Starting /dee2/code/volunteer_pipeline.sh SRR14458901 current disk space = 1540414513152 free memory = 1475881416 SRR14458901 SRAfilesize 58a7c9aadb3b24ebd8002a3db4c8236d SRR14458901.sra SRR14458901.sra file validated SRR14458901 is paired end SRR14458901 is conventional basespace SRR14458901 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.10725 32.0 32.0 32.0 32.0 32.0 2 31.16375 32.0 32.0 32.0 32.0 32.0 3 31.203 32.0 32.0 32.0 32.0 32.0 4 31.33025 32.0 32.0 32.0 32.0 32.0 5 31.33675 32.0 32.0 32.0 32.0 32.0 6 34.2565 36.0 36.0 36.0 32.0 36.0 7 34.56775 36.0 36.0 36.0 32.0 36.0 8 34.36425 36.0 36.0 36.0 32.0 36.0 9 34.52625 36.0 36.0 36.0 32.0 36.0 10-14 34.43055 36.0 36.0 36.0 32.0 36.0 15-19 34.50019999999999 36.0 36.0 36.0 32.0 36.0 20-24 34.4572 36.0 36.0 36.0 32.0 36.0 25-29 34.158249999999995 36.0 36.0 36.0 32.0 36.0 30-34 33.97165 36.0 36.0 36.0 32.0 36.0 35-39 33.9273 36.0 36.0 36.0 32.0 36.0 40-44 33.861450000000005 36.0 36.0 36.0 32.0 36.0 45-49 33.7755 36.0 36.0 36.0 32.0 36.0 50-54 33.6204 36.0 36.0 36.0 26.6 36.0 55-59 33.419500000000006 36.0 36.0 36.0 24.6 36.0 60-64 33.2337 36.0 36.0 36.0 22.2 36.0 65-69 33.15305000000001 36.0 36.0 36.0 19.6 36.0 70-74 32.87905 36.0 32.0 36.0 19.6 36.0 75-79 32.791700000000006 36.0 32.0 36.0 19.4 36.0 80-84 32.7595 36.0 32.0 36.0 21.0 36.0 85-89 32.6897 36.0 32.0 36.0 18.2 36.0 90-94 32.796150000000004 36.0 32.0 36.0 19.6 36.0 95-99 32.498149999999995 36.0 32.0 36.0 14.0 36.0 100-104 32.46825 36.0 32.0 36.0 14.0 36.0 105-109 32.429700000000004 36.0 32.0 36.0 14.0 36.0 110-114 32.42475 36.0 32.0 36.0 14.0 36.0 115-119 32.218149999999994 36.0 32.0 36.0 14.0 36.0 120-124 32.06099999999999 36.0 32.0 36.0 14.0 36.0 125-129 31.8624 36.0 32.0 36.0 14.0 36.0 130-134 31.785800000000002 36.0 32.0 36.0 14.0 36.0 135-139 31.620299999999997 36.0 32.0 36.0 14.0 36.0 140-144 31.21165 36.0 29.0 36.0 14.0 36.0 145-149 30.8358 36.0 27.0 36.0 14.0 36.0 150-151 28.657125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 2.0 21 8.0 22 12.0 23 18.0 24 39.0 25 55.0 26 90.0 27 111.0 28 133.0 29 176.0 30 223.0 31 272.0 32 358.0 33 544.0 34 947.0 35 1008.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.725 12.575 10.25 54.449999999999996 2 20.775 17.9 35.35 25.974999999999998 3 21.475 20.25 23.1 35.175 4 26.5 24.725 18.025 30.75 5 28.199999999999996 27.800000000000004 20.925 23.075000000000003 6 26.443997990959318 32.27021597187343 18.784530386740332 22.50125565042692 7 23.95 19.05 34.375 22.625 8 21.95 21.475 26.6 29.975 9 23.0 20.1 28.7 28.199999999999996 10-14 25.135 24.884999999999998 22.99 26.99 15-19 25.895000000000003 23.305 23.23 27.57 20-24 26.035000000000004 23.59 23.39 26.985 25-29 25.563834575186277 23.443516527479122 23.14347152072811 27.849177376606495 30-34 25.806612975839126 23.505577509879448 22.915311890350658 27.772497623930768 35-39 26.109804314098394 23.177018167258893 23.182022921775687 27.531154596867026 40-44 26.05319841707158 23.613685317838 23.002554726243552 27.330561538846865 45-49 26.37990675289517 23.64265303053091 22.314132450995135 27.663307765578782 50-54 26.022248947684908 23.110843856484266 23.566847063539786 27.300060132291044 55-59 26.193464183524924 23.3723206666332 22.473771397018222 27.960443752823654 60-64 26.725175526579743 22.60280842527583 23.264794383149447 27.407221664994985 65-69 26.872423846385846 22.87121745249824 22.710364934151002 27.545993766964916 70-74 27.345159350571258 22.9304469833634 22.519542994588093 27.20485067147725 75-79 27.111422986316473 22.650493709588492 22.800862112174826 27.4372211919202 80-84 26.48575577028989 23.53677464577179 23.21133530265859 26.76613428127973 85-89 27.268177951258572 22.639243356853324 22.50412850923285 27.588450182655254 90-94 27.056764191047762 22.765691422855713 22.45061265316329 27.726931732933235 95-99 27.740548109621926 22.709541908381674 22.549509901980397 27.000400080016 100-104 26.993496748374184 23.111555777888945 22.971485742871437 26.923461730865434 105-109 27.4368592148037 22.93573393348337 22.010502625656414 27.616904226056516 110-114 27.47736481416638 23.485568505827622 21.944875193837227 27.092191486168776 115-119 27.78111244497799 22.92917166866747 21.928771508603443 27.3609443777511 120-124 27.414112116817524 23.82857428614292 21.778266740011002 26.979046857028553 125-129 27.459118867830174 23.49352402860429 21.808271240686103 27.23908586287943 130-134 27.515 23.865 21.795 26.825 135-139 27.404110616592487 23.563534530179528 21.738260739110867 27.29409411411712 140-144 27.474999999999998 24.044999999999998 21.165 27.315 145-149 27.315 24.535 20.745 27.405 150-151 27.462500000000002 24.0125 20.7375 27.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 2.5 29 3.0 30 5.0 31 5.5 32 8.0 33 13.5 34 14.5 35 18.0 36 24.5 37 37.5 38 49.5 39 55.5 40 81.0 41 109.5 42 118.5 43 135.5 44 141.0 45 140.0 46 159.5 47 165.0 48 152.0 49 136.0 50 119.5 51 114.0 52 118.5 53 117.0 54 111.5 55 113.5 56 106.5 57 101.0 58 111.5 59 100.0 60 89.0 61 98.5 62 102.5 63 99.0 64 98.5 65 93.0 66 81.5 67 81.5 68 76.5 69 65.0 70 60.5 71 59.0 72 52.5 73 51.5 74 50.0 75 37.5 76 26.5 77 18.5 78 14.0 79 13.0 80 10.5 81 5.5 82 3.0 83 3.5 84 3.5 85 2.0 86 1.5 87 1.0 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.44999999999999996 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.045 35-39 0.095 40-44 0.185 45-49 0.265 50-54 0.22 55-59 0.395 60-64 0.3 65-69 0.53 70-74 0.22 75-79 0.245 80-84 0.135 85-89 0.08499999999999999 90-94 0.025 95-99 0.02 100-104 0.05 105-109 0.025 110-114 0.045 115-119 0.04 120-124 0.015 125-129 0.015 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4784688995215311 0.95 3 0.0503651473180559 0.15 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.324999999999999 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.550000000000001 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.675 0.0 0.0 0.0 0.0 134-135 7.324999999999999 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCAAA 10 0.006830828 145.0 6 CAAGCCA 10 0.006830828 145.0 4 >>END_MODULE SRR14458901 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.60525 32.0 32.0 32.0 32.0 32.0 2 30.336 32.0 32.0 32.0 21.0 32.0 3 30.3965 32.0 32.0 32.0 27.0 32.0 4 30.3545 32.0 32.0 32.0 21.0 32.0 5 30.444 32.0 32.0 32.0 32.0 32.0 6 33.616 36.0 36.0 36.0 21.0 36.0 7 33.679 36.0 36.0 36.0 21.0 36.0 8 33.73925 36.0 36.0 36.0 32.0 36.0 9 33.57225 36.0 36.0 36.0 21.0 36.0 10-14 33.6161 36.0 36.0 36.0 26.6 36.0 15-19 33.523799999999994 36.0 36.0 36.0 21.0 36.0 20-24 33.407149999999994 36.0 36.0 36.0 21.0 36.0 25-29 33.39835000000001 36.0 36.0 36.0 21.0 36.0 30-34 33.220749999999995 36.0 36.0 36.0 19.6 36.0 35-39 33.0782 36.0 36.0 36.0 15.4 36.0 40-44 33.1912 36.0 36.0 36.0 18.2 36.0 45-49 33.099000000000004 36.0 36.0 36.0 15.4 36.0 50-54 32.88195 36.0 36.0 36.0 14.0 36.0 55-59 32.6062 36.0 36.0 36.0 14.0 36.0 60-64 32.55535 36.0 36.0 36.0 14.0 36.0 65-69 32.1613 36.0 32.0 36.0 14.0 36.0 70-74 31.8368 36.0 32.0 36.0 14.0 36.0 75-79 31.569899999999997 36.0 32.0 36.0 14.0 36.0 80-84 31.387400000000003 36.0 32.0 36.0 14.0 36.0 85-89 31.553449999999998 36.0 32.0 36.0 14.0 36.0 90-94 31.223750000000003 36.0 32.0 36.0 14.0 36.0 95-99 31.195 36.0 32.0 36.0 14.0 36.0 100-104 31.04975 36.0 32.0 36.0 14.0 36.0 105-109 30.95795 36.0 32.0 36.0 14.0 36.0 110-114 30.814500000000002 36.0 31.0 36.0 14.0 36.0 115-119 30.481749999999998 36.0 27.0 36.0 14.0 36.0 120-124 30.41995 36.0 28.0 36.0 14.0 36.0 125-129 30.102899999999998 35.2 27.0 36.0 14.0 36.0 130-134 29.54065 33.6 27.0 36.0 14.0 36.0 135-139 28.96225 32.0 27.0 36.0 14.0 36.0 140-144 28.86085 32.0 25.8 36.0 14.0 36.0 145-149 28.94475 32.0 27.0 36.0 14.0 36.0 150-151 25.924625 29.5 17.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 2.0 9 4.0 10 8.0 11 14.0 12 3.0 13 3.0 14 7.0 15 10.0 16 4.0 17 10.0 18 10.0 19 8.0 20 16.0 21 15.0 22 28.0 23 46.0 24 57.0 25 90.0 26 126.0 27 134.0 28 192.0 29 243.0 30 271.0 31 323.0 32 443.0 33 607.0 34 782.0 35 541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.825 11.025 9.975000000000001 54.175 2 22.975 15.375 34.65 27.0 3 23.400000000000002 19.625 22.225 34.75 4 28.325 23.625 18.275 29.775000000000002 5 29.25 26.950000000000003 20.424999999999997 23.375 6 24.474999999999998 30.5 21.125 23.9 7 22.325 17.775 35.825 24.075 8 21.875 21.15 27.625 29.349999999999998 9 22.575 20.525 29.825000000000003 27.075 10-14 25.655 25.130000000000003 22.245 26.97 15-19 25.27 23.365 22.875 28.49 20-24 25.455 23.880000000000003 23.105 27.560000000000002 25-29 26.040000000000003 23.77 22.75 27.439999999999998 30-34 25.614456625118887 24.112729639084947 22.656054462632028 27.61675927316414 35-39 26.698444555945812 23.502257902659306 22.59407927747115 27.20521826392373 40-44 27.115586953254173 23.122400921889874 22.55624029259983 27.205771832256126 45-49 26.430545089173574 23.280582768148705 22.90881688018086 27.38005526249686 50-54 26.919393053385086 22.90164843474316 22.649594192670264 27.529364319201495 55-59 26.44066089059037 22.95990328430385 22.904493250050372 27.69494257505541 60-64 26.341291071518704 23.03538081057891 23.106041487911977 27.517286629990412 65-69 26.810166237178517 23.076145722803297 23.36415542418271 26.74953261583548 70-74 26.430200152014187 22.381555611857106 22.6399797314416 28.548264504687104 75-79 26.82976347578926 22.84032077961628 22.210943051466856 28.118972693127603 80-84 26.60522429858954 23.463516472325473 22.76083303630531 27.170426192779672 85-89 26.992928727679704 22.69929287276797 22.89260823116447 27.415170168387853 90-94 27.028955954323003 22.986337683523654 22.73654159869494 27.248164763458398 95-99 26.57054058185153 22.912314668568808 22.693228715544915 27.823916034034745 100-104 27.508156606851546 22.971044045676997 22.24204730831974 27.278752039151712 105-109 27.691994088569537 22.6010294042705 22.58064516129032 27.12633134586964 110-114 27.39152628892292 23.731495661051557 21.904032669729453 26.97294538029607 115-119 27.589203557918413 23.203148962273794 22.21143032409774 26.99621715571005 120-124 27.650429799426934 23.66966844044208 21.802087597216538 26.877814162914447 125-129 27.88279288970852 23.564366579580962 21.77654833256493 26.776292198145583 130-134 28.80262214483253 23.25104988220834 22.011676738707365 25.934651234251767 135-139 29.034903387832507 23.530316231869204 22.16185741376659 25.272922966531702 140-144 29.014589198873814 23.926286153058612 21.50499104171999 25.55413360634758 145-149 29.650299523833905 23.792944549690237 21.852439711228303 24.704316215247555 150-151 29.910371318822023 23.4955185659411 20.93469910371319 25.659411011523687 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 0.5 18 1.5 19 4.5 20 3.0 21 1.0 22 1.5 23 2.5 24 4.5 25 4.0 26 3.0 27 4.0 28 5.5 29 5.0 30 6.5 31 8.0 32 8.5 33 8.0 34 13.5 35 27.5 36 32.0 37 30.0 38 50.5 39 72.0 40 77.5 41 93.5 42 107.5 43 130.5 44 149.0 45 140.5 46 140.0 47 163.0 48 163.5 49 148.0 50 129.0 51 112.0 52 113.0 53 109.0 54 97.5 55 84.0 56 91.0 57 102.5 58 101.5 59 108.0 60 112.5 61 96.0 62 92.0 63 105.0 64 98.5 65 95.5 66 91.0 67 81.0 68 75.5 69 69.0 70 61.0 71 55.5 72 58.0 73 50.0 74 47.5 75 43.5 76 28.0 77 18.0 78 16.5 79 13.0 80 7.0 81 6.5 82 4.5 83 1.5 84 2.0 85 3.0 86 1.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.11499999999999999 35-39 0.35000000000000003 40-44 0.20500000000000002 45-49 0.475 50-54 0.815 55-59 0.74 60-64 0.935 65-69 1.045 70-74 1.325 75-79 1.49 80-84 1.805 85-89 1.7149999999999999 90-94 1.92 95-99 1.865 100-104 1.92 105-109 1.8849999999999998 110-114 2.0500000000000003 115-119 2.19 120-124 2.2800000000000002 125-129 2.395 130-134 2.37 135-139 2.445 140-144 2.325 145-149 2.3449999999999998 150-151 2.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.9249999999999998 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.6 0.0 0.0 0.0 0.0 136-137 7.3625 0.0 0.0 0.0 0.0 138-139 8.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045360 spots for SRR14458901.sra Written 1045360 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra Read 1045357 spots for SRR14458901.sra Written 1045357 spots for SRR14458901.sra SRR ids: ['SRR14458901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rlf00ql8 SRR14458901.sra spots: 20907143 blocks: [[1, 1045357], [1045358, 2090714], [2090715, 3136071], [3136072, 4181428], [4181429, 5226785], [5226786, 6272142], [6272143, 7317499], [7317500, 8362856], [8362857, 9408213], [9408214, 10453570], [10453571, 11498927], [11498928, 12544284], [12544285, 13589641], [13589642, 14634998], [14634999, 15680355], [15680356, 16725712], [16725713, 17771069], [17771070, 18816426], [18816427, 19861783], [19861784, 20907143]] SRR14458901 file size 7083461 SRR14458901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458901 SRR14458901_1.fastq SRR14458901_2.fastq Input file: SRR14458901_1.fastq Paired file: SRR14458901_2.fastq trimmed: SRR14458901-trimmed-pair1.fastq, SRR14458901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:02:15 2024 >> started Sat Dec 7 19:06:30 2024 >> done (254.812s) 20907143 read pairs processed; of these: 3368 ( 0.02%) short read pairs filtered out after trimming by size control 2168 ( 0.01%) empty read pairs filtered out after trimming by size control 20901607 (99.97%) read pairs available; of these: 3466493 (16.58%) trimmed read pairs available after processing 17435114 (83.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 126 0.00% 19 171 0.00% 20 136 0.00% 21 149 0.00% 22 143 0.00% 23 151 0.00% 24 129 0.00% 25 116 0.00% 26 144 0.00% 27 109 0.00% 28 100 0.00% 29 112 0.00% 30 110 0.00% 31 116 0.00% 32 126 0.00% 33 118 0.00% 34 196 0.00% 35 115 0.00% 36 105 0.00% 37 103 0.00% 38 90 0.00% 39 113 0.00% 40 87 0.00% 41 128 0.00% 42 109 0.00% 43 119 0.00% 44 112 0.00% 45 102 0.00% 46 116 0.00% 47 118 0.00% 48 148 0.00% 49 155 0.00% 50 149 0.00% 51 158 0.00% 52 140 0.00% 53 137 0.00% 54 147 0.00% 55 167 0.00% 56 165 0.00% 57 151 0.00% 58 182 0.00% 59 197 0.00% 60 228 0.00% 61 224 0.00% 62 268 0.00% 63 256 0.00% 64 271 0.00% 65 335 0.00% 66 309 0.00% 67 390 0.00% 68 412 0.00% 69 434 0.00% 70 532 0.00% 71 650 0.00% 72 697 0.00% 73 785 0.00% 74 821 0.00% 75 899 0.00% 76 906 0.00% 77 1002 0.00% 78 1131 0.01% 79 1329 0.01% 80 1564 0.01% 81 1806 0.01% 82 2166 0.01% 83 2472 0.01% 84 2764 0.01% 85 3004 0.01% 86 3241 0.02% 87 3496 0.02% 88 4412 0.02% 89 6223 0.03% 90 7498 0.04% 91 6930 0.03% 92 6971 0.03% 93 7636 0.04% 94 8551 0.04% 95 9941 0.05% 96 10446 0.05% 97 10622 0.05% 98 11453 0.05% 99 13477 0.06% 100 14996 0.07% 101 15870 0.08% 102 16486 0.08% 103 19416 0.09% 104 20986 0.10% 105 22010 0.11% 106 23253 0.11% 107 23952 0.11% 108 24365 0.12% 109 26382 0.13% 110 29341 0.14% 111 30996 0.15% 112 34537 0.17% 113 37914 0.18% 114 41819 0.20% 115 44302 0.21% 116 45524 0.22% 117 45444 0.22% 118 46352 0.22% 119 48608 0.23% 120 50683 0.24% 121 53607 0.26% 122 58446 0.28% 123 62925 0.30% 124 67924 0.32% 125 71152 0.34% 126 72993 0.35% 127 73364 0.35% 128 73677 0.35% 129 73579 0.35% 130 76643 0.37% 131 78773 0.38% 132 82600 0.40% 133 88316 0.42% 134 92268 0.44% 135 95084 0.45% 136 97419 0.47% 137 96194 0.46% 138 94981 0.45% 139 95644 0.46% 140 95661 0.46% 141 95091 0.45% 142 99775 0.48% 143 102953 0.49% 144 105141 0.50% 145 108631 0.52% 146 106356 0.51% 147 109250 0.52% 148 112781 0.54% 149 110243 0.53% 150 109669 0.52% 151 17435114 83.42% 20901607 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=9 prefix-density=0.53 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=18.10 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=9 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=26.12 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458901 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:12:55 Started mapping on | Dec 07 19:12:56 Finished on | Dec 07 20:00:00 Mapping speed, Million of reads per hour | 26.65 Number of input reads | 20901607 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19019875 Uniquely mapped reads % | 91.00% Average mapped length | 290.77 Number of splices: Total | 18949529 Number of splices: Annotated (sjdb) | 17927446 Number of splices: GT/AG | 18695883 Number of splices: GC/AG | 215054 Number of splices: AT/AC | 7807 Number of splices: Non-canonical | 30785 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284717 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 23188 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.31% % of reads unmapped: other | 1.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1597528 1597528 1597528 N_multimapping 284717 284717 284717 N_noFeature 505563 9528732 9663482 N_ambiguous 423875 48828 46544 UnstrandedReadsAssigned:18090437 PositiveStrandReadsAssigned:9442315 NegativeStrandReadsAssigned:9309849 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458901-trimmed-pair1.fastq SRR14458901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,901,607 reads, 19,337,673 reads pseudoaligned [quant] estimated average fragment length: 233.909 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,395 rounds 52973 SRR14458901.ke.tsv 35125 SRR14458901.se.tsv 88098 total ==> SRR14458901.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.301 0 0 PNS24247 1044 811.091 31.1022 2.58479 PNS24249 1928 1695.09 131.572 5.23209 PNS24246 1044 811.091 31.1022 2.58479 PNS24248 1044 811.091 31.1022 2.58479 PNS24244 1471 1238.09 31.1209 1.69435 PNS24243 293 104.066 6 3.88639 KQK14069 1603 1370.09 7308.55 359.571 KQK14071 474 252.66 213.196 56.8784 ==> SRR14458901.se.tsv <== BRADI_1g14170v3 7943 BRADI_1g53295v3 45 BRADI_1g59795v3 312 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 2114 BRADI_1g74790v3 716 BRADI_1g09890v3 5 BRADI_1g77505v3 447 BRADI_1g48960v3 0 SRR14458901 completed mapping pipeline successfully