Starting /dee2/code/volunteer_pipeline.sh SRR14458900 current disk space = 1540421955584 free memory = 1596019676 SRR14458900 SRAfilesize 37b9306fcf595f5c35d50843d779e090 SRR14458900.sra SRR14458900.sra file validated SRR14458900 is paired end SRR14458900 is conventional basespace SRR14458900 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0575 32.0 32.0 32.0 32.0 32.0 2 31.236 32.0 32.0 32.0 32.0 32.0 3 31.292 32.0 32.0 32.0 32.0 32.0 4 31.3725 32.0 32.0 32.0 32.0 32.0 5 31.3065 32.0 32.0 32.0 32.0 32.0 6 34.3225 36.0 36.0 36.0 32.0 36.0 7 34.63675 36.0 36.0 36.0 32.0 36.0 8 34.442 36.0 36.0 36.0 32.0 36.0 9 34.4445 36.0 36.0 36.0 32.0 36.0 10-14 34.5471 36.0 36.0 36.0 32.0 36.0 15-19 34.50725 36.0 36.0 36.0 32.0 36.0 20-24 34.52795 36.0 36.0 36.0 32.0 36.0 25-29 34.25605 36.0 36.0 36.0 32.0 36.0 30-34 34.12775 36.0 36.0 36.0 32.0 36.0 35-39 34.10125 36.0 36.0 36.0 32.0 36.0 40-44 33.9816 36.0 36.0 36.0 32.0 36.0 45-49 33.86855 36.0 36.0 36.0 32.0 36.0 50-54 33.7611 36.0 36.0 36.0 30.0 36.0 55-59 33.51845 36.0 36.0 36.0 26.8 36.0 60-64 33.29165 36.0 36.0 36.0 22.2 36.0 65-69 33.2659 36.0 36.0 36.0 21.0 36.0 70-74 33.1064 36.0 32.8 36.0 22.2 36.0 75-79 32.8449 36.0 32.0 36.0 21.0 36.0 80-84 32.94795 36.0 32.0 36.0 21.0 36.0 85-89 32.811 36.0 32.0 36.0 19.6 36.0 90-94 32.85915 36.0 32.0 36.0 19.4 36.0 95-99 32.642399999999995 36.0 32.0 36.0 15.4 36.0 100-104 32.617200000000004 36.0 32.0 36.0 16.8 36.0 105-109 32.507600000000004 36.0 32.0 36.0 14.0 36.0 110-114 32.489200000000004 36.0 32.0 36.0 14.0 36.0 115-119 32.37425 36.0 32.0 36.0 15.4 36.0 120-124 32.1969 36.0 32.0 36.0 14.0 36.0 125-129 31.91455 36.0 32.0 36.0 14.0 36.0 130-134 31.94335 36.0 32.0 36.0 14.0 36.0 135-139 31.755200000000002 36.0 32.0 36.0 14.0 36.0 140-144 31.18555 36.0 29.0 36.0 14.0 36.0 145-149 30.806050000000006 36.0 27.0 36.0 14.0 36.0 150-151 28.6635 31.5 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 6.0 21 5.0 22 12.0 23 21.0 24 33.0 25 48.0 26 70.0 27 94.0 28 121.0 29 182.0 30 201.0 31 270.0 32 396.0 33 592.0 34 921.0 35 1024.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.025 13.325000000000001 10.35 52.300000000000004 2 21.4 17.675 33.375 27.55 3 21.7 19.125 24.725 34.449999999999996 4 26.724999999999998 22.95 18.35 31.974999999999998 5 27.925 27.700000000000003 19.8 24.575 6 25.36413862380713 32.09442491210447 19.613259668508288 22.92817679558011 7 23.575 17.549999999999997 34.4 24.474999999999998 8 22.05 22.1 26.325 29.525000000000002 9 23.875 19.650000000000002 29.125 27.35 10-14 25.115 25.474999999999998 22.88 26.529999999999998 15-19 25.34 23.285 23.22 28.155 20-24 25.995 23.98 22.68 27.345000000000002 25-29 26.100220044008804 23.66973394678936 22.974594918983797 27.255451090218042 30-34 25.949272099654806 23.663014658061936 23.057681724948722 27.330031517334536 35-39 25.678246070677744 23.410751827009708 23.395735308839726 27.51526679347282 40-44 26.921535223970338 22.78785449443832 22.948191201523198 27.342419080068144 45-49 26.69408637207203 23.21312133219642 22.68144655665346 27.411345739078097 50-54 26.502280358843283 23.199518869342956 23.014083095273893 27.28411767653987 55-59 26.442669880970314 22.776354778765505 22.846667671136558 27.934307669127616 60-64 26.6258530710558 22.852268165395422 23.16338819751104 27.358490566037734 65-69 26.75149625308052 23.00457677412865 23.14540059347181 27.098526379319015 70-74 26.97879592962053 23.424733069326784 22.45726602837235 27.139204972680336 75-79 26.44375375977542 22.59374373370764 23.64146781632244 27.321034690194505 80-84 27.359198998748436 23.073842302878596 22.39799749687109 27.16896120150188 85-89 27.071657325860688 23.123498799039233 22.81825460368295 26.986589271417134 90-94 26.827072182482116 22.74523535591016 22.71021959881947 27.717472862788256 95-99 27.467360312140464 22.94532539642839 22.440098044119853 27.14721624731129 100-104 27.473736868434216 22.12606303151576 22.991495747873934 27.408704352176088 105-109 26.882096943624635 23.000350157570907 22.49512280526237 27.622430093542093 110-114 27.55877938969485 23.16658329164582 21.93096548274137 27.34367183591796 115-119 27.178589294647328 23.23661830915458 22.301150575287643 27.283641820910454 120-124 27.489621367478616 22.532886510278598 22.257790226579303 27.719701895663484 125-129 28.072632684708122 23.360512230503726 21.62973338002101 26.937121704767147 130-134 28.233470041012303 22.94188256476943 22.016604981494446 26.808042412723815 135-139 27.47686921730433 23.86096524131033 21.845461365341336 26.81670417604401 140-144 28.127812781278127 23.89238923892389 21.152115211521153 26.82768276827683 145-149 27.96279627962796 23.78237823782378 21.407140714071407 26.84768476847685 150-151 27.525 24.6625 20.6875 27.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.0 27 0.0 28 1.0 29 2.5 30 4.0 31 7.5 32 10.5 33 13.5 34 18.5 35 21.0 36 30.0 37 38.0 38 42.0 39 59.5 40 84.5 41 104.0 42 121.5 43 138.0 44 137.5 45 137.5 46 151.5 47 159.5 48 158.0 49 139.5 50 122.5 51 116.5 52 113.5 53 109.5 54 104.5 55 101.5 56 101.5 57 110.5 58 117.5 59 120.5 60 110.5 61 106.0 62 107.0 63 94.0 64 84.0 65 73.5 66 63.0 67 76.0 68 82.0 69 76.0 70 73.0 71 62.0 72 59.0 73 53.0 74 42.5 75 37.5 76 28.5 77 18.5 78 14.5 79 11.5 80 8.5 81 6.5 82 4.5 83 3.0 84 2.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.44999999999999996 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.055 35-39 0.11 40-44 0.21 45-49 0.315 50-54 0.23500000000000001 55-59 0.445 60-64 0.36 65-69 0.585 70-74 0.255 75-79 0.26 80-84 0.125 85-89 0.08 90-94 0.045 95-99 0.045 100-104 0.05 105-109 0.045 110-114 0.05 115-119 0.05 120-124 0.034999999999999996 125-129 0.045 130-134 0.03 135-139 0.025 140-144 0.01 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06376518218623 97.875 2 0.7591093117408907 1.5 3 0.10121457489878542 0.3 4 0.05060728744939271 0.2 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.6625 0.0 0.0 0.0 0.0 128-129 5.3 0.0 0.0 0.0 0.0 130-131 5.85 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.862500000000001 0.0 0.0 0.0 0.0 138-139 8.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCCTG 10 0.006830828 145.0 2 GATCGGA 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR14458900 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.96 32.0 32.0 32.0 32.0 32.0 2 30.5925 32.0 32.0 32.0 32.0 32.0 3 30.6745 32.0 32.0 32.0 32.0 32.0 4 30.72025 32.0 32.0 32.0 32.0 32.0 5 30.63175 32.0 32.0 32.0 32.0 32.0 6 33.98275 36.0 36.0 36.0 32.0 36.0 7 34.12325 36.0 36.0 36.0 32.0 36.0 8 33.96225 36.0 36.0 36.0 32.0 36.0 9 34.00625 36.0 36.0 36.0 32.0 36.0 10-14 33.9665 36.0 36.0 36.0 32.0 36.0 15-19 33.8878 36.0 36.0 36.0 32.0 36.0 20-24 33.79845 36.0 36.0 36.0 29.0 36.0 25-29 33.76515 36.0 36.0 36.0 32.0 36.0 30-34 33.637899999999995 36.0 36.0 36.0 27.0 36.0 35-39 33.47645 36.0 36.0 36.0 24.6 36.0 40-44 33.49355 36.0 36.0 36.0 25.8 36.0 45-49 33.40905 36.0 36.0 36.0 23.4 36.0 50-54 33.1096 36.0 36.0 36.0 18.2 36.0 55-59 33.07505 36.0 36.0 36.0 18.2 36.0 60-64 32.803450000000005 36.0 36.0 36.0 14.0 36.0 65-69 32.423 36.0 32.0 36.0 14.0 36.0 70-74 31.90855 36.0 32.0 36.0 14.0 36.0 75-79 31.80865 36.0 32.0 36.0 14.0 36.0 80-84 31.603550000000002 36.0 32.0 36.0 14.0 36.0 85-89 31.697749999999996 36.0 32.0 36.0 14.0 36.0 90-94 31.267000000000003 36.0 32.0 36.0 14.0 36.0 95-99 31.2589 36.0 32.0 36.0 14.0 36.0 100-104 31.2999 36.0 32.0 36.0 14.0 36.0 105-109 31.186149999999998 36.0 32.0 36.0 14.0 36.0 110-114 30.956399999999995 36.0 31.0 36.0 14.0 36.0 115-119 30.5757 36.0 27.0 36.0 14.0 36.0 120-124 30.5385 36.0 30.0 36.0 14.0 36.0 125-129 30.17985 35.2 27.0 36.0 14.0 36.0 130-134 29.775550000000003 33.6 27.0 36.0 14.0 36.0 135-139 29.014050000000005 32.0 27.0 36.0 14.0 36.0 140-144 29.016200000000005 32.0 27.0 36.0 14.0 36.0 145-149 28.9849 32.0 27.0 36.0 14.0 36.0 150-151 26.209625 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 4.0 9 1.0 10 10.0 11 12.0 12 8.0 13 4.0 14 9.0 15 13.0 16 7.0 17 21.0 18 12.0 19 7.0 20 11.0 21 17.0 22 25.0 23 28.0 24 67.0 25 72.0 26 102.0 27 122.0 28 145.0 29 231.0 30 229.0 31 301.0 32 456.0 33 565.0 34 836.0 35 683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.825 12.1 10.125 52.949999999999996 2 22.35 17.025000000000002 32.975 27.650000000000002 3 22.7 18.475 23.7 35.125 4 27.675 23.175 17.974999999999998 31.175000000000004 5 29.549999999999997 26.700000000000003 19.625 24.125 6 26.375 31.45 19.8 22.375 7 23.549999999999997 18.625 34.325 23.5 8 21.4 21.9 25.874999999999996 30.825000000000003 9 22.1 21.9 29.549999999999997 26.450000000000003 10-14 25.695 24.36 22.6 27.345000000000002 15-19 25.974999999999998 23.7 22.325 28.000000000000004 20-24 25.995 24.14 23.24 26.625 25-29 25.833875081262192 23.46852027804171 23.198479771965793 27.499124868730306 30-34 26.002302417538413 24.05525802092197 22.408528955403174 27.53391060613644 35-39 26.508079895613772 23.276121650105388 22.990063233965675 27.225735220315165 40-44 27.104208416833668 23.1312625250501 22.029058116232463 27.735470941883765 45-49 26.0428183737059 23.243542064529098 22.801286561463463 27.912353000301536 50-54 26.433651081858073 23.24103495233772 22.363443788772884 27.961870177031322 55-59 26.676744771982868 23.446712018140587 22.519526329050137 27.357016880826407 60-64 26.625214841775353 23.46072186836518 22.490142553836822 27.423920736022644 65-69 25.843208751139475 23.26040717107262 23.15405651777575 27.742327560012153 70-74 26.536113936927773 22.787385554425228 22.553407934893187 28.123092573753816 75-79 26.77161342910999 22.573742931377044 22.61449895562688 28.040144683886087 80-84 26.41133156064635 23.17447330742483 22.785845776232357 27.628349355696464 85-89 27.227242558840047 23.091846632970846 22.75488844641854 26.926022361770563 90-94 26.57923049336544 23.238895435216968 22.48578308314975 27.69609098826784 95-99 26.40814447229754 23.169795876605107 22.647976671612014 27.774082979485343 100-104 27.20384969796253 23.149380567216134 21.93611139551551 27.710658339305827 105-109 26.79411163361276 23.221222653854017 22.18360253526886 27.80106317726436 110-114 26.875096257508087 23.035063401611993 22.521690025155294 27.568150315724626 115-119 27.568290549925408 22.995010031380215 22.434281598847676 27.002417819846702 120-124 27.196868239414858 22.942206654991242 22.664056866179045 27.196868239414858 125-129 28.695921208683544 23.34347444954365 21.49744753261486 26.463156809157944 130-134 28.656116294654367 23.75380174235785 21.562967163255838 26.027114799731944 135-139 28.51467781045246 23.272971160295103 21.99349945828819 26.218851570964247 140-144 28.72455552692605 24.091728935841278 21.649059520742075 25.534656016490597 145-149 29.481496752912072 23.208947531182353 21.915266467374497 25.394289248531077 150-151 28.79061371841155 24.161939143888603 22.06034038164002 24.987106756059823 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 2.0 15 1.5 16 1.5 17 1.5 18 1.0 19 1.0 20 2.5 21 3.0 22 3.0 23 4.5 24 5.0 25 3.0 26 2.0 27 3.5 28 6.0 29 6.0 30 6.5 31 8.5 32 8.5 33 16.5 34 21.0 35 20.0 36 29.0 37 40.0 38 48.0 39 61.0 40 74.5 41 95.5 42 115.5 43 119.5 44 133.0 45 141.0 46 141.5 47 152.0 48 152.5 49 138.0 50 133.0 51 124.0 52 116.5 53 116.5 54 101.5 55 96.0 56 102.5 57 114.5 58 122.5 59 109.5 60 99.0 61 102.5 62 93.5 63 88.0 64 87.5 65 75.0 66 76.0 67 81.5 68 77.5 69 73.5 70 65.0 71 61.5 72 69.0 73 61.5 74 43.5 75 34.0 76 27.5 77 20.0 78 15.5 79 14.5 80 6.5 81 2.0 82 3.0 83 2.0 84 2.0 85 2.5 86 2.5 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.105 35-39 0.37 40-44 0.2 45-49 0.51 50-54 0.865 55-59 0.775 60-64 1.09 65-69 1.27 70-74 1.7000000000000002 75-79 1.855 80-84 2.22 85-89 2.0650000000000004 90-94 2.405 95-99 2.265 100-104 2.33 105-109 2.18 110-114 2.605 115-119 2.8049999999999997 120-124 2.93 125-129 3.0349999999999997 130-134 3.005 135-139 3.085 140-144 2.9749999999999996 145-149 2.9899999999999998 150-151 3.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31921331316188 98.475 2 0.6051437216338881 1.2 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 5.9875 0.0 0.0 0.0 0.0 134-135 6.637499999999999 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 8.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333747 spots for SRR14458900.sra Written 1333747 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra Read 1333736 spots for SRR14458900.sra Written 1333736 spots for SRR14458900.sra SRR ids: ['SRR14458900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7pzdl2tz SRR14458900.sra spots: 26674731 blocks: [[1, 1333736], [1333737, 2667472], [2667473, 4001208], [4001209, 5334944], [5334945, 6668680], [6668681, 8002416], [8002417, 9336152], [9336153, 10669888], [10669889, 12003624], [12003625, 13337360], [13337361, 14671096], [14671097, 16004832], [16004833, 17338568], [17338569, 18672304], [18672305, 20006040], [20006041, 21339776], [21339777, 22673512], [22673513, 24007248], [24007249, 25340984], [25340985, 26674731]] SRR14458900 file size 9043540 SRR14458900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458900 SRR14458900_1.fastq SRR14458900_2.fastq Input file: SRR14458900_1.fastq Paired file: SRR14458900_2.fastq trimmed: SRR14458900-trimmed-pair1.fastq, SRR14458900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:58:22 2024 >> started Sat Dec 7 18:58:53 2024 >> done (30.934s) 26674731 read pairs processed; of these: 4592 ( 0.02%) short read pairs filtered out after trimming by size control 4880 ( 0.02%) empty read pairs filtered out after trimming by size control 26665259 (99.96%) read pairs available; of these: 4199795 (15.75%) trimmed read pairs available after processing 22465464 (84.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 196 0.00% 19 215 0.00% 20 217 0.00% 21 185 0.00% 22 195 0.00% 23 180 0.00% 24 189 0.00% 25 133 0.00% 26 172 0.00% 27 175 0.00% 28 161 0.00% 29 175 0.00% 30 143 0.00% 31 160 0.00% 32 175 0.00% 33 133 0.00% 34 237 0.00% 35 136 0.00% 36 174 0.00% 37 132 0.00% 38 151 0.00% 39 159 0.00% 40 149 0.00% 41 172 0.00% 42 148 0.00% 43 165 0.00% 44 145 0.00% 45 148 0.00% 46 123 0.00% 47 165 0.00% 48 164 0.00% 49 184 0.00% 50 204 0.00% 51 196 0.00% 52 194 0.00% 53 223 0.00% 54 199 0.00% 55 212 0.00% 56 229 0.00% 57 258 0.00% 58 277 0.00% 59 297 0.00% 60 366 0.00% 61 316 0.00% 62 382 0.00% 63 355 0.00% 64 370 0.00% 65 470 0.00% 66 439 0.00% 67 460 0.00% 68 547 0.00% 69 597 0.00% 70 658 0.00% 71 804 0.00% 72 896 0.00% 73 939 0.00% 74 1046 0.00% 75 1138 0.00% 76 1121 0.00% 77 1280 0.00% 78 1407 0.01% 79 1656 0.01% 80 1900 0.01% 81 2158 0.01% 82 2621 0.01% 83 3013 0.01% 84 3266 0.01% 85 3576 0.01% 86 3751 0.01% 87 4157 0.02% 88 5500 0.02% 89 7505 0.03% 90 8978 0.03% 91 8446 0.03% 92 8502 0.03% 93 9186 0.03% 94 10377 0.04% 95 12009 0.05% 96 12761 0.05% 97 12921 0.05% 98 13854 0.05% 99 16506 0.06% 100 18605 0.07% 101 19654 0.07% 102 20336 0.08% 103 23445 0.09% 104 25838 0.10% 105 26699 0.10% 106 28342 0.11% 107 28962 0.11% 108 29274 0.11% 109 32111 0.12% 110 35676 0.13% 111 37331 0.14% 112 41878 0.16% 113 47058 0.18% 114 51423 0.19% 115 55006 0.21% 116 55599 0.21% 117 55881 0.21% 118 56256 0.21% 119 58220 0.22% 120 60919 0.23% 121 65011 0.24% 122 70847 0.27% 123 76841 0.29% 124 83244 0.31% 125 86353 0.32% 126 88825 0.33% 127 88253 0.33% 128 89355 0.34% 129 88838 0.33% 130 92367 0.35% 131 94586 0.35% 132 98716 0.37% 133 106847 0.40% 134 112531 0.42% 135 114581 0.43% 136 117271 0.44% 137 116211 0.44% 138 115187 0.43% 139 114873 0.43% 140 114144 0.43% 141 114504 0.43% 142 120453 0.45% 143 125127 0.47% 144 127906 0.48% 145 131557 0.49% 146 129570 0.49% 147 132138 0.50% 148 137305 0.51% 149 131326 0.49% 150 132636 0.50% 151 22465464 84.25% 26665259 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=8 prefix-density=0.62 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=32.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.3 sequence=TGCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=7 prefix-density=0.66 prefix-fanout=3.3 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=31.95 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.2 sequence=TGCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR14458900 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:59:44 Started mapping on | Dec 07 18:59:45 Finished on | Dec 07 19:04:22 Mapping speed, Million of reads per hour | 346.55 Number of input reads | 26665259 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 24273288 Uniquely mapped reads % | 91.03% Average mapped length | 291.36 Number of splices: Total | 24038560 Number of splices: Annotated (sjdb) | 22706960 Number of splices: GT/AG | 23711413 Number of splices: GC/AG | 278137 Number of splices: AT/AC | 8726 Number of splices: Non-canonical | 40284 Mismatch rate per base, % | 0.71% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383144 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 41775 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.70% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2009405 2009405 2009405 N_multimapping 383144 383144 383144 N_noFeature 675171 12137985 12364123 N_ambiguous 585424 74609 70343 UnstrandedReadsAssigned:23012693 PositiveStrandReadsAssigned:12060694 NegativeStrandReadsAssigned:11838822 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458900-trimmed-pair1.fastq SRR14458900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,665,259 reads, 24,613,569 reads pseudoaligned [quant] estimated average fragment length: 241.396 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,241 rounds 52973 SRR14458900.ke.tsv 35125 SRR14458900.se.tsv 88098 total ==> SRR14458900.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.975 0 0 PNS24247 1044 803.604 31.8879 2.06396 PNS24249 1928 1687.6 174.255 5.37073 PNS24246 1044 803.604 31.8879 2.06396 PNS24248 1044 803.604 31.8879 2.06396 PNS24244 1471 1230.6 64.0811 2.70851 PNS24243 293 102.518 6 3.04416 KQK14069 1603 1362.6 16613.1 634.16 KQK14071 474 247.577 415.866 87.3698 ==> SRR14458900.se.tsv <== BRADI_1g14170v3 17903 BRADI_1g53295v3 74 BRADI_1g59795v3 395 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1615 BRADI_1g74790v3 816 BRADI_1g09890v3 8 BRADI_1g77505v3 553 BRADI_1g48960v3 0 SRR14458900 completed mapping pipeline successfully