Starting /dee2/code/volunteer_pipeline.sh SRR14458902 current disk space = 1540406644736 free memory = 1602378748 SRR14458902 SRAfilesize ca13ce6b8809b279c71a7642e1a6b083 SRR14458902.sra SRR14458902.sra file validated SRR14458902 is paired end SRR14458902 is conventional basespace SRR14458902 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.139 32.0 32.0 32.0 32.0 32.0 2 31.20075 32.0 32.0 32.0 32.0 32.0 3 31.236 32.0 32.0 32.0 32.0 32.0 4 31.3975 32.0 32.0 32.0 32.0 32.0 5 31.29375 32.0 32.0 32.0 32.0 32.0 6 34.314 36.0 36.0 36.0 32.0 36.0 7 34.56475 36.0 36.0 36.0 32.0 36.0 8 34.52825 36.0 36.0 36.0 32.0 36.0 9 34.39675 36.0 36.0 36.0 32.0 36.0 10-14 34.5165 36.0 36.0 36.0 32.0 36.0 15-19 34.44969999999999 36.0 36.0 36.0 32.0 36.0 20-24 34.431050000000006 36.0 36.0 36.0 32.0 36.0 25-29 34.24875 36.0 36.0 36.0 32.0 36.0 30-34 34.08025 36.0 36.0 36.0 32.0 36.0 35-39 34.007 36.0 36.0 36.0 32.0 36.0 40-44 33.958400000000005 36.0 36.0 36.0 32.0 36.0 45-49 33.83284999999999 36.0 36.0 36.0 32.0 36.0 50-54 33.75425 36.0 36.0 36.0 30.0 36.0 55-59 33.5072 36.0 36.0 36.0 25.8 36.0 60-64 33.3173 36.0 36.0 36.0 23.4 36.0 65-69 33.267450000000004 36.0 36.0 36.0 22.2 36.0 70-74 33.05475 36.0 33.6 36.0 21.0 36.0 75-79 32.845150000000004 36.0 32.0 36.0 21.0 36.0 80-84 32.8053 36.0 32.0 36.0 19.6 36.0 85-89 32.7846 36.0 32.0 36.0 21.0 36.0 90-94 32.8031 36.0 32.0 36.0 18.0 36.0 95-99 32.6249 36.0 32.0 36.0 16.8 36.0 100-104 32.6259 36.0 32.0 36.0 16.8 36.0 105-109 32.4843 36.0 32.0 36.0 14.0 36.0 110-114 32.3399 36.0 32.0 36.0 14.0 36.0 115-119 32.31915 36.0 32.0 36.0 14.0 36.0 120-124 32.122 36.0 32.0 36.0 14.0 36.0 125-129 31.8493 36.0 32.0 36.0 14.0 36.0 130-134 32.015750000000004 36.0 32.0 36.0 14.0 36.0 135-139 31.7012 36.0 32.0 36.0 14.0 36.0 140-144 31.266199999999998 36.0 29.0 36.0 14.0 36.0 145-149 30.767000000000003 36.0 27.0 36.0 14.0 36.0 150-151 28.680625 31.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 5.0 21 8.0 22 15.0 23 17.0 24 30.0 25 36.0 26 69.0 27 109.0 28 159.0 29 151.0 30 237.0 31 274.0 32 366.0 33 567.0 34 965.0 35 991.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.775000000000002 13.075000000000001 11.525 52.625 2 21.425 18.5 32.175 27.900000000000002 3 22.825 20.525 22.95 33.7 4 28.275 24.125 17.4 30.2 5 27.575 28.249999999999996 19.900000000000002 24.275 6 27.233935742971887 31.024096385542173 19.57831325301205 22.163654618473895 7 23.625 19.825 33.925 22.625 8 22.3 22.375 25.3 30.025000000000002 9 23.150000000000002 20.95 28.475 27.425 10-14 24.959999999999997 25.235000000000003 23.32 26.484999999999996 15-19 25.8 23.785 22.81 27.605 20-24 25.685000000000002 23.75 23.415 27.150000000000002 25-29 26.003900585087763 23.3184977746662 23.228484272640895 27.44911736760514 30-34 25.84404541589556 23.75831541039364 23.148101835642475 27.249537338068325 35-39 25.739156536094853 23.582970633848614 23.267797288508678 27.41007554154785 40-44 26.247809762202756 23.25907384230288 22.85857321652065 27.63454317897372 45-49 26.156235907200482 23.6909355113494 22.85413639324548 27.298692188204637 50-54 25.667351129363446 23.804277057144287 23.213301948214554 27.315069865277707 55-59 26.491096062202157 23.697015299724104 23.07499372962127 26.73689490845247 60-64 26.749198075380914 23.571571772253407 22.63432237369687 27.044907778668804 65-69 26.390074840524385 23.331156763272894 23.120196895876237 27.158571500326484 70-74 26.95447488355787 23.453698602694445 22.27174838483498 27.320078128912705 75-79 27.366100506037377 22.576281376822486 23.022195500776593 27.035422616363547 80-84 26.72771856077666 23.585047290196666 22.529149777310714 27.158084371715958 85-89 26.95634781739087 22.981149057452875 22.686134306715335 27.376368818440923 90-94 26.515 23.405 22.939999999999998 27.139999999999997 95-99 27.200000000000003 23.095 22.42 27.284999999999997 100-104 27.905 23.34 22.73 26.025 105-109 27.29 23.28 22.48 26.950000000000003 110-114 27.47 23.595 22.57 26.365 115-119 27.694999999999997 23.605 22.225 26.474999999999998 120-124 27.01 23.275000000000002 22.045 27.67 125-129 27.205000000000002 23.79 22.275 26.729999999999997 130-134 27.779999999999998 24.215 21.455 26.55 135-139 27.54 24.015 21.68 26.765 140-144 28.025 24.310000000000002 21.205 26.46 145-149 27.445000000000004 24.775 21.085 26.695 150-151 27.4125 24.6125 21.575 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 3.0 29 4.0 30 5.0 31 10.5 32 10.0 33 7.5 34 15.5 35 23.5 36 28.5 37 36.0 38 49.5 39 68.5 40 80.0 41 96.5 42 113.0 43 122.5 44 145.5 45 150.0 46 150.0 47 157.0 48 145.0 49 132.0 50 128.5 51 126.0 52 123.5 53 124.0 54 117.5 55 118.5 56 118.0 57 112.0 58 114.5 59 107.5 60 109.5 61 99.5 62 85.0 63 92.5 64 92.5 65 81.0 66 82.0 67 86.0 68 72.0 69 68.0 70 68.0 71 62.0 72 53.0 73 44.5 74 34.5 75 26.5 76 23.5 77 19.5 78 18.5 79 12.5 80 5.5 81 6.0 82 5.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.034999999999999996 35-39 0.055 40-44 0.125 45-49 0.215 50-54 0.165 55-59 0.325 60-64 0.24 65-69 0.455 70-74 0.165 75-79 0.20500000000000002 80-84 0.08499999999999999 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19191919191918 98.2 2 0.6565656565656566 1.3 3 0.10101010101010101 0.3 4 0.050505050505050504 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.9499999999999997 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.5625 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACCC 10 0.006830828 145.0 3 AGTCCCC 10 0.006830828 145.0 6 >>END_MODULE SRR14458902 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458902_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0295 32.0 32.0 32.0 32.0 32.0 2 30.6105 32.0 32.0 32.0 32.0 32.0 3 30.45025 32.0 32.0 32.0 32.0 32.0 4 30.5725 32.0 32.0 32.0 32.0 32.0 5 30.64275 32.0 32.0 32.0 32.0 32.0 6 33.86325 36.0 36.0 36.0 32.0 36.0 7 34.038 36.0 36.0 36.0 32.0 36.0 8 34.00875 36.0 36.0 36.0 32.0 36.0 9 33.83 36.0 36.0 36.0 32.0 36.0 10-14 33.9106 36.0 36.0 36.0 32.0 36.0 15-19 33.8371 36.0 36.0 36.0 31.0 36.0 20-24 33.83970000000001 36.0 36.0 36.0 31.0 36.0 25-29 33.7034 36.0 36.0 36.0 28.0 36.0 30-34 33.6541 36.0 36.0 36.0 29.0 36.0 35-39 33.5536 36.0 36.0 36.0 25.6 36.0 40-44 33.54565 36.0 36.0 36.0 26.8 36.0 45-49 33.429500000000004 36.0 36.0 36.0 24.6 36.0 50-54 33.2273 36.0 36.0 36.0 19.6 36.0 55-59 33.0977 36.0 36.0 36.0 18.2 36.0 60-64 32.90465 36.0 36.0 36.0 18.2 36.0 65-69 32.556799999999996 36.0 32.0 36.0 15.4 36.0 70-74 32.0741 36.0 32.8 36.0 14.0 36.0 75-79 31.871199999999998 36.0 32.0 36.0 14.0 36.0 80-84 31.62065 36.0 32.0 36.0 14.0 36.0 85-89 31.7406 36.0 32.0 36.0 14.0 36.0 90-94 31.342000000000002 36.0 32.0 36.0 14.0 36.0 95-99 31.392950000000003 36.0 32.0 36.0 14.0 36.0 100-104 31.29605 36.0 32.0 36.0 14.0 36.0 105-109 31.33035 36.0 32.0 36.0 14.0 36.0 110-114 30.9557 36.0 31.0 36.0 14.0 36.0 115-119 30.4858 36.0 27.0 36.0 14.0 36.0 120-124 30.46535 36.0 28.0 36.0 14.0 36.0 125-129 30.1262 35.2 27.0 36.0 14.0 36.0 130-134 29.660700000000002 34.4 27.0 36.0 14.0 36.0 135-139 29.079999999999995 32.0 27.0 36.0 14.0 36.0 140-144 28.951549999999997 32.0 27.0 36.0 14.0 36.0 145-149 28.967900000000004 32.0 27.0 36.0 14.0 36.0 150-151 26.123624999999997 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 7.0 10 10.0 11 6.0 12 8.0 13 9.0 14 10.0 15 10.0 16 7.0 17 13.0 18 12.0 19 11.0 20 13.0 21 21.0 22 26.0 23 35.0 24 55.0 25 81.0 26 107.0 27 124.0 28 157.0 29 181.0 30 273.0 31 286.0 32 442.0 33 548.0 34 860.0 35 688.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.630657664416105 11.852963240810203 9.952488122030507 55.56389097274319 2 22.225 17.05 33.475 27.250000000000004 3 21.475 20.3 22.8 35.425000000000004 4 27.075 22.7 17.224999999999998 33.0 5 29.325000000000003 26.974999999999998 19.675 24.025 6 24.9 32.425 18.925 23.75 7 23.95 18.675 33.550000000000004 23.825 8 22.1 22.575 25.775 29.549999999999997 9 23.625 19.225 29.599999999999998 27.55 10-14 25.47 24.404999999999998 22.97 27.155 15-19 25.83 23.815 22.915 27.439999999999998 20-24 25.119999999999997 23.66 23.435 27.785 25-29 25.96 23.7 22.98 27.36 30-34 25.761592716722525 23.700665299384724 23.085388424791155 27.452353559101596 35-39 25.754688596931103 24.06980242703841 22.7008324140006 27.474676562029888 40-44 26.424066473120433 23.385724296726398 22.76003603964361 27.43017319050956 45-49 25.95473478195413 23.550961007678026 22.858433281477392 27.635870928890448 50-54 25.79946618320995 23.553406859042152 23.236138389484818 27.41098856826308 55-59 26.558333752578356 23.439150777280275 22.719726316848618 27.282789153292754 60-64 26.066542131569648 23.436158933710306 22.815166355328927 27.682132579391123 65-69 26.514499721645834 23.234981527405232 22.96168834455185 27.288830406397086 70-74 26.572750851853737 22.839851497736866 23.119564664598485 27.467832985810915 75-79 26.137695561331093 23.049482749834375 22.92717729195332 27.885644396881208 80-84 26.251151366287996 23.365059871046974 22.674240098249925 27.709548664415106 85-89 27.273656243613324 23.451870018393624 22.09278561209892 27.181688125894134 90-94 27.069557640063564 23.030396227382234 22.210261930391102 27.689784202163104 95-99 26.834263478572524 23.286058061543187 22.533408427627872 27.346270032256413 100-104 26.720647773279353 23.112796597140367 22.743811817762516 27.422743811817764 105-109 26.790192967190457 23.31473614167989 22.966678609817272 26.92839228131238 110-114 26.357425386551604 23.737607232752865 22.787281039708223 27.117686340987312 115-119 26.929815520972895 23.116561888075854 22.709471297536844 27.244151293414408 120-124 26.803697774105252 23.19371998140784 22.863192687083615 27.13938955740329 125-129 27.7251797816752 23.60184179212582 22.225671271146982 26.447307155052 130-134 27.71053176081109 23.593006414235465 22.48086074901717 26.215601075936274 135-139 28.15704962187921 24.054698021340513 21.941365378638768 25.84688697814151 140-144 28.55444725825624 24.18212827536307 22.016641686908883 25.246782779471804 145-149 29.01591895803184 23.935290469299154 21.99193715112673 25.05685342154228 150-151 28.970512157268498 24.469736161407138 21.469218830832904 25.090532850491464 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 2.0 19 1.0 20 1.5 21 2.5 22 3.0 23 3.5 24 5.0 25 4.5 26 2.5 27 5.0 28 6.0 29 5.5 30 5.5 31 6.0 32 11.0 33 16.0 34 18.0 35 20.5 36 31.0 37 45.5 38 48.5 39 59.5 40 86.5 41 105.0 42 124.0 43 137.5 44 133.0 45 133.5 46 130.5 47 133.0 48 137.0 49 135.0 50 133.5 51 125.5 52 116.0 53 117.0 54 120.5 55 116.5 56 109.0 57 101.5 58 118.5 59 115.5 60 102.5 61 106.0 62 95.5 63 86.5 64 84.5 65 83.5 66 84.0 67 83.0 68 72.5 69 66.5 70 69.5 71 62.0 72 50.5 73 52.0 74 44.0 75 34.0 76 31.0 77 17.5 78 8.0 79 7.5 80 10.0 81 6.5 82 3.0 83 2.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.045 35-39 0.29 40-44 0.11 45-49 0.365 50-54 0.715 55-59 0.615 60-64 0.9650000000000001 65-69 1.205 70-74 1.685 75-79 1.8849999999999998 80-84 2.29 85-89 2.1399999999999997 90-94 2.455 95-99 2.3449999999999998 100-104 2.435 105-109 2.315 110-114 2.665 115-119 2.97 120-124 3.1850000000000005 125-129 3.3550000000000004 130-134 3.34 135-139 3.47 140-144 3.2550000000000003 145-149 3.26 150-151 3.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7575757575757576 1.5 3 0.12626262626262627 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.300000000000001 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404291 spots for SRR14458902.sra Written 1404291 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra Read 1404277 spots for SRR14458902.sra Written 1404277 spots for SRR14458902.sra SRR ids: ['SRR14458902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pv2mrjqn SRR14458902.sra spots: 28085554 blocks: [[1, 1404277], [1404278, 2808554], [2808555, 4212831], [4212832, 5617108], [5617109, 7021385], [7021386, 8425662], [8425663, 9829939], [9829940, 11234216], [11234217, 12638493], [12638494, 14042770], [14042771, 15447047], [15447048, 16851324], [16851325, 18255601], [18255602, 19659878], [19659879, 21064155], [21064156, 22468432], [22468433, 23872709], [23872710, 25276986], [25276987, 26681263], [26681264, 28085554]] SRR14458902 file size 9522999 SRR14458902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458902 SRR14458902_1.fastq SRR14458902_2.fastq Input file: SRR14458902_1.fastq Paired file: SRR14458902_2.fastq trimmed: SRR14458902-trimmed-pair1.fastq, SRR14458902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:14:06 2024 >> started Sat Dec 7 19:14:41 2024 >> done (34.352s) 28085554 read pairs processed; of these: 3586 ( 0.01%) short read pairs filtered out after trimming by size control 3258 ( 0.01%) empty read pairs filtered out after trimming by size control 28078710 (99.98%) read pairs available; of these: 4578877 (16.31%) trimmed read pairs available after processing 23499833 (83.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 177 0.00% 19 166 0.00% 20 188 0.00% 21 150 0.00% 22 149 0.00% 23 150 0.00% 24 174 0.00% 25 139 0.00% 26 140 0.00% 27 111 0.00% 28 147 0.00% 29 162 0.00% 30 143 0.00% 31 135 0.00% 32 148 0.00% 33 113 0.00% 34 194 0.00% 35 122 0.00% 36 158 0.00% 37 130 0.00% 38 134 0.00% 39 161 0.00% 40 136 0.00% 41 180 0.00% 42 159 0.00% 43 128 0.00% 44 158 0.00% 45 136 0.00% 46 155 0.00% 47 160 0.00% 48 184 0.00% 49 215 0.00% 50 192 0.00% 51 225 0.00% 52 171 0.00% 53 217 0.00% 54 226 0.00% 55 229 0.00% 56 229 0.00% 57 265 0.00% 58 277 0.00% 59 274 0.00% 60 339 0.00% 61 392 0.00% 62 395 0.00% 63 405 0.00% 64 424 0.00% 65 492 0.00% 66 427 0.00% 67 523 0.00% 68 596 0.00% 69 724 0.00% 70 788 0.00% 71 873 0.00% 72 1026 0.00% 73 1065 0.00% 74 1279 0.00% 75 1259 0.00% 76 1344 0.00% 77 1518 0.01% 78 1567 0.01% 79 1917 0.01% 80 2216 0.01% 81 2606 0.01% 82 3169 0.01% 83 3647 0.01% 84 3975 0.01% 85 4155 0.01% 86 4420 0.02% 87 5053 0.02% 88 6341 0.02% 89 8576 0.03% 90 9932 0.04% 91 9666 0.03% 92 9679 0.03% 93 10522 0.04% 94 11673 0.04% 95 13543 0.05% 96 13948 0.05% 97 14200 0.05% 98 15128 0.05% 99 17980 0.06% 100 20180 0.07% 101 21437 0.08% 102 22281 0.08% 103 25316 0.09% 104 27743 0.10% 105 28314 0.10% 106 29898 0.11% 107 30294 0.11% 108 30921 0.11% 109 33727 0.12% 110 37161 0.13% 111 39478 0.14% 112 43713 0.16% 113 47853 0.17% 114 53324 0.19% 115 56677 0.20% 116 57748 0.21% 117 57963 0.21% 118 58946 0.21% 119 61458 0.22% 120 64315 0.23% 121 68689 0.24% 122 75073 0.27% 123 80546 0.29% 124 86838 0.31% 125 92363 0.33% 126 94521 0.34% 127 94646 0.34% 128 95182 0.34% 129 95594 0.34% 130 99485 0.35% 131 102272 0.36% 132 107285 0.38% 133 116498 0.41% 134 122146 0.44% 135 125398 0.45% 136 128287 0.46% 137 127785 0.46% 138 126663 0.45% 139 126026 0.45% 140 126734 0.45% 141 127604 0.45% 142 134745 0.48% 143 138787 0.49% 144 142688 0.51% 145 148652 0.53% 146 146586 0.52% 147 149526 0.53% 148 155311 0.55% 149 148906 0.53% 150 150305 0.54% 151 23499833 83.69% 28078710 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=7 prefix-density=0.57 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=20.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=9 prefix-density=0.56 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.71 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458902 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:15:35 Started mapping on | Dec 07 19:15:35 Finished on | Dec 07 19:20:01 Mapping speed, Million of reads per hour | 380.01 Number of input reads | 28078710 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 24731121 Uniquely mapped reads % | 88.08% Average mapped length | 291.28 Number of splices: Total | 23827596 Number of splices: Annotated (sjdb) | 22533960 Number of splices: GT/AG | 23507570 Number of splices: GC/AG | 269576 Number of splices: AT/AC | 8930 Number of splices: Non-canonical | 41520 Mismatch rate per base, % | 0.69% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 552466 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 90488 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 3.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2795803 2795803 2795803 N_multimapping 552466 552466 552466 N_noFeature 747184 12410786 12609128 N_ambiguous 583376 67024 64076 UnstrandedReadsAssigned:23400561 PositiveStrandReadsAssigned:12253311 NegativeStrandReadsAssigned:12057917 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458902 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458902-trimmed-pair1.fastq SRR14458902-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,078,710 reads, 25,160,269 reads pseudoaligned [quant] estimated average fragment length: 230.059 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR14458902.ke.tsv 35125 SRR14458902.se.tsv 88098 total ==> SRR14458902.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.172 0 0 PNS24247 1044 814.941 37.1423 2.28477 PNS24249 1928 1698.94 115.409 3.40536 PNS24246 1044 814.941 37.1423 2.28477 PNS24248 1044 814.941 37.1423 2.28477 PNS24244 1471 1241.94 91.1638 3.67978 PNS24243 293 103.375 6 2.90961 KQK14069 1603 1373.94 9046.42 330.072 KQK14071 474 254.471 254.377 50.1117 ==> SRR14458902.se.tsv <== BRADI_1g14170v3 9791 BRADI_1g53295v3 60 BRADI_1g59795v3 376 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 2873 BRADI_1g74790v3 937 BRADI_1g09890v3 10 BRADI_1g77505v3 533 BRADI_1g48960v3 0 SRR14458902 completed mapping pipeline successfully