36.0 40-44 33.957550000000005 36.0 36.0 36.0 32.0 36.0 45-49 33.85475 36.0 36.0 36.0 32.0 36.0 50-54 33.829 36.0 36.0 36.0 31.0 36.0 55-59 33.5518 36.0 36.0 36.0 27.0 36.0 60-64 33.40755 36.0 36.0 36.0 25.8 36.0 65-69 33.30005 36.0 36.0 36.0 23.4 36.0 70-74 33.0124 36.0 32.8 36.0 22.2 36.0 75-79 32.89335 36.0 32.0 36.0 21.0 36.0 80-84 32.84740000000001 36.0 32.0 36.0 22.2 36.0 85-89 32.809000000000005 36.0 32.0 36.0 20.8 36.0 90-94 32.85875 36.0 32.0 36.0 21.0 36.0 95-99 32.735600000000005 36.0 32.0 36.0 18.2 36.0 100-104 32.54684999999999 36.0 32.0 36.0 15.4 36.0 105-109 32.51434999999999 36.0 32.0 36.0 15.4 36.0 110-114 32.40605000000001 36.0 32.0 36.0 14.0 36.0 115-119 32.22259999999999 36.0 32.0 36.0 14.0 36.0 120-124 32.359 36.0 32.0 36.0 15.4 36.0 125-129 32.02765 36.0 32.0 36.0 14.0 36.0 130-134 31.942349999999998 36.0 32.0 36.0 14.0 36.0 135-139 31.74155 36.0 32.0 36.0 14.0 36.0 140-144 31.2314 36.0 29.0 36.0 14.0 36.0 145-149 30.845700000000004 36.0 27.0 36.0 14.0 36.0 150-151 28.665125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 2.0 20 0.0 21 7.0 22 15.0 23 20.0 24 27.0 25 57.0 26 63.0 27 86.0 28 120.0 29 167.0 30 227.0 31 271.0 32 411.0 33 567.0 34 955.0 35 1000.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.775 11.725 10.45 53.05 2 21.224999999999998 16.825000000000003 32.65 29.299999999999997 3 20.575 18.75 24.7 35.975 4 25.45 24.0 18.575 31.974999999999998 5 28.599999999999998 27.3 19.625 24.474999999999998 6 26.14805520702635 31.618569636135508 20.752823086574654 21.48055207026349 7 22.575 18.15 35.0 24.275 8 22.725 21.775 26.025 29.475 9 22.775000000000002 19.8 29.75 27.675 10-14 25.679999999999996 24.44 22.68 27.200000000000003 15-19 25.75 23.05 22.915 28.285 20-24 25.874999999999996 23.39 23.330000000000002 27.405 25-29 25.46263879163749 23.357007102130638 23.42702810843253 27.753325997799337 30-34 25.581628058237854 23.74543453244609 23.28513533796968 27.387802071346375 35-39 26.02513393080659 23.051119010664397 23.10118660191258 27.82256045661643 40-44 26.646271126937158 23.682230803952052 22.84467626260093 26.826821806509855 45-49 25.96998444009436 23.354916428248757 22.878080610349848 27.79701852130703 50-54 26.48136069439567 23.079624705233055 22.377201344639005 28.061813255732275 55-59 26.50560048219398 23.170425435732582 22.56266010347079 27.761313978602644 60-64 26.652280825011292 23.290008531138657 22.08561248557234 27.972098158277714 65-69 26.236678061532277 23.270661572491456 22.9489241906294 27.543736175346872 70-74 26.718169960870874 22.539379953847696 22.85040634092505 27.892043744356375 75-79 26.759997992874705 22.921370866576346 22.775854282703598 27.542776857845354 80-84 26.672010420319626 23.039927859325683 22.844546866389457 27.443514853965233 85-89 26.573531620850233 22.727955535526515 22.923238696109358 27.775274147513894 90-94 27.080832332933173 22.934173669467786 22.26390556222489 27.721088435374146 95-99 26.895758303321326 22.554021608643456 22.859143657462987 27.69107643057223 100-104 27.35277930654926 22.729774353329667 22.429579226497225 27.487867113623853 105-109 27.270908363345335 22.88915566226491 22.57903161264506 27.260904361744696 110-114 27.29501225674121 22.73750562809545 22.51738456150883 27.450097553654512 115-119 27.22361180590295 22.951475737868936 22.331165582791396 27.49374687343672 120-124 27.184514580103038 23.378182363827342 22.03771319961987 27.399589856449758 125-129 27.393217965389617 23.817145143543065 21.706511953586073 27.083124937481244 130-134 27.649147372105816 22.9034355153273 22.12831924788718 27.319097864679705 135-139 27.95198799699925 23.440860215053764 21.85546386596649 26.751687921980494 140-144 27.365000000000002 24.0 21.235 27.400000000000002 145-149 27.76 23.945 21.355 26.939999999999998 150-151 27.375 23.7 21.762500000000003 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 1.5 28 3.0 29 5.0 30 5.5 31 6.0 32 8.5 33 12.5 34 18.0 35 22.0 36 25.0 37 38.5 38 53.0 39 59.0 40 82.0 41 109.0 42 127.0 43 125.0 44 125.5 45 145.5 46 144.5 47 124.5 48 141.0 49 147.5 50 134.0 51 139.0 52 125.0 53 102.5 54 94.5 55 95.5 56 96.5 57 103.5 58 107.5 59 115.0 60 106.5 61 102.5 62 106.0 63 100.5 64 92.0 65 89.0 66 93.5 67 83.5 68 77.0 69 73.5 70 69.5 71 64.0 72 55.0 73 54.0 74 46.5 75 32.5 76 26.5 77 21.5 78 16.0 79 13.0 80 11.0 81 8.5 82 4.5 83 1.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.375 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.03 30-34 0.065 35-39 0.135 40-44 0.305 45-49 0.385 50-54 0.345 55-59 0.455 60-64 0.365 65-69 0.54 70-74 0.33 75-79 0.35500000000000004 80-84 0.19499999999999998 85-89 0.145 90-94 0.04 95-99 0.04 100-104 0.065 105-109 0.04 110-114 0.055 115-119 0.05 120-124 0.034999999999999996 125-129 0.03 130-134 0.015 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.7063572149344097 1.4000000000000001 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 3.0375 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0125 134-135 4.9375 0.0 0.0 0.0 0.025 136-137 5.7375 0.0 0.0 0.0 0.025 138-139 6.512499999999999 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTGTA 10 0.006830828 145.0 4 >>END_MODULE SRR14458896 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.966 32.0 32.0 32.0 32.0 32.0 2 30.62325 32.0 32.0 32.0 32.0 32.0 3 30.5215 32.0 32.0 32.0 32.0 32.0 4 30.65325 32.0 32.0 32.0 32.0 32.0 5 30.59475 32.0 32.0 32.0 32.0 32.0 6 33.9935 36.0 36.0 36.0 32.0 36.0 7 34.138 36.0 36.0 36.0 32.0 36.0 8 34.005 36.0 36.0 36.0 32.0 36.0 9 33.9705 36.0 36.0 36.0 32.0 36.0 10-14 33.8821 36.0 36.0 36.0 32.0 36.0 15-19 33.8456 36.0 36.0 36.0 31.0 36.0 20-24 33.773 36.0 36.0 36.0 30.0 36.0 25-29 33.7124 36.0 36.0 36.0 29.0 36.0 30-34 33.6438 36.0 36.0 36.0 27.8 36.0 35-39 33.49935 36.0 36.0 36.0 25.8 36.0 40-44 33.51965 36.0 36.0 36.0 25.8 36.0 45-49 33.41545000000001 36.0 36.0 36.0 23.2 36.0 50-54 33.2525 36.0 36.0 36.0 20.8 36.0 55-59 33.02675 36.0 36.0 36.0 18.2 36.0 60-64 32.80885000000001 36.0 36.0 36.0 15.4 36.0 65-69 32.404650000000004 36.0 32.0 36.0 14.0 36.0 70-74 32.18745 36.0 32.8 36.0 14.0 36.0 75-79 32.0542 36.0 32.0 36.0 14.0 36.0 80-84 31.752050000000004 36.0 32.0 36.0 14.0 36.0 85-89 31.87735 36.0 32.0 36.0 14.0 36.0 90-94 31.538549999999997 36.0 32.0 36.0 14.0 36.0 95-99 31.49235 36.0 32.0 36.0 14.0 36.0 100-104 31.482800000000005 36.0 32.0 36.0 14.0 36.0 105-109 31.387699999999995 36.0 32.0 36.0 14.0 36.0 110-114 31.2143 36.0 32.0 36.0 14.0 36.0 115-119 30.830899999999996 36.0 30.0 36.0 14.0 36.0 120-124 30.849700000000002 36.0 31.0 36.0 14.0 36.0 125-129 30.436899999999998 35.2 27.0 36.0 14.0 36.0 130-134 29.82045 32.8 27.0 36.0 14.0 36.0 135-139 29.347049999999996 32.0 27.0 36.0 14.0 36.0 140-144 29.2183 32.0 27.0 36.0 14.0 36.0 145-149 29.254649999999998 32.0 27.0 36.0 14.0 36.0 150-151 26.420375 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 4.0 8 5.0 9 3.0 10 6.0 11 8.0 12 4.0 13 7.0 14 7.0 15 7.0 16 8.0 17 12.0 18 9.0 19 9.0 20 18.0 21 22.0 22 22.0 23 32.0 24 51.0 25 78.0 26 96.0 27 114.0 28 141.0 29 201.0 30 241.0 31 322.0 32 415.0 33 571.0 34 914.0 35 672.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.936968484242122 11.880940470235117 9.604802401200601 54.57728864432217 2 21.50537634408602 15.9039759939985 36.159039759939986 26.431607901975497 3 22.55 19.1 23.35 35.0 4 27.125 23.425 17.9 31.55 5 29.5 26.650000000000002 20.150000000000002 23.7 6 26.1 30.475 18.85 24.575 7 23.75 19.900000000000002 32.975 23.375 8 22.5 20.45 26.525 30.525000000000002 9 22.900000000000002 20.1 29.225 27.775 10-14 25.590000000000003 24.335 22.535 27.54 15-19 25.19 24.145 22.91 27.755000000000003 20-24 26.125 23.27 23.24 27.365000000000002 25-29 26.33763376337634 23.14731473147315 22.542254225422543 27.972797279727974 30-34 25.494615577260205 23.806661657901326 22.749812171299773 27.948910593538695 35-39 26.15400070319956 23.27590536943091 22.90923702847958 27.660856898889953 40-44 25.703254274682845 23.62232362232362 22.830065687208545 27.844356415784986 45-49 25.697201145671073 23.360635143962615 22.62700366815738 28.315160042208937 50-54 26.483488782455254 23.231661204940764 22.586337282581294 27.69851273002269 55-59 26.463027370331165 22.889258531175965 23.181611976410103 27.466102122082763 60-64 26.44310893389223 23.135195192162012 22.963486692591285 27.458209181354476 65-69 26.78770102154344 22.590270051582888 22.494184282391018 28.127844644482654 70-74 26.32593043301896 23.136598722239125 22.74617178785113 27.791299056890782 75-79 26.231089450705657 23.149558330795006 23.017565235049243 27.601786983450094 80-84 26.661573720397254 23.463203463203463 22.322383498854087 27.552839317545203 85-89 26.602238046795524 23.189216683621567 22.533062054933875 27.675483214649034 90-94 27.058163837487893 23.127899271040427 22.429525411632767 27.384411479838917 95-99 27.225024198889397 22.859035101125887 22.283356258596974 27.632584441387742 100-104 26.71763506625892 23.363914373088683 22.426095820591232 27.492354740061163 105-109 27.179669993888776 23.13098390710939 22.061519657771438 27.62782644123039 110-114 27.551541130843027 22.999591753419065 22.264747907736275 27.184119208001633 115-119 27.229543365001536 23.44468280723261 21.907242823577487 27.418531004188374 120-124 27.34382987424599 23.19803701053062 22.288109600245374 27.17002351497802 125-129 27.681129758493654 23.040319279574295 21.843020875972165 27.435530085959886 130-134 27.96337033815931 23.81439607100834 21.93687010794495 26.285363482887398 135-139 28.270106998412942 24.03624635232683 21.686376900629703 26.007269748630524 140-144 28.472790507364977 23.465630114566284 21.777823240589196 26.283756137479543 145-149 28.83375959079284 23.631713554987215 21.943734015345267 25.59079283887468 150-151 28.799897645854657 23.656601842374616 22.018935516888433 25.524564994882294 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 1.0 12 1.5 13 1.0 14 2.5 15 2.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 4.0 24 4.0 25 2.5 26 3.0 27 2.5 28 4.0 29 5.0 30 6.0 31 10.0 32 13.5 33 15.5 34 17.0 35 18.5 36 23.0 37 33.5 38 45.0 39 65.0 40 88.5 41 109.5 42 119.0 43 116.5 44 127.0 45 143.5 46 148.5 47 146.0 48 133.0 49 132.5 50 132.5 51 126.0 52 118.0 53 112.0 54 108.0 55 92.5 56 95.0 57 109.0 58 113.0 59 110.5 60 108.5 61 94.5 62 98.5 63 102.5 64 91.0 65 89.0 66 86.0 67 85.0 68 78.0 69 71.0 70 70.0 71 67.0 72 51.0 73 43.5 74 46.5 75 37.5 76 30.0 77 25.0 78 18.0 79 13.5 80 9.5 81 4.5 82 2.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.17500000000000002 35-39 0.455 40-44 0.28500000000000003 45-49 0.49500000000000005 50-54 0.8250000000000001 55-59 0.8049999999999999 60-64 0.9950000000000001 65-69 1.13 70-74 1.39 75-79 1.51 80-84 1.825 85-89 1.7000000000000002 90-94 1.915 95-99 1.855 100-104 1.9 105-109 1.82 110-114 2.02 115-119 2.11 120-124 2.19 125-129 2.2800000000000002 130-134 2.265 135-139 2.335 140-144 2.2399999999999998 145-149 2.25 150-151 2.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41992433795713 98.55000000000001 2 0.37831021437578816 0.75 3 0.1008827238335435 0.3 4 0.1008827238335435 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.38749999999999996 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.7000000000000002 0.0 0.0 0.0 0.0 120-121 1.9749999999999999 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.699999999999999 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra Read 990040 spots for SRR14458896.sra Written 990040 spots for SRR14458896.sra SRR ids: ['SRR14458896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8tp_bzzb SRR14458896.sra spots: 19800800 blocks: [[1, 990040], [990041, 1980080], [1980081, 2970120], [2970121, 3960160], [3960161, 4950200], [4950201, 5940240], [5940241, 6930280], [6930281, 7920320], [7920321, 8910360], [8910361, 9900400], [9900401, 10890440], [10890441, 11880480], [11880481, 12870520], [12870521, 13860560], [13860561, 14850600], [14850601, 15840640], [15840641, 16830680], [16830681, 17820720], [17820721, 18810760], [18810761, 19800800]] SRR14458896 file size 6707477 SRR14458896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458896 SRR14458896_1.fastq SRR14458896_2.fastq Input file: SRR14458896_1.fastq Paired file: SRR14458896_2.fastq trimmed: SRR14458896-trimmed-pair1.fastq, SRR14458896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:41:42 2024 >> started Sat Dec 7 18:42:05 2024 >> done (23.140s) 19800800 read pairs processed; of these: 3624 ( 0.02%) short read pairs filtered out after trimming by size control 2315 ( 0.01%) empty read pairs filtered out after trimming by size control 19794861 (99.97%) read pairs available; of these: 2727028 (13.78%) trimmed read pairs available after processing 17067833 (86.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 151 0.00% 19 145 0.00% 20 144 0.00% 21 159 0.00% 22 138 0.00% 23 129 0.00% 24 141 0.00% 25 121 0.00% 26 147 0.00% 27 117 0.00% 28 106 0.00% 29 138 0.00% 30 107 0.00% 31 98 0.00% 32 130 0.00% 33 88 0.00% 34 171 0.00% 35 106 0.00% 36 110 0.00% 37 96 0.00% 38 109 0.00% 39 110 0.00% 40 104 0.00% 41 115 0.00% 42 87 0.00% 43 99 0.00% 44 111 0.00% 45 110 0.00% 46 113 0.00% 47 118 0.00% 48 102 0.00% 49 129 0.00% 50 137 0.00% 51 119 0.00% 52 140 0.00% 53 151 0.00% 54 130 0.00% 55 113 0.00% 56 153 0.00% 57 137 0.00% 58 172 0.00% 59 165 0.00% 60 229 0.00% 61 214 0.00% 62 218 0.00% 63 233 0.00% 64 217 0.00% 65 276 0.00% 66 249 0.00% 67 255 0.00% 68 314 0.00% 69 322 0.00% 70 339 0.00% 71 365 0.00% 72 463 0.00% 73 459 0.00% 74 468 0.00% 75 537 0.00% 76 546 0.00% 77 650 0.00% 78 636 0.00% 79 766 0.00% 80 865 0.00% 81 1048 0.01% 82 1117 0.01% 83 1300 0.01% 84 1461 0.01% 85 1624 0.01% 86 1754 0.01% 87 2085 0.01% 88 2842 0.01% 89 4290 0.02% 90 5188 0.03% 91 4516 0.02% 92 4215 0.02% 93 4444 0.02% 94 5281 0.03% 95 6189 0.03% 96 6738 0.03% 97 6598 0.03% 98 7252 0.04% 99 8922 0.05% 100 10399 0.05% 101 10770 0.05% 102 10759 0.05% 103 12553 0.06% 104 13793 0.07% 105 14316 0.07% 106 15593 0.08% 107 16369 0.08% 108 16486 0.08% 109 18460 0.09% 110 20702 0.10% 111 21878 0.11% 112 24622 0.12% 113 26921 0.14% 114 30442 0.15% 115 32646 0.16% 116 33650 0.17% 117 34316 0.17% 118 34750 0.18% 119 36367 0.18% 120 38395 0.19% 121 40860 0.21% 122 45319 0.23% 123 49469 0.25% 124 52827 0.27% 125 55992 0.28% 126 57143 0.29% 127 57976 0.29% 128 58708 0.30% 129 58933 0.30% 130 61232 0.31% 131 62981 0.32% 132 66099 0.33% 133 71445 0.36% 134 75122 0.38% 135 76755 0.39% 136 78727 0.40% 137 78218 0.40% 138 78075 0.39% 139 77315 0.39% 140 77649 0.39% 141 78086 0.39% 142 82494 0.42% 143 85265 0.43% 144 87176 0.44% 145 89892 0.45% 146 88814 0.45% 147 90841 0.46% 148 94999 0.48% 149 91224 0.46% 150 92454 0.47% 151 17067833 86.22% 19794861 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=10 prefix-density=0.60 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.77 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=GCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=8 prefix-density=0.62 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=19.15 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458896 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:43:02 Started mapping on | Dec 07 18:43:02 Finished on | Dec 07 18:46:29 Mapping speed, Million of reads per hour | 344.26 Number of input reads | 19794861 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17719202 Uniquely mapped reads % | 89.51% Average mapped length | 292.33 Number of splices: Total | 17452750 Number of splices: Annotated (sjdb) | 16502646 Number of splices: GT/AG | 17220607 Number of splices: GC/AG | 196536 Number of splices: AT/AC | 6532 Number of splices: Non-canonical | 29075 Mismatch rate per base, % | 0.72% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343350 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 41052 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.28% % of reads unmapped: other | 2.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1732788 1732788 1732788 N_multimapping 343350 343350 343350 N_noFeature 530275 8897742 9034673 N_ambiguous 410681 49766 47604 UnstrandedReadsAssigned:16778246 PositiveStrandReadsAssigned:8771694 NegativeStrandReadsAssigned:8636925 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458896-trimmed-pair1.fastq SRR14458896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,794,861 reads, 17,997,692 reads pseudoaligned [quant] estimated average fragment length: 246.451 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,279 rounds 52973 SRR14458896.ke.tsv 35125 SRR14458896.se.tsv 88098 total ==> SRR14458896.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.898 0 0 PNS24247 1044 798.549 32.3234 2.88204 PNS24249 1928 1682.55 138.777 5.87265 PNS24246 1044 798.549 32.3234 2.88204 PNS24248 1044 798.549 32.3234 2.88204 PNS24244 1471 1225.55 36.2526 2.10617 PNS24243 293 99.5761 3 2.14511 KQK14069 1603 1357.55 4072.92 213.616 KQK14071 474 242.495 172.34 50.6018 ==> SRR14458896.se.tsv <== BRADI_1g14170v3 4767 BRADI_1g53295v3 37 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 2260 BRADI_1g74790v3 614 BRADI_1g09890v3 5 BRADI_1g77505v3 408 BRADI_1g48960v3 0 SRR14458896 completed mapping pipeline successfully