Starting /dee2/code/volunteer_pipeline.sh SRR14458899 current disk space = 1540323975168 free memory = 1602369900 SRR14458899 SRAfilesize c6546826f26b7ee8af7b16678da6e8ce SRR14458899.sra SRR14458899.sra file validated SRR14458899 is paired end SRR14458899 is conventional basespace SRR14458899 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.127 32.0 32.0 32.0 32.0 32.0 2 31.17175 32.0 32.0 32.0 32.0 32.0 3 31.24875 32.0 32.0 32.0 32.0 32.0 4 31.3895 32.0 32.0 32.0 32.0 32.0 5 31.3335 32.0 32.0 32.0 32.0 32.0 6 34.22675 36.0 36.0 36.0 32.0 36.0 7 34.599 36.0 36.0 36.0 32.0 36.0 8 34.45825 36.0 36.0 36.0 32.0 36.0 9 34.573 36.0 36.0 36.0 32.0 36.0 10-14 34.54735 36.0 36.0 36.0 32.0 36.0 15-19 34.54985 36.0 36.0 36.0 32.0 36.0 20-24 34.43575 36.0 36.0 36.0 32.0 36.0 25-29 34.189949999999996 36.0 36.0 36.0 32.0 36.0 30-34 34.1298 36.0 36.0 36.0 32.0 36.0 35-39 34.11425 36.0 36.0 36.0 32.0 36.0 40-44 33.984449999999995 36.0 36.0 36.0 32.0 36.0 45-49 33.800149999999995 36.0 36.0 36.0 32.0 36.0 50-54 33.82465 36.0 36.0 36.0 30.0 36.0 55-59 33.5714 36.0 36.0 36.0 27.0 36.0 60-64 33.4884 36.0 36.0 36.0 27.0 36.0 65-69 33.27845000000001 36.0 36.0 36.0 22.2 36.0 70-74 33.08635 36.0 32.8 36.0 23.4 36.0 75-79 32.9503 36.0 32.0 36.0 22.2 36.0 80-84 32.8703 36.0 32.0 36.0 22.2 36.0 85-89 32.840700000000005 36.0 32.0 36.0 21.0 36.0 90-94 32.879599999999996 36.0 32.0 36.0 20.8 36.0 95-99 32.66855 36.0 32.0 36.0 18.2 36.0 100-104 32.6226 36.0 32.0 36.0 16.8 36.0 105-109 32.5239 36.0 32.0 36.0 14.0 36.0 110-114 32.482749999999996 36.0 32.0 36.0 14.0 36.0 115-119 32.36409999999999 36.0 32.0 36.0 14.0 36.0 120-124 32.19895 36.0 32.0 36.0 14.0 36.0 125-129 32.0419 36.0 32.0 36.0 14.0 36.0 130-134 32.0137 36.0 32.0 36.0 14.0 36.0 135-139 31.80725 36.0 32.0 36.0 14.0 36.0 140-144 31.198150000000005 36.0 29.0 36.0 14.0 36.0 145-149 30.8858 36.0 27.0 36.0 14.0 36.0 150-151 28.697625000000002 31.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 3.0 20 5.0 21 3.0 22 7.0 23 19.0 24 20.0 25 44.0 26 80.0 27 96.0 28 132.0 29 157.0 30 219.0 31 270.0 32 420.0 33 568.0 34 925.0 35 1029.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.624999999999996 11.799999999999999 11.25 51.324999999999996 2 20.724999999999998 17.075000000000003 32.15 30.049999999999997 3 21.925 19.875 24.4 33.800000000000004 4 28.325 22.975 17.7 31.0 5 28.299999999999997 28.325 18.85 24.525 6 25.14414640260717 31.66207069440963 19.027325144146403 24.166457758836803 7 23.3 18.9 34.1 23.7 8 23.1 21.425 25.7 29.775000000000002 9 22.15 20.525 28.475 28.849999999999998 10-14 25.335 24.875 23.055 26.735 15-19 25.89 23.48 23.615 27.015 20-24 26.4113205660283 23.13615680784039 23.131156557827893 27.321366068303416 25-29 25.90777233169951 23.737121136340903 23.281984595378614 27.073121936580975 30-34 26.464555505528043 23.127720246135375 23.237780779428686 27.1699434689079 35-39 26.26126126126126 23.64864864864865 23.053053053053052 27.037037037037038 40-44 26.417551592867163 23.342015628130635 22.956321378481267 27.28411140052094 45-49 26.18701428929556 23.39934820757082 22.617197292554525 27.796440210579092 50-54 26.269912834385334 23.2090972848412 22.437631499849715 28.083358380923755 55-59 26.471621418176344 23.219752095147285 23.58608922567371 26.72253726100266 60-64 26.47383196310407 22.859434529777424 22.859434529777424 27.807298977341087 65-69 26.496885674100863 23.10628892907374 22.49849306811332 27.898332328712076 70-74 26.768537074148295 22.930861723446895 23.206412825651302 27.094188376753507 75-79 26.762539459838653 22.59858696196823 22.964373402816054 27.67450017537706 80-84 26.782138566279535 22.922507008410093 22.867440929114938 27.427913496195433 85-89 26.943860702491744 22.795957170019012 22.916041228860202 27.34414089862904 90-94 26.713356678339167 22.991495747873934 22.696348174087046 27.598799399699853 95-99 27.30228602871292 22.90030513731179 22.725226351858336 27.07218248211695 100-104 26.91345672836418 23.491745872936466 22.926463231615806 26.66833416708354 105-109 26.56195287879546 22.95032764744135 22.90030513731179 27.587414336451406 110-114 27.490119565761166 22.84256340987543 22.667467106908802 26.9998499174546 115-119 27.25862931465733 22.826413206603302 22.536268134067033 27.378689344672335 120-124 27.55377688844422 23.52176088044022 22.216108054027014 26.708354177088545 125-129 27.497373818218197 23.11540193086889 22.490120554249412 26.8971036966635 130-134 28.568570571171353 22.876863058917678 21.871561468440532 26.68300490147044 135-139 27.408222466740025 23.757127138141442 21.85155546663999 26.983094928478547 140-144 27.68553710742148 24.10482096419284 21.484296859371874 26.7253450690138 145-149 27.634145121768267 24.083612541881283 21.563234485172774 26.71900785117768 150-151 27.8625 24.375 20.6625 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 1.0 26 1.0 27 1.0 28 1.5 29 5.0 30 6.0 31 5.5 32 8.0 33 9.5 34 16.0 35 27.5 36 32.5 37 40.0 38 53.0 39 67.5 40 74.0 41 89.5 42 112.5 43 120.0 44 125.0 45 144.5 46 149.5 47 141.5 48 156.0 49 145.5 50 122.0 51 123.5 52 122.5 53 114.0 54 105.5 55 109.0 56 115.0 57 117.5 58 117.0 59 102.5 60 99.0 61 103.0 62 102.0 63 98.0 64 97.0 65 96.0 66 93.0 67 90.5 68 75.5 69 68.5 70 71.5 71 60.5 72 47.5 73 46.0 74 43.5 75 37.0 76 27.5 77 17.0 78 12.5 79 7.0 80 5.0 81 5.0 82 4.0 83 3.5 84 1.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.03 30-34 0.055 35-39 0.1 40-44 0.18 45-49 0.27499999999999997 50-54 0.19 55-59 0.365 60-64 0.26 65-69 0.45999999999999996 70-74 0.2 75-79 0.215 80-84 0.12 85-89 0.06999999999999999 90-94 0.05 95-99 0.045 100-104 0.05 105-109 0.045 110-114 0.055 115-119 0.05 120-124 0.05 125-129 0.045 130-134 0.03 135-139 0.03 140-144 0.02 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.6043817678166709 1.2 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.225 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.2375 0.0 0.0 0.0 0.0 134-135 6.825 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 8.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 60 0.004633351 14.4325 140-144 AGATCGG 65 0.007877022 13.322308 140-144 >>END_MODULE SRR14458899 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.007 32.0 32.0 32.0 32.0 32.0 2 30.78425 32.0 32.0 32.0 32.0 32.0 3 30.75825 32.0 32.0 32.0 32.0 32.0 4 30.74025 32.0 32.0 32.0 32.0 32.0 5 30.78575 32.0 32.0 32.0 32.0 32.0 6 34.0875 36.0 36.0 36.0 32.0 36.0 7 34.144 36.0 36.0 36.0 32.0 36.0 8 34.14825 36.0 36.0 36.0 32.0 36.0 9 33.913 36.0 36.0 36.0 32.0 36.0 10-14 33.98075 36.0 36.0 36.0 32.0 36.0 15-19 33.9222 36.0 36.0 36.0 32.0 36.0 20-24 33.915749999999996 36.0 36.0 36.0 32.0 36.0 25-29 33.7798 36.0 36.0 36.0 29.0 36.0 30-34 33.684250000000006 36.0 36.0 36.0 29.0 36.0 35-39 33.59735 36.0 36.0 36.0 28.0 36.0 40-44 33.6225 36.0 36.0 36.0 30.0 36.0 45-49 33.48485 36.0 36.0 36.0 24.6 36.0 50-54 33.25255 36.0 36.0 36.0 20.8 36.0 55-59 33.09065 36.0 36.0 36.0 19.6 36.0 60-64 32.848200000000006 36.0 36.0 36.0 14.0 36.0 65-69 32.63315 36.0 32.8 36.0 15.4 36.0 70-74 32.228750000000005 36.0 32.8 36.0 14.0 36.0 75-79 32.06955000000001 36.0 32.0 36.0 14.0 36.0 80-84 31.843149999999998 36.0 32.0 36.0 14.0 36.0 85-89 31.85215 36.0 32.0 36.0 14.0 36.0 90-94 31.479149999999997 36.0 32.0 36.0 14.0 36.0 95-99 31.5371 36.0 32.0 36.0 14.0 36.0 100-104 31.567699999999995 36.0 32.0 36.0 14.0 36.0 105-109 31.390750000000004 36.0 32.0 36.0 14.0 36.0 110-114 31.2452 36.0 32.0 36.0 14.0 36.0 115-119 30.930500000000002 36.0 31.0 36.0 14.0 36.0 120-124 30.881849999999996 36.0 32.0 36.0 14.0 36.0 125-129 30.475299999999997 35.2 29.0 36.0 14.0 36.0 130-134 29.904649999999997 34.4 27.0 36.0 14.0 36.0 135-139 29.20075 32.0 27.0 36.0 14.0 36.0 140-144 29.2404 32.0 27.0 36.0 14.0 36.0 145-149 29.413550000000004 32.0 27.0 36.0 14.0 36.0 150-151 26.555500000000002 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 2.0 9 4.0 10 4.0 11 6.0 12 16.0 13 5.0 14 5.0 15 11.0 16 7.0 17 14.0 18 10.0 19 8.0 20 8.0 21 14.0 22 30.0 23 34.0 24 50.0 25 67.0 26 85.0 27 110.0 28 174.0 29 207.0 30 226.0 31 311.0 32 422.0 33 554.0 34 911.0 35 703.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.706176544136035 11.42785696424106 10.302575643910977 53.56339084771192 2 23.25 16.625 32.95 27.175 3 23.175 18.7 22.75 35.375 4 27.35 22.5 19.025 31.125000000000004 5 29.625 26.775 20.05 23.549999999999997 6 26.950000000000003 31.125000000000004 18.925 23.0 7 23.150000000000002 19.6 33.675 23.575 8 23.674999999999997 21.349999999999998 25.85 29.125 9 23.575 19.875 29.575000000000003 26.974999999999998 10-14 25.19 25.0 22.225 27.584999999999997 15-19 26.47 23.59 22.25 27.689999999999998 20-24 25.45 23.855 23.015 27.68 25-29 26.4252850570114 23.554710942188436 22.494498899779956 27.525505101020205 30-34 26.129823332165557 23.397227365997697 22.93178519593614 27.541164105900606 35-39 25.804672616063375 23.939637019953874 22.997092148801766 27.25859821518099 40-44 26.15315270195823 23.02298793008464 22.907797866479694 27.91606150147744 45-49 26.932154873700597 22.75900165720886 22.64349922161402 27.665344247476526 50-54 26.195153896529145 23.731801924336303 22.60843282454284 27.464611354591707 55-59 26.36825940284981 23.53859322289915 22.541664568752832 27.55148280549821 60-64 26.390992628496413 22.86680803796829 22.765828536807028 27.97637079672826 65-69 26.763412044293876 23.451484047125447 22.56661778833999 27.21848612024068 70-74 26.34919023201503 23.54165608975986 22.800426460882367 27.308727217342742 75-79 26.497074535741543 23.261256677690156 22.762655812770287 27.479012973798017 80-84 27.0617636558372 23.3590044371908 22.644973733870557 26.934258173101444 85-89 26.578343949044587 22.894267515923566 23.480254777070066 27.047133757961785 90-94 26.32331172477158 23.16369761625236 22.842121382267365 27.670869276708693 95-99 27.094601489947955 23.140116338401878 22.430860291866516 27.334421879783648 100-104 26.96921741793864 23.028230129154117 22.68620143958344 27.316351013323803 105-109 26.789814767566465 23.942440169413686 22.386079501964588 26.88166556105526 110-114 27.498467198038014 23.43654199877376 22.49131412221541 26.57367668097282 115-119 27.363464196140658 23.70886011158315 22.41388135332958 26.513794338946617 120-124 27.625102543068085 22.949138638228057 22.43129614438064 26.994462674323216 125-129 27.880468268638325 23.069418771821727 22.253029369480387 26.79708359005956 130-134 28.338210380409674 24.092612557112787 21.56681554494584 26.002361517531703 135-139 28.829754443645328 23.738826672146306 21.899722593239495 25.53169629096887 140-144 28.656410256410258 23.851282051282052 22.015384615384615 25.476923076923075 145-149 29.39637930150264 23.488384019693317 22.442176521872916 24.673060156931125 150-151 28.74743326488706 25.166837782340863 21.43223819301848 24.653490759753595 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 2.5 24 3.5 25 4.0 26 4.0 27 5.5 28 4.5 29 3.5 30 6.5 31 7.5 32 12.5 33 17.5 34 21.5 35 29.5 36 32.5 37 41.0 38 53.5 39 66.0 40 80.0 41 101.0 42 119.0 43 130.0 44 137.5 45 123.5 46 119.5 47 133.0 48 144.0 49 143.5 50 134.0 51 127.0 52 118.0 53 120.5 54 121.5 55 105.0 56 96.0 57 99.5 58 107.5 59 105.0 60 107.0 61 105.0 62 92.5 63 98.0 64 86.5 65 72.0 66 79.0 67 80.0 68 76.0 69 74.5 70 76.0 71 64.5 72 62.0 73 60.5 74 44.0 75 39.5 76 30.0 77 20.5 78 13.0 79 6.5 80 4.5 81 3.5 82 3.0 83 0.5 84 0.5 85 2.0 86 1.5 87 0.0 88 1.0 89 1.0 90 1.0 91 1.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.095 35-39 0.27 40-44 0.165 45-49 0.43499999999999994 50-54 0.745 55-59 0.695 60-64 0.97 65-69 1.115 70-74 1.5150000000000001 75-79 1.725 80-84 1.965 85-89 1.875 90-94 2.045 95-99 2.01 100-104 2.0549999999999997 105-109 2.015 110-114 2.1399999999999997 115-119 2.315 120-124 2.48 125-129 2.62 130-134 2.605 135-139 2.67 140-144 2.5 145-149 2.505 150-151 2.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.925 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.175000000000001 0.0 0.0 0.0 0.0 138-139 8.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGCTC 10 0.0072238143 142.3125 1 GATCGGA 65 0.0069354866 13.577818 140-144 ATCGGAA 65 0.0069354866 13.577818 140-144 >>END_MODULE Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082405 spots for SRR14458899.sra Written 1082405 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra Read 1082400 spots for SRR14458899.sra Written 1082400 spots for SRR14458899.sra SRR ids: ['SRR14458899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kn9oew0h SRR14458899.sra spots: 21648005 blocks: [[1, 1082400], [1082401, 2164800], [2164801, 3247200], [3247201, 4329600], [4329601, 5412000], [5412001, 6494400], [6494401, 7576800], [7576801, 8659200], [8659201, 9741600], [9741601, 10824000], [10824001, 11906400], [11906401, 12988800], [12988801, 14071200], [14071201, 15153600], [15153601, 16236000], [16236001, 17318400], [17318401, 18400800], [18400801, 19483200], [19483201, 20565600], [20565601, 21648005]] SRR14458899 file size 7335238 SRR14458899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458899 SRR14458899_1.fastq SRR14458899_2.fastq Input file: SRR14458899_1.fastq Paired file: SRR14458899_2.fastq trimmed: SRR14458899-trimmed-pair1.fastq, SRR14458899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:52:13 2024 >> started Sat Dec 7 18:52:38 2024 >> done (25.169s) 21648005 read pairs processed; of these: 4613 ( 0.02%) short read pairs filtered out after trimming by size control 3778 ( 0.02%) empty read pairs filtered out after trimming by size control 21639614 (99.96%) read pairs available; of these: 3344335 (15.45%) trimmed read pairs available after processing 18295279 (84.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 220 0.00% 19 183 0.00% 20 205 0.00% 21 207 0.00% 22 204 0.00% 23 207 0.00% 24 227 0.00% 25 139 0.00% 26 170 0.00% 27 147 0.00% 28 171 0.00% 29 209 0.00% 30 178 0.00% 31 152 0.00% 32 162 0.00% 33 122 0.00% 34 221 0.00% 35 158 0.00% 36 139 0.00% 37 133 0.00% 38 153 0.00% 39 165 0.00% 40 163 0.00% 41 146 0.00% 42 158 0.00% 43 180 0.00% 44 151 0.00% 45 160 0.00% 46 141 0.00% 47 180 0.00% 48 181 0.00% 49 179 0.00% 50 184 0.00% 51 182 0.00% 52 183 0.00% 53 225 0.00% 54 192 0.00% 55 213 0.00% 56 193 0.00% 57 240 0.00% 58 253 0.00% 59 253 0.00% 60 294 0.00% 61 338 0.00% 62 301 0.00% 63 330 0.00% 64 328 0.00% 65 340 0.00% 66 390 0.00% 67 427 0.00% 68 418 0.00% 69 451 0.00% 70 503 0.00% 71 605 0.00% 72 636 0.00% 73 687 0.00% 74 756 0.00% 75 714 0.00% 76 817 0.00% 77 911 0.00% 78 966 0.00% 79 1127 0.01% 80 1263 0.01% 81 1458 0.01% 82 1740 0.01% 83 2020 0.01% 84 2227 0.01% 85 2389 0.01% 86 2489 0.01% 87 2887 0.01% 88 3784 0.02% 89 5480 0.03% 90 6469 0.03% 91 6143 0.03% 92 5787 0.03% 93 6390 0.03% 94 7220 0.03% 95 8348 0.04% 96 8906 0.04% 97 8775 0.04% 98 9670 0.04% 99 11662 0.05% 100 13137 0.06% 101 13572 0.06% 102 14083 0.07% 103 16642 0.08% 104 18188 0.08% 105 18776 0.09% 106 19913 0.09% 107 20717 0.10% 108 21038 0.10% 109 23252 0.11% 110 26090 0.12% 111 27339 0.13% 112 30710 0.14% 113 34060 0.16% 114 38030 0.18% 115 40644 0.19% 116 41152 0.19% 117 41756 0.19% 118 42501 0.20% 119 44066 0.20% 120 46361 0.21% 121 49896 0.23% 122 54738 0.25% 123 59515 0.28% 124 63642 0.29% 125 67725 0.31% 126 69151 0.32% 127 69828 0.32% 128 70568 0.33% 129 71288 0.33% 130 73780 0.34% 131 75919 0.35% 132 79713 0.37% 133 86006 0.40% 134 90854 0.42% 135 93981 0.43% 136 95008 0.44% 137 94757 0.44% 138 94544 0.44% 139 94609 0.44% 140 95009 0.44% 141 95621 0.44% 142 100648 0.47% 143 103893 0.48% 144 106636 0.49% 145 110512 0.51% 146 109812 0.51% 147 111298 0.51% 148 114749 0.53% 149 110843 0.51% 150 113690 0.53% 151 18295279 84.55% 21639614 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=8 prefix-density=0.55 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=43.39 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.6 sequence=TGCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=7 prefix-density=0.56 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.89 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458899 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:53:58 Started mapping on | Dec 07 18:53:58 Finished on | Dec 07 18:56:55 Mapping speed, Million of reads per hour | 440.13 Number of input reads | 21639614 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17387608 Uniquely mapped reads % | 80.35% Average mapped length | 288.79 Number of splices: Total | 17415925 Number of splices: Annotated (sjdb) | 16486526 Number of splices: GT/AG | 17182614 Number of splices: GC/AG | 194761 Number of splices: AT/AC | 6758 Number of splices: Non-canonical | 31792 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312282 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 55612 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.82% % of reads unmapped: other | 2.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3942796 3942796 3942796 N_multimapping 312282 312282 312282 N_noFeature 502474 8718649 8861517 N_ambiguous 436715 66339 65031 UnstrandedReadsAssigned:16448419 PositiveStrandReadsAssigned:8602620 NegativeStrandReadsAssigned:8461060 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458899-trimmed-pair1.fastq SRR14458899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,639,614 reads, 19,776,965 reads pseudoaligned [quant] estimated average fragment length: 233.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52973 SRR14458899.ke.tsv 35125 SRR14458899.se.tsv 88098 total ==> SRR14458899.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.678 0 0 PNS24247 1044 811.401 18.8167 1.52359 PNS24249 1928 1695.4 147.427 5.71303 PNS24246 1044 811.401 18.8167 1.52359 PNS24248 1044 811.401 18.8167 1.52359 PNS24244 1471 1238.4 33.1227 1.75722 PNS24243 293 105.893 4 2.48174 KQK14069 1603 1370.4 6330.02 303.472 KQK14071 474 253.965 199.296 51.5567 ==> SRR14458899.se.tsv <== BRADI_1g14170v3 6197 BRADI_1g53295v3 38 BRADI_1g59795v3 253 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 2444 BRADI_1g74790v3 634 BRADI_1g09890v3 10 BRADI_1g77505v3 409 BRADI_1g48960v3 0 SRR14458899 completed mapping pipeline successfully