Starting /dee2/code/volunteer_pipeline.sh SRR14458897 current disk space = 1540403507200 free memory = 1595698580 SRR14458897 SRAfilesize ed86721ca24cf93b47fb622ad657a77f SRR14458897.sra SRR14458897.sra file validated SRR14458897 is paired end SRR14458897 is conventional basespace SRR14458897 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.932 32.0 32.0 32.0 32.0 32.0 2 31.1895 32.0 32.0 32.0 32.0 32.0 3 31.247 32.0 32.0 32.0 32.0 32.0 4 31.34175 32.0 32.0 32.0 32.0 32.0 5 31.397 32.0 32.0 32.0 32.0 32.0 6 34.14675 36.0 36.0 36.0 32.0 36.0 7 34.549 36.0 36.0 36.0 32.0 36.0 8 34.432 36.0 36.0 36.0 32.0 36.0 9 34.586 36.0 36.0 36.0 32.0 36.0 10-14 34.52425 36.0 36.0 36.0 32.0 36.0 15-19 34.540800000000004 36.0 36.0 36.0 32.0 36.0 20-24 34.39895 36.0 36.0 36.0 32.0 36.0 25-29 34.240899999999996 36.0 36.0 36.0 32.0 36.0 30-34 34.0529 36.0 36.0 36.0 32.0 36.0 35-39 33.910450000000004 36.0 36.0 36.0 32.0 36.0 40-44 33.82875 36.0 36.0 36.0 32.0 36.0 45-49 33.80395 36.0 36.0 36.0 32.0 36.0 50-54 33.65145 36.0 36.0 36.0 29.0 36.0 55-59 33.45255 36.0 36.0 36.0 23.4 36.0 60-64 33.3228 36.0 36.0 36.0 23.4 36.0 65-69 33.226 36.0 36.0 36.0 21.0 36.0 70-74 32.9875 36.0 33.6 36.0 20.8 36.0 75-79 32.7799 36.0 32.0 36.0 21.0 36.0 80-84 32.8743 36.0 32.0 36.0 21.0 36.0 85-89 32.8149 36.0 32.0 36.0 21.0 36.0 90-94 32.67415000000001 36.0 32.0 36.0 16.8 36.0 95-99 32.51055 36.0 32.0 36.0 15.4 36.0 100-104 32.522749999999995 36.0 32.0 36.0 14.0 36.0 105-109 32.425399999999996 36.0 32.0 36.0 14.0 36.0 110-114 32.447 36.0 32.0 36.0 14.0 36.0 115-119 32.2943 36.0 32.0 36.0 14.0 36.0 120-124 32.17274999999999 36.0 32.0 36.0 14.0 36.0 125-129 31.9156 36.0 32.0 36.0 14.0 36.0 130-134 31.885550000000002 36.0 32.0 36.0 14.0 36.0 135-139 31.646500000000003 36.0 32.0 36.0 14.0 36.0 140-144 31.2455 36.0 29.0 36.0 14.0 36.0 145-149 30.893700000000003 36.0 27.0 36.0 14.0 36.0 150-151 28.742875 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 9.0 22 10.0 23 26.0 24 30.0 25 55.0 26 83.0 27 99.0 28 140.0 29 162.0 30 220.0 31 272.0 32 390.0 33 536.0 34 946.0 35 1018.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.7 12.174999999999999 11.35 50.775000000000006 2 21.825 16.55 32.25 29.375 3 21.025 20.1 23.375 35.5 4 26.450000000000003 24.025 19.175 30.349999999999998 5 28.95 26.875 20.225 23.95 6 27.444081427494343 30.63583815028902 20.080422216637345 21.83965820557929 7 22.175 19.5 33.875 24.45 8 21.875 22.625 25.900000000000002 29.599999999999998 9 23.625 20.424999999999997 29.225 26.724999999999998 10-14 24.87 25.145 23.02 26.965 15-19 26.115 23.47 23.39 27.025 20-24 25.790000000000003 24.02 23.169999999999998 27.02 25-29 26.14022804560912 23.549709941988397 23.424684936987397 26.885377075415086 30-34 25.280112044817926 23.574429771908765 23.589435774309724 27.55602240896359 35-39 26.198578720848765 23.491142027825042 23.095786207586826 27.214493043739363 40-44 26.34610568494866 23.21061858251941 23.375907838717755 27.067367893814176 45-49 26.385964912280702 22.957393483709275 23.418546365914786 27.23809523809524 50-54 26.22745490981964 23.491983967935873 22.680360721442884 27.600200400801604 55-59 27.007079379424614 23.57784806948838 22.62388913993071 26.7911834111563 60-64 26.21709701679619 23.389320631737277 23.0032589621459 27.39032338932063 65-69 26.028154851684267 23.775766716943185 22.92609351432881 27.26998491704374 70-74 27.00671409960918 22.958212245716002 23.349032969235395 26.686040685439423 75-79 26.622888365331594 23.25429846107574 22.467291593563587 27.655521580029074 80-84 27.044749224146564 23.160476524176595 22.830113124436878 26.964661127239964 85-89 27.299094864229634 22.478371755763366 22.993449017352603 27.229084362654397 90-94 27.155 22.945 22.535 27.365000000000002 95-99 27.189999999999998 22.775000000000002 22.85 27.185 100-104 26.779999999999998 23.169999999999998 22.655 27.395000000000003 105-109 27.700000000000003 22.939999999999998 22.634999999999998 26.724999999999998 110-114 27.305 22.91 23.035 26.75 115-119 27.48 22.985 22.625 26.91 120-124 28.065 23.16 22.21 26.565 125-129 27.975 23.82 21.7 26.505000000000003 130-134 27.944999999999997 23.32 21.935 26.8 135-139 27.439999999999998 23.735 22.27 26.555 140-144 27.365000000000002 23.905 22.35 26.38 145-149 27.37 24.67 21.395 26.565 150-151 27.625 24.3875 21.0375 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 2.0 29 3.5 30 5.0 31 7.5 32 10.0 33 13.0 34 14.5 35 20.0 36 31.5 37 36.0 38 51.5 39 65.5 40 81.5 41 108.5 42 126.0 43 139.0 44 143.0 45 142.0 46 141.0 47 144.0 48 150.0 49 144.5 50 132.5 51 127.0 52 122.0 53 115.0 54 121.0 55 116.5 56 102.0 57 110.0 58 107.0 59 100.0 60 95.5 61 95.0 62 93.0 63 83.5 64 94.5 65 92.0 66 84.0 67 86.0 68 73.0 69 66.5 70 67.5 71 62.5 72 53.5 73 44.5 74 40.5 75 35.0 76 28.0 77 21.5 78 14.0 79 8.0 80 6.0 81 4.5 82 3.5 83 3.0 84 1.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.5 90 2.0 91 1.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.525 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.04 35-39 0.09 40-44 0.17500000000000002 45-49 0.25 50-54 0.2 55-59 0.415 60-64 0.27499999999999997 65-69 0.5499999999999999 70-74 0.21 75-79 0.255 80-84 0.11 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.42778057372924005 0.8500000000000001 3 0.0754906894816306 0.22499999999999998 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.5499999999999998 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.6624999999999996 0.0 0.0 0.0 0.0 124-125 3.2125000000000004 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.862500000000001 0.0 0.0 0.0 0.0 138-139 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458897 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.80425 32.0 32.0 32.0 32.0 32.0 2 30.49925 32.0 32.0 32.0 32.0 32.0 3 30.40375 32.0 32.0 32.0 32.0 32.0 4 30.46075 32.0 32.0 32.0 32.0 32.0 5 30.53775 32.0 32.0 32.0 32.0 32.0 6 33.7315 36.0 36.0 36.0 21.0 36.0 7 33.75225 36.0 36.0 36.0 32.0 36.0 8 33.802 36.0 36.0 36.0 32.0 36.0 9 33.876 36.0 36.0 36.0 32.0 36.0 10-14 33.77405 36.0 36.0 36.0 29.8 36.0 15-19 33.721 36.0 36.0 36.0 28.8 36.0 20-24 33.5772 36.0 36.0 36.0 24.4 36.0 25-29 33.543000000000006 36.0 36.0 36.0 25.8 36.0 30-34 33.443549999999995 36.0 36.0 36.0 21.0 36.0 35-39 33.335899999999995 36.0 36.0 36.0 19.4 36.0 40-44 33.3698 36.0 36.0 36.0 22.2 36.0 45-49 33.203649999999996 36.0 36.0 36.0 18.0 36.0 50-54 32.981300000000005 36.0 36.0 36.0 15.4 36.0 55-59 32.80385 36.0 36.0 36.0 14.0 36.0 60-64 32.557750000000006 36.0 36.0 36.0 14.0 36.0 65-69 32.2117 36.0 32.0 36.0 14.0 36.0 70-74 31.779950000000003 36.0 32.0 36.0 14.0 36.0 75-79 31.592450000000003 36.0 32.0 36.0 14.0 36.0 80-84 31.306099999999997 36.0 32.0 36.0 14.0 36.0 85-89 31.43655 36.0 32.0 36.0 14.0 36.0 90-94 31.06035 36.0 32.0 36.0 14.0 36.0 95-99 31.117649999999998 36.0 32.0 36.0 14.0 36.0 100-104 31.0425 36.0 32.0 36.0 14.0 36.0 105-109 30.9459 36.0 32.0 36.0 14.0 36.0 110-114 30.748199999999997 36.0 31.0 36.0 14.0 36.0 115-119 30.35795 36.0 27.0 36.0 14.0 36.0 120-124 30.29975 36.0 27.0 36.0 14.0 36.0 125-129 29.88265 36.0 27.0 36.0 14.0 36.0 130-134 29.49155 33.6 27.0 36.0 14.0 36.0 135-139 28.884500000000003 32.0 27.0 36.0 14.0 36.0 140-144 28.871549999999996 32.0 27.0 36.0 14.0 36.0 145-149 28.903250000000003 32.0 27.0 36.0 14.0 36.0 150-151 26.101 29.5 17.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 15.0 11 9.0 12 8.0 13 10.0 14 8.0 15 9.0 16 9.0 17 14.0 18 12.0 19 19.0 20 12.0 21 20.0 22 36.0 23 32.0 24 59.0 25 76.0 26 106.0 27 143.0 28 169.0 29 200.0 30 277.0 31 332.0 32 435.0 33 559.0 34 830.0 35 597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.55613903475869 12.203050762690673 10.152538134533634 53.088272068017005 2 23.625 16.825000000000003 32.824999999999996 26.724999999999998 3 22.45 18.9 23.425 35.225 4 28.225 22.35 18.099999999999998 31.324999999999996 5 29.5 26.275 20.474999999999998 23.75 6 25.900000000000002 30.75 19.225 24.125 7 22.975 19.35 33.375 24.3 8 22.375 22.675 25.2 29.75 9 23.5 21.075 28.749999999999996 26.674999999999997 10-14 25.335 24.87 22.88 26.915 15-19 26.369999999999997 23.11 23.125 27.395000000000003 20-24 25.665 24.39 22.415 27.529999999999998 25-29 26.284999999999997 23.585 23.01 27.12 30-34 25.9566805062278 24.085838627382323 22.715221849832425 27.24225901655745 35-39 26.27986348122867 23.976109215017065 23.0827143143947 26.661312989359566 40-44 26.278103249712082 23.479044614691304 23.063441990886783 27.17941014470983 45-49 26.19334740227113 23.726258667470606 22.60074364385489 27.479650286403377 50-54 26.411951748851763 23.62085499419573 22.611416746580527 27.355776510371975 55-59 26.578960633096425 23.6201421442613 22.843893341398257 26.957003881244013 60-64 26.756072874493924 23.071862348178136 22.965587044534413 27.206477732793523 65-69 26.233581824636136 23.753740047669762 22.50621228257011 27.50646584512399 70-74 26.722338204592898 23.646825194765515 22.658994857171955 26.971841743469625 75-79 26.303438424650544 22.773186409550046 23.191511070298947 27.73186409550046 80-84 26.698084212683128 23.773178977563774 22.487450056346685 27.041286753406414 85-89 27.058823529411764 23.25831202046036 22.685421994884912 26.997442455242965 90-94 26.474207773561687 23.320685057942775 23.095067172597684 27.110039995897857 95-99 26.78827628612421 23.5704037712646 22.929903668784586 26.711416273826604 100-104 27.122641509433965 22.872231337161608 22.908121410992617 27.097005742411813 105-109 26.761285033560483 23.73315571040631 22.877491417738383 26.62806783829482 110-114 26.693718218706664 23.103395140993374 22.9390312804972 27.263855359802765 115-119 26.535234467493694 23.81736758120142 22.623153343285118 27.024244608019764 120-124 27.17290442313641 23.87359521600165 22.296113001340345 26.6573873595216 125-129 27.553076088640942 23.472286791673124 22.08275220827522 26.891884911410713 130-134 27.33608673205989 23.618998451213216 22.75684047496128 26.288074341765615 135-139 28.682891541363098 23.78442618715445 22.037926936392292 25.49475533509017 140-144 29.19395595895003 23.588262596049713 22.257748439997936 24.960033005002323 145-149 28.87730884325663 24.197709214735323 22.0978227221133 24.82715921989475 150-151 29.03059248741448 23.54459790886795 22.408674325545373 25.016135278172197 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 3.0 19 2.5 20 3.0 21 3.0 22 2.5 23 3.5 24 5.0 25 5.5 26 6.5 27 5.5 28 3.0 29 3.0 30 7.0 31 12.5 32 14.5 33 12.0 34 14.5 35 24.0 36 37.0 37 46.5 38 51.0 39 70.0 40 88.5 41 94.5 42 108.0 43 134.0 44 146.5 45 143.5 46 146.0 47 156.0 48 146.5 49 124.0 50 126.0 51 129.0 52 116.5 53 98.5 54 100.0 55 108.0 56 105.0 57 97.0 58 95.0 59 106.0 60 102.5 61 96.5 62 101.0 63 99.5 64 88.0 65 90.0 66 90.0 67 82.0 68 81.0 69 71.5 70 71.0 71 63.0 72 50.5 73 50.0 74 40.5 75 29.5 76 22.5 77 15.0 78 13.0 79 12.0 80 6.0 81 5.5 82 5.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.045 35-39 0.38 40-44 0.145 45-49 0.49 50-54 0.935 55-59 0.8049999999999999 60-64 1.2 65-69 1.405 70-74 1.805 75-79 1.9900000000000002 80-84 2.39 85-89 2.25 90-94 2.4899999999999998 95-99 2.42 100-104 2.48 105-109 2.415 110-114 2.6550000000000002 115-119 2.8649999999999998 120-124 3.01 125-129 3.205 130-134 3.15 135-139 3.235 140-144 3.045 145-149 3.09 150-151 3.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16624557857504 98.125 2 0.7074279939363315 1.4000000000000001 3 0.07579585649317837 0.22499999999999998 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.025265285497726126 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.9249999999999998 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.9499999999999997 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 5.074999999999999 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.4625 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCAA 10 0.0070833815 143.25 9 >>END_MODULE Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389578 spots for SRR14458897.sra Written 1389578 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra Read 1389566 spots for SRR14458897.sra Written 1389566 spots for SRR14458897.sra SRR ids: ['SRR14458897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d8623ual SRR14458897.sra spots: 27791332 blocks: [[1, 1389566], [1389567, 2779132], [2779133, 4168698], [4168699, 5558264], [5558265, 6947830], [6947831, 8337396], [8337397, 9726962], [9726963, 11116528], [11116529, 12506094], [12506095, 13895660], [13895661, 15285226], [15285227, 16674792], [16674793, 18064358], [18064359, 19453924], [19453925, 20843490], [20843491, 22233056], [22233057, 23622622], [23622623, 25012188], [25012189, 26401754], [26401755, 27791332]] SRR14458897 file size 9423010 SRR14458897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458897 SRR14458897_1.fastq SRR14458897_2.fastq Input file: SRR14458897_1.fastq Paired file: SRR14458897_2.fastq trimmed: SRR14458897-trimmed-pair1.fastq, SRR14458897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:49:38 2024 >> started Sat Dec 7 18:50:10 2024 >> done (31.501s) 27791332 read pairs processed; of these: 3781 ( 0.01%) short read pairs filtered out after trimming by size control 3385 ( 0.01%) empty read pairs filtered out after trimming by size control 27784166 (99.97%) read pairs available; of these: 4594920 (16.54%) trimmed read pairs available after processing 23189246 (83.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 160 0.00% 19 164 0.00% 20 161 0.00% 21 137 0.00% 22 139 0.00% 23 154 0.00% 24 152 0.00% 25 117 0.00% 26 130 0.00% 27 146 0.00% 28 153 0.00% 29 140 0.00% 30 115 0.00% 31 153 0.00% 32 148 0.00% 33 108 0.00% 34 181 0.00% 35 129 0.00% 36 145 0.00% 37 123 0.00% 38 122 0.00% 39 101 0.00% 40 130 0.00% 41 129 0.00% 42 117 0.00% 43 117 0.00% 44 148 0.00% 45 136 0.00% 46 157 0.00% 47 153 0.00% 48 134 0.00% 49 168 0.00% 50 166 0.00% 51 156 0.00% 52 165 0.00% 53 167 0.00% 54 194 0.00% 55 187 0.00% 56 216 0.00% 57 178 0.00% 58 222 0.00% 59 275 0.00% 60 290 0.00% 61 280 0.00% 62 323 0.00% 63 288 0.00% 64 322 0.00% 65 364 0.00% 66 375 0.00% 67 393 0.00% 68 403 0.00% 69 492 0.00% 70 538 0.00% 71 646 0.00% 72 687 0.00% 73 775 0.00% 74 823 0.00% 75 830 0.00% 76 890 0.00% 77 1016 0.00% 78 1071 0.00% 79 1319 0.00% 80 1493 0.01% 81 1795 0.01% 82 2127 0.01% 83 2429 0.01% 84 2603 0.01% 85 2857 0.01% 86 3098 0.01% 87 3502 0.01% 88 4677 0.02% 89 6813 0.02% 90 8395 0.03% 91 7573 0.03% 92 7722 0.03% 93 8035 0.03% 94 9364 0.03% 95 10704 0.04% 96 11299 0.04% 97 11624 0.04% 98 12456 0.04% 99 15233 0.05% 100 17672 0.06% 101 18176 0.07% 102 19202 0.07% 103 22142 0.08% 104 24491 0.09% 105 25765 0.09% 106 27518 0.10% 107 28286 0.10% 108 29022 0.10% 109 32051 0.12% 110 35804 0.13% 111 37922 0.14% 112 42887 0.15% 113 47572 0.17% 114 52841 0.19% 115 56817 0.20% 116 57801 0.21% 117 58793 0.21% 118 59502 0.21% 119 62016 0.22% 120 65205 0.23% 121 70085 0.25% 122 77533 0.28% 123 83916 0.30% 124 89658 0.32% 125 94713 0.34% 126 97810 0.35% 127 97665 0.35% 128 98533 0.35% 129 98219 0.35% 130 101567 0.37% 131 105804 0.38% 132 110622 0.40% 133 120442 0.43% 134 126168 0.45% 135 129456 0.47% 136 132731 0.48% 137 131314 0.47% 138 129014 0.46% 139 129566 0.47% 140 129844 0.47% 141 130725 0.47% 142 137145 0.49% 143 142721 0.51% 144 145946 0.53% 145 151167 0.54% 146 149202 0.54% 147 152116 0.55% 148 155866 0.56% 149 150315 0.54% 150 151255 0.54% 151 23189246 83.46% 27784166 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=7 prefix-density=0.59 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=17.46 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=10 prefix-density=0.56 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.26 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458897 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:51:04 Started mapping on | Dec 07 18:51:04 Finished on | Dec 07 18:55:26 Mapping speed, Million of reads per hour | 381.77 Number of input reads | 27784166 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 25135261 Uniquely mapped reads % | 90.47% Average mapped length | 291.35 Number of splices: Total | 24708938 Number of splices: Annotated (sjdb) | 23369986 Number of splices: GT/AG | 24380162 Number of splices: GC/AG | 279448 Number of splices: AT/AC | 9284 Number of splices: Non-canonical | 40044 Mismatch rate per base, % | 0.72% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431993 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 48653 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 1.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2217531 2217531 2217531 N_multimapping 431993 431993 431993 N_noFeature 712310 12578493 12818686 N_ambiguous 567817 62333 60448 UnstrandedReadsAssigned:23855134 PositiveStrandReadsAssigned:12494435 NegativeStrandReadsAssigned:12256127 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458897-trimmed-pair1.fastq SRR14458897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,784,166 reads, 25,529,371 reads pseudoaligned [quant] estimated average fragment length: 232.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR14458897.ke.tsv 35125 SRR14458897.se.tsv 88098 total ==> SRR14458897.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.667 0 0 PNS24247 1044 812.389 32.941 2.0773 PNS24249 1928 1696.39 178.195 5.38143 PNS24246 1044 812.389 32.941 2.0773 PNS24248 1044 812.389 32.941 2.0773 PNS24244 1471 1239.39 22.9816 0.949947 PNS24243 293 103.671 4 1.97664 KQK14069 1603 1371.39 7917.73 295.779 KQK14071 474 253.026 420.136 85.0651 ==> SRR14458897.se.tsv <== BRADI_1g14170v3 9549 BRADI_1g53295v3 58 BRADI_1g59795v3 366 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 2684 BRADI_1g74790v3 960 BRADI_1g09890v3 17 BRADI_1g77505v3 505 BRADI_1g48960v3 0 SRR14458897 completed mapping pipeline successfully