Starting /dee2/code/volunteer_pipeline.sh SRR14458903 current disk space = 1540371472384 free memory = 1472391112 SRR14458903 SRAfilesize 24dc30da04f517a1c3ca323e1db177da SRR14458903.sra SRR14458903.sra file validated SRR14458903 is paired end SRR14458903 is conventional basespace SRR14458903 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.10125 32.0 32.0 32.0 32.0 32.0 2 31.102 32.0 32.0 32.0 32.0 32.0 3 31.25975 32.0 32.0 32.0 32.0 32.0 4 31.40875 32.0 32.0 32.0 32.0 32.0 5 31.33525 32.0 32.0 32.0 32.0 32.0 6 34.456 36.0 36.0 36.0 32.0 36.0 7 34.503 36.0 36.0 36.0 32.0 36.0 8 34.312 36.0 36.0 36.0 32.0 36.0 9 34.554 36.0 36.0 36.0 32.0 36.0 10-14 34.537 36.0 36.0 36.0 32.0 36.0 15-19 34.52075 36.0 36.0 36.0 32.0 36.0 20-24 34.419650000000004 36.0 36.0 36.0 32.0 36.0 25-29 34.178999999999995 36.0 36.0 36.0 32.0 36.0 30-34 34.07665 36.0 36.0 36.0 32.0 36.0 35-39 33.98195 36.0 36.0 36.0 32.0 36.0 40-44 33.910000000000004 36.0 36.0 36.0 32.0 36.0 45-49 33.735400000000006 36.0 36.0 36.0 32.0 36.0 50-54 33.634550000000004 36.0 36.0 36.0 27.8 36.0 55-59 33.44865 36.0 36.0 36.0 23.4 36.0 60-64 33.267250000000004 36.0 36.0 36.0 22.2 36.0 65-69 33.19 36.0 36.0 36.0 21.0 36.0 70-74 32.99995 36.0 32.8 36.0 22.2 36.0 75-79 32.803599999999996 36.0 32.0 36.0 18.2 36.0 80-84 32.7081 36.0 32.0 36.0 18.2 36.0 85-89 32.724149999999995 36.0 32.0 36.0 16.8 36.0 90-94 32.81375 36.0 32.0 36.0 19.6 36.0 95-99 32.56915 36.0 32.0 36.0 14.0 36.0 100-104 32.5715 36.0 32.0 36.0 14.0 36.0 105-109 32.434549999999994 36.0 32.0 36.0 14.0 36.0 110-114 32.378750000000004 36.0 32.0 36.0 14.0 36.0 115-119 32.319449999999996 36.0 32.0 36.0 14.0 36.0 120-124 32.0742 36.0 32.0 36.0 14.0 36.0 125-129 31.98055 36.0 32.0 36.0 14.0 36.0 130-134 31.906799999999997 36.0 32.0 36.0 14.0 36.0 135-139 31.645850000000003 36.0 32.0 36.0 14.0 36.0 140-144 31.26565 36.0 29.0 36.0 14.0 36.0 145-149 30.8517 36.0 27.0 36.0 14.0 36.0 150-151 28.75875 31.5 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 4.0 18 0.0 19 2.0 20 6.0 21 8.0 22 22.0 23 20.0 24 35.0 25 45.0 26 77.0 27 95.0 28 120.0 29 175.0 30 209.0 31 273.0 32 400.0 33 568.0 34 934.0 35 1007.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.575 13.15 11.1 52.175000000000004 2 21.925 18.625 32.875 26.575 3 22.2 19.950000000000003 24.15 33.7 4 26.224999999999998 24.775 18.35 30.65 5 28.999999999999996 27.825 19.950000000000003 23.225 6 26.110971629425055 32.161687170474515 19.357268390660305 22.37007280944012 7 23.225 18.675 34.55 23.549999999999997 8 21.875 21.875 27.575 28.675 9 22.95 20.075000000000003 29.975 27.0 10-14 25.264999999999997 24.905 22.89 26.939999999999998 15-19 26.025 24.38 22.975 26.619999999999997 20-24 26.14 24.445 22.86 26.555 25-29 26.07021404280856 23.689737947589517 23.514702940588116 26.7253450690138 30-34 25.749012154253986 24.038413444705647 23.32316310708748 26.889411293952886 35-39 25.783048133693587 23.731612128489942 23.131191834284 27.35414790353247 40-44 26.063430031564707 24.47016383586352 23.077308482388897 26.389097650182876 45-49 26.203610832497493 23.786359077231694 23.094282848545635 26.915747241725175 50-54 26.151686801343427 23.87087072033686 23.625244373151535 26.352198105168178 55-59 26.586345381526105 23.68975903614458 22.951807228915662 26.772088353413654 60-64 26.39313838591563 23.830064703817026 23.047599939810404 26.729196970456943 65-69 26.475022615338222 23.972258518444065 22.720876469996984 26.831842396220722 70-74 26.29072681704261 23.659147869674186 23.38847117794486 26.66165413533835 75-79 26.11944040515469 23.476909191194906 23.17103745675174 27.23261294689866 80-84 26.460721974665795 23.857207229760178 22.955990587292845 26.72608020828118 85-89 26.802421574023118 23.670385750737978 22.80982638715165 26.71736628808726 90-94 26.314999999999998 23.455000000000002 23.115 27.115000000000002 95-99 26.135 23.29 23.77 26.805 100-104 26.638995849377405 23.203480522078312 23.733560034005098 26.42396359453918 105-109 27.16 23.31 23.325000000000003 26.205000000000002 110-114 26.961348067403367 23.36616830841542 22.69113455672784 26.981349067453376 115-119 26.621331066553328 24.181209060453025 22.79113955697785 26.4063203160158 120-124 26.895000000000003 23.29 23.189999999999998 26.625 125-129 27.534999999999997 23.66 22.56 26.245 130-134 27.500000000000004 24.235 22.075 26.19 135-139 27.317731773177318 24.477447744774476 22.252225222522252 25.95259525952595 140-144 27.22 24.775 21.945 26.06 145-149 27.51 24.435000000000002 21.755 26.3 150-151 27.250000000000004 24.4125 21.4875 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 3.0 28 3.5 29 4.0 30 6.5 31 6.5 32 7.0 33 9.5 34 13.5 35 22.5 36 30.0 37 39.0 38 65.5 39 88.5 40 92.0 41 95.0 42 110.0 43 133.5 44 142.0 45 149.0 46 169.0 47 175.0 48 166.5 49 148.0 50 137.5 51 128.5 52 122.5 53 117.0 54 111.5 55 111.0 56 101.5 57 102.0 58 100.5 59 104.0 60 105.0 61 94.0 62 90.5 63 87.5 64 84.5 65 86.0 66 80.0 67 70.0 68 60.0 69 53.5 70 58.0 71 57.0 72 50.5 73 47.0 74 41.5 75 34.5 76 24.5 77 15.0 78 11.5 79 10.0 80 5.5 81 2.5 82 2.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 1.0 97 1.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.42500000000000004 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.034999999999999996 35-39 0.06999999999999999 40-44 0.20500000000000002 45-49 0.3 50-54 0.255 55-59 0.4 60-64 0.315 65-69 0.51 70-74 0.25 75-79 0.28500000000000003 80-84 0.135 85-89 0.065 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.005 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.2375 0.0 0.0 0.0 0.0 130-131 5.85 0.0 0.0 0.0 0.0 132-133 6.2 0.0 0.0 0.0 0.0 134-135 6.7125 0.0 0.0 0.0 0.0 136-137 7.387499999999999 0.0 0.0 0.0 0.0 138-139 8.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTACG 10 0.006830828 145.0 6 GTTACGA 10 0.006830828 145.0 1 TTACGAC 10 0.006830828 145.0 2 >>END_MODULE SRR14458903 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458903_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9085 32.0 32.0 32.0 32.0 32.0 2 30.52725 32.0 32.0 32.0 32.0 32.0 3 30.5635 32.0 32.0 32.0 32.0 32.0 4 30.7355 32.0 32.0 32.0 32.0 32.0 5 30.6095 32.0 32.0 32.0 32.0 32.0 6 33.98225 36.0 36.0 36.0 32.0 36.0 7 33.9585 36.0 36.0 36.0 32.0 36.0 8 33.98825 36.0 36.0 36.0 32.0 36.0 9 33.99525 36.0 36.0 36.0 32.0 36.0 10-14 33.8375 36.0 36.0 36.0 31.0 36.0 15-19 33.796800000000005 36.0 36.0 36.0 31.0 36.0 20-24 33.689099999999996 36.0 36.0 36.0 29.0 36.0 25-29 33.56655 36.0 36.0 36.0 24.4 36.0 30-34 33.590199999999996 36.0 36.0 36.0 27.0 36.0 35-39 33.39575 36.0 36.0 36.0 22.2 36.0 40-44 33.39935 36.0 36.0 36.0 22.2 36.0 45-49 33.302350000000004 36.0 36.0 36.0 21.0 36.0 50-54 33.174850000000006 36.0 36.0 36.0 19.4 36.0 55-59 33.03045 36.0 36.0 36.0 18.2 36.0 60-64 32.681149999999995 36.0 36.0 36.0 14.0 36.0 65-69 32.3984 36.0 32.0 36.0 14.0 36.0 70-74 31.970149999999997 36.0 32.8 36.0 14.0 36.0 75-79 31.81435 36.0 32.0 36.0 14.0 36.0 80-84 31.573950000000004 36.0 32.0 36.0 14.0 36.0 85-89 31.721449999999997 36.0 32.0 36.0 14.0 36.0 90-94 31.4219 36.0 32.0 36.0 14.0 36.0 95-99 31.3102 36.0 32.0 36.0 14.0 36.0 100-104 31.347199999999997 36.0 32.0 36.0 14.0 36.0 105-109 31.2315 36.0 32.0 36.0 14.0 36.0 110-114 30.925750000000004 36.0 31.0 36.0 14.0 36.0 115-119 30.535899999999998 36.0 27.0 36.0 14.0 36.0 120-124 30.601049999999997 36.0 29.0 36.0 14.0 36.0 125-129 30.17655 35.2 27.0 36.0 14.0 36.0 130-134 29.5824 33.6 27.0 36.0 14.0 36.0 135-139 28.981100000000005 32.0 27.0 36.0 14.0 36.0 140-144 29.03295 32.0 27.0 36.0 14.0 36.0 145-149 29.1355 32.8 27.0 36.0 14.0 36.0 150-151 26.226374999999997 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 5.0 10 8.0 11 12.0 12 4.0 13 8.0 14 9.0 15 8.0 16 2.0 17 14.0 18 10.0 19 6.0 20 19.0 21 26.0 22 38.0 23 42.0 24 63.0 25 68.0 26 88.0 27 125.0 28 175.0 29 204.0 30 245.0 31 321.0 32 422.0 33 557.0 34 812.0 35 706.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.8 12.225 9.825000000000001 55.15 2 21.925 17.375 34.625 26.075 3 23.3 19.225 23.3 34.175 4 27.025 23.724999999999998 18.25 31.0 5 29.875 27.875 20.775 21.475 6 25.474999999999998 32.375 19.35 22.8 7 23.625 20.075000000000003 34.1 22.2 8 21.4 22.425 27.400000000000002 28.775000000000002 9 23.200000000000003 20.925 30.075000000000003 25.8 10-14 24.8 25.4 23.494999999999997 26.305 15-19 25.380000000000003 24.705 23.215 26.700000000000003 20-24 25.424999999999997 24.55 23.09 26.935 25-29 25.955000000000002 24.27 22.915 26.86 30-34 25.312781503353015 24.331898708837954 23.716344710239216 26.638975077569814 35-39 25.496888175065248 24.13170046175467 23.06765709696848 27.303754266211605 40-44 25.410739330795433 24.063313965137247 23.58745742336205 26.93848928070527 45-49 25.983223667687984 24.06449344517555 22.874077050580137 27.07820583655633 50-54 25.083190480992236 23.842896037107998 24.175657961076936 26.89825552082283 55-59 26.112789526686807 23.434038267875128 23.76636455186304 26.686807653575023 60-64 25.046710094430136 23.966065747614 23.34494773519164 27.64227642276423 65-69 26.811374215745797 23.2695810564663 23.58834244080146 26.33070228698644 70-74 25.808088496473335 24.164002638656314 22.778708073273457 27.249200791596895 75-79 26.027745312261803 23.669901925910867 23.375171502617004 26.927181259210325 80-84 25.568471499949013 23.87580299785867 23.360864688487815 27.194860813704498 85-89 26.39568052159739 23.889568052159742 22.590668296658517 27.124083129584353 90-94 26.55093183558846 23.553740107224915 23.181005871840693 26.714322185345928 95-99 26.51604018972816 23.21619829652675 23.899627683990413 26.36813382975468 100-104 26.696278143666717 23.72491958952366 23.163322611936486 26.41547965487313 105-109 26.974489795918366 23.64795918367347 22.816326530612244 26.56122448979592 110-114 26.834134861352705 23.938401719021797 22.56216105597053 26.66530236365497 115-119 27.237294220216423 23.85250525667983 22.431919585619774 26.478280937483973 120-124 27.156877858280666 24.433482349314012 22.19310415703201 26.21653563537331 125-129 27.397754198001444 23.843618007623366 22.416812609457093 26.3418151849181 130-134 27.695712594575117 24.056822275979208 22.142158628853775 26.105306500591897 135-139 27.9037411109966 23.832835205606514 22.585798206740186 25.6776254766567 140-144 28.672803003033888 23.669460585180232 22.558749421504604 25.098986990281276 145-149 28.973884433477277 24.280279662759614 22.434711083693195 24.311124820069914 150-151 28.22591020198122 24.57223723144217 22.372314421716197 24.829538144860415 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 2.0 16 2.0 17 1.0 18 1.0 19 1.5 20 1.0 21 2.5 22 4.0 23 3.0 24 3.0 25 2.5 26 2.0 27 4.5 28 6.0 29 3.5 30 4.0 31 9.0 32 12.0 33 15.0 34 20.0 35 32.0 36 44.5 37 56.0 38 69.0 39 80.5 40 87.5 41 98.0 42 127.5 43 134.5 44 139.5 45 161.0 46 161.0 47 151.5 48 143.5 49 143.0 50 139.5 51 130.5 52 126.5 53 108.0 54 107.5 55 115.5 56 102.0 57 99.5 58 110.0 59 102.0 60 89.0 61 91.0 62 90.0 63 83.5 64 77.0 65 72.0 66 66.0 67 74.5 68 80.5 69 70.5 70 62.0 71 59.0 72 45.5 73 37.0 74 33.0 75 25.0 76 23.5 77 17.5 78 9.5 79 6.5 80 4.0 81 1.5 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.09 35-39 0.38 40-44 0.18 45-49 0.455 50-54 0.83 55-59 0.7000000000000001 60-64 0.985 65-69 1.18 70-74 1.465 75-79 1.6049999999999998 80-84 1.9300000000000002 85-89 1.8399999999999999 90-94 2.075 95-99 1.965 100-104 2.0650000000000004 105-109 2.0 110-114 2.27 115-119 2.505 120-124 2.6950000000000003 125-129 2.93 130-134 2.855 135-139 2.97 140-144 2.765 145-149 2.74 150-151 2.8375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.7125000000000004 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.8625 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.762499999999999 0.0 0.0 0.0 0.0 138-139 7.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403258 spots for SRR14458903.sra Written 1403258 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra Read 1403242 spots for SRR14458903.sra Written 1403242 spots for SRR14458903.sra SRR ids: ['SRR14458903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lxtzqevr SRR14458903.sra spots: 28064856 blocks: [[1, 1403242], [1403243, 2806484], [2806485, 4209726], [4209727, 5612968], [5612969, 7016210], [7016211, 8419452], [8419453, 9822694], [9822695, 11225936], [11225937, 12629178], [12629179, 14032420], [14032421, 15435662], [15435663, 16838904], [16838905, 18242146], [18242147, 19645388], [19645389, 21048630], [21048631, 22451872], [22451873, 23855114], [23855115, 25258356], [25258357, 26661598], [26661599, 28064856]] SRR14458903 file size 9515965 SRR14458903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458903 SRR14458903_1.fastq SRR14458903_2.fastq Input file: SRR14458903_1.fastq Paired file: SRR14458903_2.fastq trimmed: SRR14458903-trimmed-pair1.fastq, SRR14458903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:20:38 2024 >> started Sat Dec 7 19:24:38 2024 >> done (240.036s) 28064856 read pairs processed; of these: 4063 ( 0.01%) short read pairs filtered out after trimming by size control 3075 ( 0.01%) empty read pairs filtered out after trimming by size control 28057718 (99.97%) read pairs available; of these: 4285684 (15.27%) trimmed read pairs available after processing 23772034 (84.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 212 0.00% 19 190 0.00% 20 180 0.00% 21 168 0.00% 22 167 0.00% 23 185 0.00% 24 191 0.00% 25 145 0.00% 26 159 0.00% 27 158 0.00% 28 156 0.00% 29 173 0.00% 30 194 0.00% 31 160 0.00% 32 152 0.00% 33 126 0.00% 34 237 0.00% 35 141 0.00% 36 163 0.00% 37 157 0.00% 38 171 0.00% 39 146 0.00% 40 140 0.00% 41 200 0.00% 42 165 0.00% 43 176 0.00% 44 151 0.00% 45 154 0.00% 46 176 0.00% 47 190 0.00% 48 199 0.00% 49 210 0.00% 50 213 0.00% 51 186 0.00% 52 206 0.00% 53 235 0.00% 54 242 0.00% 55 240 0.00% 56 283 0.00% 57 247 0.00% 58 318 0.00% 59 348 0.00% 60 406 0.00% 61 407 0.00% 62 472 0.00% 63 478 0.00% 64 526 0.00% 65 515 0.00% 66 540 0.00% 67 624 0.00% 68 638 0.00% 69 751 0.00% 70 858 0.00% 71 1008 0.00% 72 1185 0.00% 73 1330 0.00% 74 1381 0.00% 75 1448 0.01% 76 1516 0.01% 77 1664 0.01% 78 1822 0.01% 79 2185 0.01% 80 2473 0.01% 81 2940 0.01% 82 3353 0.01% 83 3987 0.01% 84 4246 0.02% 85 4603 0.02% 86 4792 0.02% 87 5282 0.02% 88 6634 0.02% 89 8780 0.03% 90 10528 0.04% 91 9947 0.04% 92 10313 0.04% 93 11032 0.04% 94 12233 0.04% 95 13871 0.05% 96 14298 0.05% 97 14471 0.05% 98 15564 0.06% 99 17958 0.06% 100 20432 0.07% 101 20985 0.07% 102 21769 0.08% 103 24858 0.09% 104 26918 0.10% 105 27660 0.10% 106 29630 0.11% 107 29514 0.11% 108 29899 0.11% 109 32283 0.12% 110 35594 0.13% 111 37151 0.13% 112 41392 0.15% 113 45491 0.16% 114 50440 0.18% 115 53520 0.19% 116 54202 0.19% 117 54348 0.19% 118 54442 0.19% 119 56379 0.20% 120 58950 0.21% 121 62634 0.22% 122 68716 0.24% 123 74294 0.26% 124 79727 0.28% 125 84268 0.30% 126 85858 0.31% 127 86271 0.31% 128 87467 0.31% 129 87131 0.31% 130 91196 0.33% 131 92696 0.33% 132 97744 0.35% 133 105745 0.38% 134 111439 0.40% 135 114773 0.41% 136 118085 0.42% 137 117982 0.42% 138 116129 0.41% 139 117092 0.42% 140 117422 0.42% 141 118051 0.42% 142 124382 0.44% 143 129984 0.46% 144 133921 0.48% 145 139232 0.50% 146 138783 0.49% 147 141818 0.51% 148 147042 0.52% 149 141768 0.51% 150 143108 0.51% 151 23772034 84.73% 28057718 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=7 prefix-density=0.55 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=22.44 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=10 prefix-density=0.53 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=20.16 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458903 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:32:21 Started mapping on | Dec 07 19:32:31 Finished on | Dec 07 20:06:00 Mapping speed, Million of reads per hour | 50.28 Number of input reads | 28057718 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 21769523 Uniquely mapped reads % | 77.59% Average mapped length | 284.86 Number of splices: Total | 22062835 Number of splices: Annotated (sjdb) | 20894684 Number of splices: GT/AG | 21767958 Number of splices: GC/AG | 246040 Number of splices: AT/AC | 8389 Number of splices: Non-canonical | 40448 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.01% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459669 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 100751 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.76% % of reads unmapped: other | 3.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5833597 5833597 5833597 N_multimapping 459669 459669 459669 N_noFeature 728278 10938754 11161794 N_ambiguous 547654 77590 78927 UnstrandedReadsAssigned:20493591 PositiveStrandReadsAssigned:10753179 NegativeStrandReadsAssigned:10528802 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458903 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458903-trimmed-pair1.fastq SRR14458903-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,057,718 reads, 25,137,289 reads pseudoaligned [quant] estimated average fragment length: 221.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR14458903.ke.tsv 35125 SRR14458903.se.tsv 88098 total ==> SRR14458903.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 715.41 0 0 PNS24247 1044 823.171 31.9708 2.02335 PNS24249 1928 1707.17 143.008 4.36406 PNS24246 1044 823.171 31.9708 2.02335 PNS24248 1044 823.171 31.9708 2.02335 PNS24244 1471 1250.17 55.0795 2.29524 PNS24243 293 107.891 6 2.89718 KQK14069 1603 1382.17 8341.93 314.422 KQK14071 474 261.95 275.583 54.8077 ==> SRR14458903.se.tsv <== BRADI_1g14170v3 7946 BRADI_1g53295v3 78 BRADI_1g59795v3 370 BRADI_1g07683v3 1 BRADI_1g00485v3 50 BRADI_1g20270v3 2512 BRADI_1g74790v3 817 BRADI_1g09890v3 7 BRADI_1g77505v3 485 BRADI_1g48960v3 0 SRR14458903 completed mapping pipeline successfully