Starting /dee2/code/volunteer_pipeline.sh SRR14458898 current disk space = 1540400476160 free memory = 1599172368 SRR14458898 SRAfilesize 223945a9eea03273971c1e3e2614d459 SRR14458898.sra SRR14458898.sra file validated SRR14458898 is paired end SRR14458898 is conventional basespace SRR14458898 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.907 32.0 32.0 32.0 32.0 32.0 2 31.12425 32.0 32.0 32.0 32.0 32.0 3 31.0995 32.0 32.0 32.0 32.0 32.0 4 31.15125 32.0 32.0 32.0 32.0 32.0 5 31.145 32.0 32.0 32.0 32.0 32.0 6 34.01625 36.0 36.0 36.0 32.0 36.0 7 34.35575 36.0 36.0 36.0 32.0 36.0 8 34.327 36.0 36.0 36.0 32.0 36.0 9 34.38675 36.0 36.0 36.0 32.0 36.0 10-14 34.269999999999996 36.0 36.0 36.0 32.0 36.0 15-19 34.31975 36.0 36.0 36.0 32.0 36.0 20-24 34.265950000000004 36.0 36.0 36.0 32.0 36.0 25-29 34.01335 36.0 36.0 36.0 32.0 36.0 30-34 33.87935 36.0 36.0 36.0 32.0 36.0 35-39 33.89825 36.0 36.0 36.0 32.0 36.0 40-44 33.747699999999995 36.0 36.0 36.0 32.0 36.0 45-49 33.6649 36.0 36.0 36.0 30.0 36.0 50-54 33.5435 36.0 36.0 36.0 26.6 36.0 55-59 33.3237 36.0 36.0 36.0 21.0 36.0 60-64 33.24065 36.0 36.0 36.0 21.0 36.0 65-69 33.0789 36.0 36.0 36.0 19.6 36.0 70-74 32.925349999999995 36.0 32.0 36.0 21.0 36.0 75-79 32.73355 36.0 32.0 36.0 19.6 36.0 80-84 32.70575 36.0 32.0 36.0 19.6 36.0 85-89 32.55155 36.0 32.0 36.0 16.8 36.0 90-94 32.5563 36.0 32.0 36.0 14.0 36.0 95-99 32.400850000000005 36.0 32.0 36.0 14.0 36.0 100-104 32.33905 36.0 32.0 36.0 14.0 36.0 105-109 32.17955 36.0 32.0 36.0 14.0 36.0 110-114 32.1641 36.0 32.0 36.0 14.0 36.0 115-119 32.11025 36.0 32.0 36.0 14.0 36.0 120-124 31.906349999999996 36.0 32.0 36.0 14.0 36.0 125-129 31.661850000000005 36.0 32.0 36.0 14.0 36.0 130-134 31.5533 36.0 32.0 36.0 14.0 36.0 135-139 31.534749999999995 36.0 32.0 36.0 14.0 36.0 140-144 30.98445 36.0 29.0 36.0 14.0 36.0 145-149 30.478050000000003 32.8 27.0 36.0 14.0 36.0 150-151 28.37775 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 10.0 22 14.0 23 24.0 24 34.0 25 63.0 26 66.0 27 105.0 28 143.0 29 188.0 30 213.0 31 346.0 32 436.0 33 564.0 34 999.0 35 793.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.85 12.475 10.424999999999999 52.25 2 21.125 18.099999999999998 34.150000000000006 26.625 3 21.425 19.75 24.349999999999998 34.475 4 25.874999999999996 25.025 18.0 31.1 5 27.05 28.125 20.3 24.525 6 25.425851703406817 32.48997995991984 19.238476953907817 22.84569138276553 7 22.375 19.75 35.725 22.15 8 23.925 20.474999999999998 26.75 28.849999999999998 9 22.675 20.25 29.975 27.1 10-14 24.915000000000003 25.775 22.735 26.575 15-19 25.685000000000002 23.82 23.225 27.27 20-24 25.915 23.810000000000002 23.57 26.705000000000002 25-29 26.01260126012601 23.417341734173416 23.742374237423743 26.82768276827683 30-34 25.893884082612388 24.15362304345652 23.113467020053008 26.83902585387808 35-39 25.96149037259315 23.15578894723681 23.735933983495876 27.14678669667417 40-44 26.38715164857157 23.880522339520688 22.819832891379395 26.912493120528342 45-49 25.618179997997796 23.335669236159777 24.016418059865853 27.02973270597657 50-54 26.040624374624777 23.38903342005203 23.564138483089852 27.00620372223334 55-59 26.35507464181946 23.509668369902815 22.87345957318906 27.26179741508867 60-64 26.40404444889378 23.33066373010311 23.00530583642006 27.25998598458304 65-69 26.353247794707297 23.80212510024058 22.54410585404972 27.300521251002408 70-74 26.58126501200961 23.43875100080064 22.953362690152122 27.02662129703763 75-79 26.526220976781424 23.49379503602882 22.628102481985586 27.35188150520416 80-84 26.45425899064673 23.753313659780922 23.483219126694344 26.309208222878006 85-89 26.811340567028353 23.081154057702886 23.486174308715434 26.621331066553328 90-94 26.740000000000002 22.994999999999997 23.35 26.915 95-99 26.745 22.685 23.405 27.165 100-104 27.115000000000002 23.34 22.830000000000002 26.715 105-109 26.865 22.814999999999998 22.96 27.36 110-114 26.851342567128356 23.67118355917796 23.091154557727886 26.3863193159658 115-119 27.279999999999998 23.57 22.67 26.479999999999997 120-124 26.995 23.65 22.355 27.0 125-129 27.400000000000002 23.95 22.314999999999998 26.334999999999997 130-134 27.525 24.125 22.085 26.265 135-139 27.245 24.525 21.615000000000002 26.615 140-144 27.284999999999997 23.525 22.575 26.615 145-149 27.515 24.595 21.529999999999998 26.36 150-151 27.0 24.6875 22.25 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 1.5 27 1.5 28 1.5 29 2.5 30 4.0 31 6.0 32 9.0 33 15.5 34 20.5 35 22.5 36 30.0 37 42.0 38 60.0 39 73.5 40 79.5 41 96.0 42 116.0 43 126.0 44 139.5 45 151.0 46 153.0 47 158.5 48 153.0 49 146.0 50 146.0 51 131.0 52 126.5 53 126.5 54 113.5 55 98.0 56 98.0 57 112.5 58 108.5 59 112.5 60 111.5 61 99.5 62 102.0 63 96.5 64 89.0 65 77.0 66 68.0 67 73.0 68 66.0 69 62.0 70 66.0 71 60.0 72 56.0 73 47.5 74 33.0 75 29.0 76 25.0 77 15.0 78 12.5 79 10.5 80 6.0 81 3.5 82 1.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.015 35-39 0.025 40-44 0.065 45-49 0.11 50-54 0.06 55-59 0.19 60-64 0.11 65-69 0.24 70-74 0.08 75-79 0.08 80-84 0.034999999999999996 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.808489135927236 1.6 3 0.07579585649317837 0.22499999999999998 4 0.0 0.0 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0125 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.037500000000000006 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.0625 0.0 0.0 0.0 0.025 80-81 0.075 0.0 0.0 0.0 0.025 82-83 0.0875 0.0 0.0 0.0 0.025 84-85 0.125 0.0 0.0 0.0 0.025 86-87 0.15 0.0 0.0 0.0 0.025 88-89 0.175 0.0 0.0 0.0 0.025 90-91 0.225 0.0 0.0 0.0 0.025 92-93 0.2625 0.0 0.0 0.0 0.025 94-95 0.30000000000000004 0.0 0.0 0.0 0.025 96-97 0.38749999999999996 0.0 0.0 0.0 0.025 98-99 0.5249999999999999 0.0 0.0 0.0 0.025 100-101 0.6 0.0 0.0 0.0 0.025 102-103 0.7375 0.0 0.0 0.0 0.025 104-105 0.9 0.0 0.0 0.0 0.025 106-107 1.175 0.0 0.0 0.0 0.025 108-109 1.4125 0.0 0.0 0.0 0.025 110-111 1.6 0.0 0.0 0.0 0.025 112-113 1.9125 0.0 0.0 0.0 0.025 114-115 2.275 0.0 0.0 0.0 0.025 116-117 2.6625 0.0 0.0 0.0 0.025 118-119 2.9875 0.0 0.0 0.0 0.025 120-121 3.3125 0.0 0.0 0.0 0.025 122-123 3.825 0.0 0.0 0.0 0.025 124-125 4.55 0.0 0.0 0.0 0.025 126-127 5.0875 0.0 0.0 0.0 0.025 128-129 5.5625 0.0 0.0 0.0 0.025 130-131 6.3125 0.0 0.0 0.0 0.025 132-133 7.0 0.0 0.0 0.0 0.025 134-135 7.725 0.0 0.0 0.0 0.025 136-137 8.6375 0.0 0.0 0.0 0.025 138-139 9.4875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAATC 10 0.006830828 145.0 7 GTACAAC 10 0.006830828 145.0 5 TACAACA 10 0.006830828 145.0 6 CCGGGCT 10 0.006830828 145.0 3 >>END_MODULE SRR14458898 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9065 32.0 32.0 32.0 32.0 32.0 2 30.49 32.0 32.0 32.0 32.0 32.0 3 30.4595 32.0 32.0 32.0 32.0 32.0 4 30.698 32.0 32.0 32.0 32.0 32.0 5 30.52025 32.0 32.0 32.0 32.0 32.0 6 33.7685 36.0 36.0 36.0 32.0 36.0 7 33.88675 36.0 36.0 36.0 32.0 36.0 8 33.8175 36.0 36.0 36.0 32.0 36.0 9 33.716 36.0 36.0 36.0 32.0 36.0 10-14 33.78225 36.0 36.0 36.0 32.0 36.0 15-19 33.662549999999996 36.0 36.0 36.0 27.8 36.0 20-24 33.613800000000005 36.0 36.0 36.0 25.6 36.0 25-29 33.59475 36.0 36.0 36.0 25.8 36.0 30-34 33.502449999999996 36.0 36.0 36.0 23.4 36.0 35-39 33.4391 36.0 36.0 36.0 23.4 36.0 40-44 33.40045 36.0 36.0 36.0 23.4 36.0 45-49 33.28404999999999 36.0 36.0 36.0 20.8 36.0 50-54 33.1434 36.0 36.0 36.0 18.2 36.0 55-59 32.9079 36.0 36.0 36.0 14.0 36.0 60-64 32.751250000000006 36.0 36.0 36.0 14.0 36.0 65-69 32.39175 36.0 32.0 36.0 14.0 36.0 70-74 31.972199999999997 36.0 32.0 36.0 14.0 36.0 75-79 31.844150000000003 36.0 32.0 36.0 14.0 36.0 80-84 31.716649999999998 36.0 32.0 36.0 14.0 36.0 85-89 31.78365 36.0 32.0 36.0 14.0 36.0 90-94 31.496050000000004 36.0 32.0 36.0 14.0 36.0 95-99 31.5356 36.0 32.0 36.0 14.0 36.0 100-104 31.3967 36.0 32.0 36.0 14.0 36.0 105-109 31.395750000000003 36.0 32.0 36.0 14.0 36.0 110-114 31.183500000000002 36.0 31.0 36.0 14.0 36.0 115-119 30.8796 36.0 29.0 36.0 14.0 36.0 120-124 30.839199999999998 36.0 31.0 36.0 14.0 36.0 125-129 30.449450000000002 35.2 27.0 36.0 14.0 36.0 130-134 29.864150000000002 32.8 27.0 36.0 14.0 36.0 135-139 29.3144 32.0 27.0 36.0 14.0 36.0 140-144 29.16035 32.0 27.0 36.0 14.0 36.0 145-149 29.283350000000002 32.0 27.0 36.0 14.0 36.0 150-151 26.307125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 4.0 10 3.0 11 6.0 12 7.0 13 2.0 14 8.0 15 13.0 16 7.0 17 16.0 18 7.0 19 5.0 20 8.0 21 12.0 22 18.0 23 54.0 24 37.0 25 79.0 26 99.0 27 127.0 28 164.0 29 222.0 30 296.0 31 334.0 32 437.0 33 607.0 34 901.0 35 527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.6 11.975 9.575 53.849999999999994 2 22.55 17.224999999999998 33.625 26.6 3 22.325 18.975 22.725 35.975 4 27.1 23.849999999999998 17.9 31.15 5 30.25 26.75 19.650000000000002 23.35 6 25.55 33.074999999999996 19.400000000000002 21.975 7 22.5 19.025 34.050000000000004 24.425 8 22.8 20.875 26.325 30.0 9 22.825 20.424999999999997 28.825 27.925 10-14 25.31 24.985 23.28 26.424999999999997 15-19 25.480000000000004 23.735 23.275000000000002 27.51 20-24 25.495 23.735 23.86 26.91 25-29 26.224999999999998 23.294999999999998 22.855 27.625 30-34 26.185237047409483 23.414682936587315 23.189637927585515 27.210442088417686 35-39 25.287874236507456 23.790928206668667 23.545609292079703 27.375588264744167 40-44 25.94946209657243 24.218163622717036 22.727045283962973 27.105328996747563 45-49 26.356161636418328 23.914569337210466 22.83164544269528 26.897623583675923 50-54 25.429518738068925 23.897317391741183 23.314578519039486 27.358585351150406 55-59 26.429683185218657 23.141035296480396 22.940201837626148 27.4890796806748 60-64 26.465408805031448 23.63270440251572 23.371069182389938 26.530817610062897 65-69 25.90689238210399 23.836154776299878 23.36255542120113 26.894397420395 70-74 26.56518660867806 23.905127945787395 22.686355820774754 26.843329624759786 75-79 26.493822159205994 23.171966781446223 23.44541219363986 26.88879886570792 80-84 26.557426948051948 23.259943181818183 22.925121753246753 27.257508116883116 85-89 26.017743979721164 24.136882129277566 22.494296577946766 27.3510773130545 90-94 26.613557946011774 23.4929977674041 22.970367363507204 26.923076923076923 95-99 26.386281771599613 23.783674090609306 23.200243518847344 26.62980061894374 100-104 27.031004211701426 23.692089105394025 22.62647790125336 26.650428781651193 105-109 26.94063926940639 23.73921867072552 22.729578893962454 26.590563165905635 110-114 26.886577010910933 24.41004821111393 22.806394316163413 25.896980461811726 115-119 27.130956009346747 23.483693995733006 22.381387788275934 27.003962206644317 120-124 27.65860105734038 23.535990239934932 22.77348515656771 26.031923546156975 125-129 27.62481551223981 23.639879892106467 22.454068909359254 26.28123568629447 130-134 28.026255533506333 23.81315829644329 22.617412099933855 25.54317407011652 135-139 28.04480651731161 24.475560081466394 22.286150712830956 25.19348268839104 140-144 29.150353383840955 24.294503482991814 21.279300350841513 25.275842782325725 145-149 29.14314772438342 24.01728960081363 21.815408085430967 25.02415458937198 150-151 29.247202441505593 23.944557477110884 21.922685656154627 24.885554425228893 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 1.5 21 4.5 22 3.5 23 0.0 24 1.5 25 2.5 26 3.5 27 3.5 28 3.0 29 4.0 30 5.5 31 7.5 32 11.0 33 14.0 34 14.0 35 22.0 36 35.5 37 44.5 38 54.0 39 69.0 40 92.0 41 110.5 42 121.5 43 135.0 44 139.5 45 139.5 46 144.0 47 146.0 48 141.0 49 139.5 50 135.5 51 130.0 52 120.0 53 112.0 54 109.5 55 107.0 56 102.5 57 104.0 58 119.5 59 115.5 60 102.5 61 94.0 62 88.5 63 100.5 64 103.0 65 86.5 66 87.0 67 82.0 68 71.0 69 76.5 70 71.5 71 50.0 72 39.5 73 35.5 74 33.5 75 29.5 76 17.5 77 16.0 78 16.5 79 9.5 80 4.5 81 4.0 82 2.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.13 40-44 0.075 45-49 0.27 50-54 0.47000000000000003 55-59 0.415 60-64 0.625 65-69 0.76 70-74 1.13 75-79 1.26 80-84 1.44 85-89 1.375 90-94 1.46 95-99 1.4449999999999998 100-104 1.465 105-109 1.4500000000000002 110-114 1.4749999999999999 115-119 1.5699999999999998 120-124 1.6400000000000001 125-129 1.755 130-134 1.735 135-139 1.7999999999999998 140-144 1.6650000000000003 145-149 1.675 150-151 1.7000000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.655076845553036 1.3 3 0.02519526329050139 0.075 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.025 98-99 0.575 0.0 0.0 0.0 0.025 100-101 0.675 0.0 0.0 0.0 0.025 102-103 0.8374999999999999 0.0 0.0 0.0 0.025 104-105 0.9625 0.0 0.0 0.0 0.025 106-107 1.225 0.0 0.0 0.0 0.025 108-109 1.5 0.0 0.0 0.0 0.025 110-111 1.6749999999999998 0.0 0.0 0.0 0.025 112-113 1.9625 0.0 0.0 0.0 0.025 114-115 2.325 0.0 0.0 0.0 0.025 116-117 2.6375 0.0 0.0 0.0 0.025 118-119 2.9125 0.0 0.0 0.0 0.025 120-121 3.1875 0.0 0.0 0.0 0.025 122-123 3.575 0.0 0.0 0.0 0.025 124-125 4.237500000000001 0.0 0.0 0.0 0.025 126-127 4.737500000000001 0.0 0.0 0.0 0.025 128-129 5.2125 0.0 0.0 0.0 0.025 130-131 5.949999999999999 0.0 0.0 0.0 0.025 132-133 6.6125 0.0 0.0 0.0 0.025 134-135 7.3375 0.0 0.0 0.0 0.025 136-137 8.2875 0.0 0.0 0.0 0.025 138-139 9.1125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGATA 10 0.006959184 144.1 4 TGCACCC 10 0.006959184 144.1 6 GGACCAA 10 0.006959184 144.1 2 TCGGTGC 10 0.006959184 144.1 2 ACCCGAA 10 0.006959184 144.1 9 CACCCGA 10 0.006959184 144.1 8 CGGTGCA 10 0.006959184 144.1 3 TGGATGA 10 0.006959184 144.1 2 GCACCCG 10 0.006959184 144.1 7 >>END_MODULE Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944052 spots for SRR14458898.sra Written 944052 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra Read 944033 spots for SRR14458898.sra Written 944033 spots for SRR14458898.sra SRR ids: ['SRR14458898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o1y5zvqf SRR14458898.sra spots: 18880679 blocks: [[1, 944033], [944034, 1888066], [1888067, 2832099], [2832100, 3776132], [3776133, 4720165], [4720166, 5664198], [5664199, 6608231], [6608232, 7552264], [7552265, 8496297], [8496298, 9440330], [9440331, 10384363], [10384364, 11328396], [11328397, 12272429], [12272430, 13216462], [13216463, 14160495], [14160496, 15104528], [15104529, 16048561], [16048562, 16992594], [16992595, 17936627], [17936628, 18880679]] SRR14458898 file size 6394780 SRR14458898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458898 SRR14458898_1.fastq SRR14458898_2.fastq Input file: SRR14458898_1.fastq Paired file: SRR14458898_2.fastq trimmed: SRR14458898-trimmed-pair1.fastq, SRR14458898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:48:07 2024 >> started Sat Dec 7 18:48:30 2024 >> done (22.600s) 18880679 read pairs processed; of these: 3348 ( 0.02%) short read pairs filtered out after trimming by size control 2138 ( 0.01%) empty read pairs filtered out after trimming by size control 18875193 (99.97%) read pairs available; of these: 3177563 (16.83%) trimmed read pairs available after processing 15697630 (83.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 136 0.00% 19 149 0.00% 20 134 0.00% 21 126 0.00% 22 133 0.00% 23 118 0.00% 24 142 0.00% 25 118 0.00% 26 150 0.00% 27 102 0.00% 28 126 0.00% 29 149 0.00% 30 124 0.00% 31 118 0.00% 32 107 0.00% 33 106 0.00% 34 191 0.00% 35 108 0.00% 36 106 0.00% 37 94 0.00% 38 105 0.00% 39 103 0.00% 40 101 0.00% 41 140 0.00% 42 101 0.00% 43 121 0.00% 44 129 0.00% 45 113 0.00% 46 122 0.00% 47 134 0.00% 48 128 0.00% 49 126 0.00% 50 158 0.00% 51 124 0.00% 52 163 0.00% 53 165 0.00% 54 133 0.00% 55 164 0.00% 56 187 0.00% 57 193 0.00% 58 226 0.00% 59 220 0.00% 60 250 0.00% 61 254 0.00% 62 310 0.00% 63 302 0.00% 64 278 0.00% 65 356 0.00% 66 317 0.00% 67 363 0.00% 68 415 0.00% 69 448 0.00% 70 540 0.00% 71 674 0.00% 72 744 0.00% 73 823 0.00% 74 816 0.00% 75 888 0.00% 76 1022 0.01% 77 1065 0.01% 78 1165 0.01% 79 1340 0.01% 80 1562 0.01% 81 1811 0.01% 82 2117 0.01% 83 2384 0.01% 84 2677 0.01% 85 2979 0.02% 86 2961 0.02% 87 3366 0.02% 88 4059 0.02% 89 5557 0.03% 90 6658 0.04% 91 6488 0.03% 92 6610 0.04% 93 7132 0.04% 94 8085 0.04% 95 8851 0.05% 96 9500 0.05% 97 9645 0.05% 98 10387 0.06% 99 12237 0.06% 100 13915 0.07% 101 14376 0.08% 102 15139 0.08% 103 17185 0.09% 104 19215 0.10% 105 19641 0.10% 106 20891 0.11% 107 21033 0.11% 108 21663 0.11% 109 23623 0.13% 110 26131 0.14% 111 27669 0.15% 112 30541 0.16% 113 33665 0.18% 114 36998 0.20% 115 39614 0.21% 116 40639 0.22% 117 40843 0.22% 118 41333 0.22% 119 42910 0.23% 120 44500 0.24% 121 47948 0.25% 122 52677 0.28% 123 56764 0.30% 124 60809 0.32% 125 64205 0.34% 126 65997 0.35% 127 65970 0.35% 128 66946 0.35% 129 66610 0.35% 130 69379 0.37% 131 71262 0.38% 132 74764 0.40% 133 80642 0.43% 134 84158 0.45% 135 87097 0.46% 136 88550 0.47% 137 88887 0.47% 138 87921 0.47% 139 87424 0.46% 140 88446 0.47% 141 89159 0.47% 142 93275 0.49% 143 96706 0.51% 144 98253 0.52% 145 101770 0.54% 146 100819 0.53% 147 103554 0.55% 148 106462 0.56% 149 102795 0.54% 150 103661 0.55% 151 15697630 83.17% 18875193 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=9 prefix-density=0.60 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.71 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=9 prefix-density=0.58 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=18.26 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458898 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:49:23 Started mapping on | Dec 07 18:49:23 Finished on | Dec 07 18:52:33 Mapping speed, Million of reads per hour | 357.64 Number of input reads | 18875193 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16680798 Uniquely mapped reads % | 88.37% Average mapped length | 290.75 Number of splices: Total | 16272119 Number of splices: Annotated (sjdb) | 15394052 Number of splices: GT/AG | 16056650 Number of splices: GC/AG | 182151 Number of splices: AT/AC | 5957 Number of splices: Non-canonical | 27361 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357075 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 48539 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.20% % of reads unmapped: other | 3.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1837709 1837709 1837709 N_multimapping 357075 357075 357075 N_noFeature 516038 8337609 8558625 N_ambiguous 371536 38117 36796 UnstrandedReadsAssigned:15793224 PositiveStrandReadsAssigned:8305072 NegativeStrandReadsAssigned:8085377 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458898-trimmed-pair1.fastq SRR14458898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,875,193 reads, 17,038,135 reads pseudoaligned [quant] estimated average fragment length: 224.036 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR14458898.ke.tsv 35125 SRR14458898.se.tsv 88098 total ==> SRR14458898.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.146 0 0 PNS24247 1044 820.964 14.8616 1.39255 PNS24249 1928 1704.96 113.644 5.12744 PNS24246 1044 820.964 14.8616 1.39255 PNS24248 1044 820.964 14.8616 1.39255 PNS24244 1471 1247.96 45.7714 2.82138 PNS24243 293 104.406 2 1.47359 KQK14069 1603 1379.96 4249.44 236.883 KQK14071 474 257.317 260.338 77.8288 ==> SRR14458898.se.tsv <== BRADI_1g14170v3 5192 BRADI_1g53295v3 45 BRADI_1g59795v3 231 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 2040 BRADI_1g74790v3 716 BRADI_1g09890v3 5 BRADI_1g77505v3 370 BRADI_1g48960v3 0 SRR14458898 completed mapping pipeline successfully