Starting /dee2/code/volunteer_pipeline.sh SRR14458904 current disk space = 1540380725248 free memory = 1602377564 SRR14458904 SRAfilesize 35523a2eb6c0225af5f742badd39d8aa SRR14458904.sra SRR14458904.sra file validated SRR14458904 is paired end SRR14458904 is conventional basespace SRR14458904 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.10275 32.0 32.0 32.0 32.0 32.0 2 31.10225 32.0 32.0 32.0 32.0 32.0 3 31.3015 32.0 32.0 32.0 32.0 32.0 4 31.35675 32.0 32.0 32.0 32.0 32.0 5 31.2745 32.0 32.0 32.0 32.0 32.0 6 34.40675 36.0 36.0 36.0 32.0 36.0 7 34.608 36.0 36.0 36.0 32.0 36.0 8 34.54825 36.0 36.0 36.0 32.0 36.0 9 34.47525 36.0 36.0 36.0 32.0 36.0 10-14 34.592349999999996 36.0 36.0 36.0 32.0 36.0 15-19 34.54585 36.0 36.0 36.0 32.0 36.0 20-24 34.45654999999999 36.0 36.0 36.0 32.0 36.0 25-29 34.2912 36.0 36.0 36.0 32.0 36.0 30-34 34.166399999999996 36.0 36.0 36.0 32.0 36.0 35-39 34.1106 36.0 36.0 36.0 32.0 36.0 40-44 33.917449999999995 36.0 36.0 36.0 32.0 36.0 45-49 33.93300000000001 36.0 36.0 36.0 32.0 36.0 50-54 33.797 36.0 36.0 36.0 30.0 36.0 55-59 33.611450000000005 36.0 36.0 36.0 26.8 36.0 60-64 33.45165000000001 36.0 36.0 36.0 25.8 36.0 65-69 33.3977 36.0 36.0 36.0 24.6 36.0 70-74 33.102999999999994 36.0 34.4 36.0 22.2 36.0 75-79 32.87125 36.0 32.0 36.0 21.0 36.0 80-84 32.834900000000005 36.0 32.0 36.0 19.6 36.0 85-89 32.8033 36.0 32.0 36.0 19.6 36.0 90-94 32.91115 36.0 32.0 36.0 19.6 36.0 95-99 32.6699 36.0 32.0 36.0 18.2 36.0 100-104 32.6666 36.0 32.0 36.0 18.2 36.0 105-109 32.547 36.0 32.0 36.0 14.0 36.0 110-114 32.526300000000006 36.0 32.0 36.0 14.0 36.0 115-119 32.353699999999996 36.0 32.0 36.0 14.0 36.0 120-124 32.34215 36.0 32.0 36.0 14.0 36.0 125-129 32.13615 36.0 32.0 36.0 14.0 36.0 130-134 32.02265 36.0 32.0 36.0 14.0 36.0 135-139 31.776400000000002 36.0 32.0 36.0 14.0 36.0 140-144 31.415100000000002 36.0 29.0 36.0 14.0 36.0 145-149 30.982799999999997 36.0 27.0 36.0 14.0 36.0 150-151 28.854625 31.5 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 10.0 22 17.0 23 20.0 24 29.0 25 51.0 26 57.0 27 92.0 28 139.0 29 152.0 30 213.0 31 282.0 32 356.0 33 533.0 34 933.0 35 1110.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.450000000000003 12.475 12.925 47.15 2 21.2 17.9 31.15 29.75 3 24.025 20.25 22.275 33.45 4 27.825 23.9 18.2 30.075000000000003 5 28.275 26.974999999999998 20.25 24.5 6 25.508410745669092 31.835300025106704 19.93472257092644 22.721566658297764 7 22.6 18.575 34.8 24.025 8 23.825 21.725 25.025 29.425 9 23.95 20.65 27.425 27.975 10-14 25.35 25.369999999999997 22.805 26.474999999999998 15-19 25.645 23.745 23.150000000000002 27.46 20-24 24.891244562228113 24.24121206060303 22.911145557277866 27.956397819890995 25-29 26.05521104220844 24.084816963392676 22.664532906581318 27.19543908781756 30-34 25.786603971787304 23.690660797358813 23.27047171227052 27.252263518583362 35-39 25.70184656958415 24.03543011559826 22.42906470499925 27.833658609818347 40-44 26.409614421632448 23.870806209313972 22.8092138207311 26.910365548322485 45-49 26.26384087379127 23.197554987724835 23.357883661506087 27.180720476977804 50-54 26.422560609096372 23.632538569424966 22.891204167501503 27.05369665397716 55-59 26.12621651449784 23.487508778970604 23.296879703019965 27.08939500351159 60-64 26.473536487570172 23.200681635926223 23.050320769847634 27.275461106655975 65-69 26.047212456052236 23.184329482672027 23.370165745856355 27.398292315419386 70-74 26.754495817261937 23.498472173521016 22.296248058908983 27.45078395030807 75-79 26.375112714156902 23.088868850816553 23.143973549744516 27.392044885282036 80-84 26.80912821539386 23.20088079271344 22.585326794114703 27.404664197778 85-89 26.38923623268144 23.068073825839043 22.607912769469316 27.934777172010207 90-94 26.89672418104526 22.58064516129032 22.920730182545636 27.60190047511878 95-99 27.231807951987996 22.815703925981495 22.72568142035509 27.22680670167542 100-104 27.341835458864715 23.210802700675167 22.61065266316579 26.83670917729432 105-109 26.981745436359088 23.1807951987997 22.650662665666417 27.186796699174792 110-114 27.28182045511378 23.265816454113526 23.145786446611652 26.30657664416104 115-119 27.47686921730433 23.600900225056265 22.045511377844463 26.87671917979495 120-124 27.446861715428856 23.645911477869465 22.360590147536886 26.54663665916479 125-129 27.95198799699925 24.121030257564392 21.490372593148287 26.43660915228807 130-134 27.320464092818565 24.184836967393476 21.664332866573314 26.830366073214645 135-139 27.530506101220244 24.014802960592117 21.544308861772354 26.910382076415285 140-144 27.735547109421884 24.019803960792157 21.359271854370874 26.885377075415086 145-149 27.604140621093165 24.628694304145622 21.208181227184077 26.55898384757714 150-151 27.6625 23.9375 21.6625 26.737499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 2.5 30 3.5 31 5.0 32 9.0 33 15.0 34 20.5 35 23.0 36 30.0 37 51.0 38 72.0 39 76.5 40 79.5 41 95.0 42 117.5 43 126.0 44 140.5 45 143.0 46 133.0 47 137.0 48 140.0 49 146.5 50 148.0 51 132.0 52 119.5 53 125.0 54 115.0 55 95.0 56 96.0 57 102.0 58 103.0 59 109.5 60 95.0 61 94.5 62 100.0 63 85.5 64 82.0 65 75.0 66 77.5 67 87.5 68 80.0 69 76.5 70 76.0 71 63.5 72 62.0 73 54.0 74 40.5 75 29.5 76 21.5 77 19.0 78 15.0 79 12.5 80 12.5 81 11.0 82 4.0 83 1.5 84 1.5 85 2.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.42500000000000004 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.02 30-34 0.045 35-39 0.08499999999999999 40-44 0.15 45-49 0.20500000000000002 50-54 0.18 55-59 0.33 60-64 0.24 65-69 0.44999999999999996 70-74 0.185 75-79 0.19 80-84 0.09 85-89 0.034999999999999996 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.02 135-139 0.02 140-144 0.02 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3375000000000004 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 6.0875 0.0 0.0 0.0 0.0 132-133 6.8625 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTAT 10 0.006830828 145.0 6 >>END_MODULE SRR14458904 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9785 32.0 32.0 32.0 32.0 32.0 2 30.66825 32.0 32.0 32.0 32.0 32.0 3 30.6425 32.0 32.0 32.0 32.0 32.0 4 30.70325 32.0 32.0 32.0 32.0 32.0 5 30.70925 32.0 32.0 32.0 32.0 32.0 6 34.00075 36.0 36.0 36.0 32.0 36.0 7 34.098 36.0 36.0 36.0 32.0 36.0 8 34.061 36.0 36.0 36.0 32.0 36.0 9 34.0805 36.0 36.0 36.0 32.0 36.0 10-14 33.9705 36.0 36.0 36.0 32.0 36.0 15-19 33.9132 36.0 36.0 36.0 32.0 36.0 20-24 33.88445 36.0 36.0 36.0 31.0 36.0 25-29 33.77535 36.0 36.0 36.0 29.0 36.0 30-34 33.69255 36.0 36.0 36.0 28.0 36.0 35-39 33.6191 36.0 36.0 36.0 27.0 36.0 40-44 33.57365 36.0 36.0 36.0 26.8 36.0 45-49 33.40965 36.0 36.0 36.0 23.4 36.0 50-54 33.287699999999994 36.0 36.0 36.0 21.0 36.0 55-59 33.17515 36.0 36.0 36.0 18.2 36.0 60-64 32.92695 36.0 36.0 36.0 14.0 36.0 65-69 32.573 36.0 32.0 36.0 14.0 36.0 70-74 32.11965 36.0 32.8 36.0 14.0 36.0 75-79 32.005849999999995 36.0 32.0 36.0 14.0 36.0 80-84 31.71335 36.0 32.0 36.0 14.0 36.0 85-89 31.885399999999997 36.0 32.0 36.0 14.0 36.0 90-94 31.514099999999996 36.0 32.0 36.0 14.0 36.0 95-99 31.567649999999997 36.0 32.0 36.0 14.0 36.0 100-104 31.497300000000003 36.0 32.0 36.0 14.0 36.0 105-109 31.419150000000002 36.0 32.0 36.0 14.0 36.0 110-114 31.1887 36.0 32.0 36.0 14.0 36.0 115-119 30.7983 36.0 29.0 36.0 14.0 36.0 120-124 30.7262 36.0 31.0 36.0 14.0 36.0 125-129 30.4861 36.0 28.0 36.0 14.0 36.0 130-134 29.93055 34.4 27.0 36.0 14.0 36.0 135-139 29.263150000000003 32.0 27.0 36.0 14.0 36.0 140-144 29.219150000000003 32.0 27.0 36.0 14.0 36.0 145-149 29.201900000000002 32.0 27.0 36.0 14.0 36.0 150-151 26.298125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 7.0 10 9.0 11 5.0 12 2.0 13 5.0 14 11.0 15 13.0 16 14.0 17 13.0 18 14.0 19 5.0 20 10.0 21 14.0 22 22.0 23 28.0 24 52.0 25 78.0 26 102.0 27 126.0 28 140.0 29 230.0 30 233.0 31 294.0 32 394.0 33 554.0 34 870.0 35 753.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.974999999999998 12.375 12.225 48.425000000000004 2 24.349999999999998 17.075000000000003 30.3 28.275 3 23.35 20.0 22.575 34.075 4 27.525 23.474999999999998 17.974999999999998 31.025000000000002 5 30.95 26.400000000000002 19.45 23.200000000000003 6 25.35 30.95 20.65 23.05 7 22.85 19.05 34.8 23.3 8 23.95 22.2 25.324999999999996 28.525 9 23.9 20.8 27.6 27.700000000000003 10-14 25.624999999999996 25.040000000000003 22.49 26.845000000000002 15-19 25.86 23.630000000000003 23.23 27.279999999999998 20-24 26.240000000000002 24.26 22.869999999999997 26.63 25-29 26.21893283992599 23.99359903985598 22.993449017352603 26.79401910286543 30-34 25.71671586531245 23.960574373342673 23.48526542252464 26.837444338820234 35-39 26.448312183377638 23.238200331042787 22.666399157345637 27.647088328233938 40-44 25.922772574748336 23.613963039014372 23.323483748184504 27.139780638052784 45-49 25.948604697851835 23.639831359164827 22.625978719132707 27.785585223850635 50-54 26.141454820035236 23.614397180971558 22.90964007047571 27.334507928517493 55-59 26.125220015086747 23.32411365350767 22.962031682172494 27.58863464923309 60-64 26.281016743998386 22.97760742384507 23.27516643130926 27.466209400847287 65-69 26.22851365015167 22.947421638018202 23.351870576339735 27.472194135490398 70-74 26.226510919248348 23.377348908075167 23.057389537836464 27.33875063484002 75-79 26.42104727494784 23.37285634318864 23.230369955727443 26.975726426136077 80-84 26.12713811590503 23.70181261169262 22.578503957110033 27.592545315292316 85-89 26.7897205792372 23.174586987558637 22.679991841729553 27.35570059147461 90-94 26.913643331630045 23.832396525293817 22.171691364333164 27.082268778742975 95-99 27.024818711061176 23.148810131753653 23.000714942293943 26.825656214891225 100-104 27.157528996985334 23.652342752031068 22.354504113228757 26.83562413775484 105-109 26.750063824355376 22.879754914475363 23.196323717130458 27.173857544038803 110-114 26.797419090536668 23.468865219172468 23.07455960671856 26.659156083572306 115-119 28.270236995998772 23.77141684620909 21.88365650969529 26.07468964809685 120-124 27.524915236823176 23.800472618925305 22.17712935374499 26.497482790506528 125-129 27.91750244303863 23.61261122254796 22.234223113717018 26.23566322069639 130-134 28.44654702524811 23.751735486193244 21.86455494420733 25.937162544351317 135-139 28.796377296351565 23.748263263520816 21.489219369114394 25.96614007101323 140-144 28.480361916512443 23.889574336829117 21.8332305161423 25.796833230516143 145-149 29.457722950398356 24.009252120277562 21.490619378051914 25.042405551272168 150-151 28.968356058657065 24.479032673012608 21.880627733470543 24.67198353485979 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 1.5 13 2.0 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.5 21 2.5 22 2.0 23 1.0 24 0.5 25 2.5 26 2.0 27 2.0 28 4.5 29 5.0 30 5.5 31 8.0 32 13.5 33 16.5 34 23.0 35 29.0 36 37.5 37 53.0 38 64.5 39 75.5 40 88.0 41 95.5 42 104.0 43 132.5 44 144.5 45 139.0 46 151.5 47 145.5 48 132.0 49 142.5 50 135.0 51 116.5 52 120.5 53 115.0 54 98.0 55 99.5 56 96.0 57 100.5 58 109.5 59 102.5 60 100.0 61 102.0 62 97.5 63 84.0 64 82.5 65 84.5 66 79.5 67 75.0 68 77.5 69 75.0 70 66.5 71 59.0 72 51.0 73 51.0 74 46.5 75 35.0 76 27.0 77 22.5 78 19.0 79 13.0 80 8.5 81 6.0 82 4.0 83 2.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.065 35-39 0.315 40-44 0.165 45-49 0.38 50-54 0.675 55-59 0.575 60-64 0.86 65-69 1.0999999999999999 70-74 1.55 75-79 1.745 80-84 2.075 85-89 1.94 90-94 2.15 95-99 2.09 100-104 2.145 105-109 2.075 110-114 2.36 115-119 2.53 120-124 2.67 125-129 2.785 130-134 2.765 135-139 2.835 140-144 2.74 145-149 2.725 150-151 2.825 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0125 110-111 1.0875 0.0 0.0 0.0 0.025 112-113 1.275 0.0 0.0 0.0 0.025 114-115 1.725 0.0 0.0 0.0 0.025 116-117 2.175 0.0 0.0 0.0 0.025 118-119 2.525 0.0 0.0 0.0 0.025 120-121 2.9125 0.0 0.0 0.0 0.025 122-123 3.25 0.0 0.0 0.0 0.025 124-125 3.8375000000000004 0.0 0.0 0.0 0.025 126-127 4.512499999999999 0.0 0.0 0.0 0.025 128-129 5.0 0.0 0.0 0.0 0.025 130-131 5.8 0.0 0.0 0.0 0.025 132-133 6.512499999999999 0.0 0.0 0.0 0.025 134-135 7.137499999999999 0.0 0.0 0.0 0.025 136-137 7.95 0.0 0.0 0.0 0.025 138-139 9.05 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra Read 1127860 spots for SRR14458904.sra Written 1127860 spots for SRR14458904.sra SRR ids: ['SRR14458904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rrn49zeo SRR14458904.sra spots: 22557200 blocks: [[1, 1127860], [1127861, 2255720], [2255721, 3383580], [3383581, 4511440], [4511441, 5639300], [5639301, 6767160], [6767161, 7895020], [7895021, 9022880], [9022881, 10150740], [10150741, 11278600], [11278601, 12406460], [12406461, 13534320], [13534321, 14662180], [14662181, 15790040], [15790041, 16917900], [16917901, 18045760], [18045761, 19173620], [19173621, 20301480], [20301481, 21429340], [21429341, 22557200]] SRR14458904 file size 7644223 SRR14458904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458904 SRR14458904_1.fastq SRR14458904_2.fastq Input file: SRR14458904_1.fastq Paired file: SRR14458904_2.fastq trimmed: SRR14458904-trimmed-pair1.fastq, SRR14458904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:10:30 2024 >> started Sat Dec 7 19:11:00 2024 >> done (30.367s) 22557200 read pairs processed; of these: 4407 ( 0.02%) short read pairs filtered out after trimming by size control 12138 ( 0.05%) empty read pairs filtered out after trimming by size control 22540655 (99.93%) read pairs available; of these: 3991713 (17.71%) trimmed read pairs available after processing 18548942 (82.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 224 0.00% 19 197 0.00% 20 180 0.00% 21 179 0.00% 22 153 0.00% 23 166 0.00% 24 176 0.00% 25 132 0.00% 26 169 0.00% 27 126 0.00% 28 146 0.00% 29 163 0.00% 30 153 0.00% 31 164 0.00% 32 156 0.00% 33 113 0.00% 34 166 0.00% 35 158 0.00% 36 151 0.00% 37 110 0.00% 38 146 0.00% 39 144 0.00% 40 148 0.00% 41 144 0.00% 42 150 0.00% 43 160 0.00% 44 139 0.00% 45 158 0.00% 46 132 0.00% 47 171 0.00% 48 153 0.00% 49 210 0.00% 50 134 0.00% 51 167 0.00% 52 171 0.00% 53 203 0.00% 54 196 0.00% 55 210 0.00% 56 225 0.00% 57 224 0.00% 58 268 0.00% 59 266 0.00% 60 271 0.00% 61 305 0.00% 62 306 0.00% 63 331 0.00% 64 356 0.00% 65 348 0.00% 66 426 0.00% 67 462 0.00% 68 443 0.00% 69 493 0.00% 70 562 0.00% 71 623 0.00% 72 741 0.00% 73 783 0.00% 74 861 0.00% 75 881 0.00% 76 930 0.00% 77 1033 0.00% 78 1227 0.01% 79 1310 0.01% 80 1511 0.01% 81 1811 0.01% 82 2033 0.01% 83 2498 0.01% 84 2602 0.01% 85 2803 0.01% 86 3134 0.01% 87 3505 0.02% 88 4362 0.02% 89 6232 0.03% 90 7679 0.03% 91 7138 0.03% 92 7052 0.03% 93 7964 0.04% 94 8830 0.04% 95 10341 0.05% 96 10895 0.05% 97 10812 0.05% 98 11933 0.05% 99 14226 0.06% 100 16090 0.07% 101 17062 0.08% 102 17842 0.08% 103 20791 0.09% 104 22600 0.10% 105 23849 0.11% 106 25348 0.11% 107 25774 0.11% 108 26561 0.12% 109 29037 0.13% 110 32458 0.14% 111 34163 0.15% 112 39053 0.17% 113 42515 0.19% 114 47385 0.21% 115 50117 0.22% 116 51493 0.23% 117 52077 0.23% 118 52418 0.23% 119 55198 0.24% 120 58309 0.26% 121 61699 0.27% 122 67817 0.30% 123 72825 0.32% 124 78684 0.35% 125 83182 0.37% 126 84497 0.37% 127 84677 0.38% 128 86252 0.38% 129 86270 0.38% 130 88738 0.39% 131 91922 0.41% 132 96026 0.43% 133 103058 0.46% 134 108022 0.48% 135 111128 0.49% 136 112786 0.50% 137 111721 0.50% 138 111403 0.49% 139 111345 0.49% 140 111435 0.49% 141 112435 0.50% 142 116285 0.52% 143 121528 0.54% 144 123933 0.55% 145 127185 0.56% 146 125755 0.56% 147 126864 0.56% 148 131883 0.59% 149 126708 0.56% 150 128356 0.57% 151 18548942 82.29% 22540655 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=8 prefix-density=0.53 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=19.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=6 prefix-density=0.55 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=20.16 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458904 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:11:54 Started mapping on | Dec 07 19:11:54 Finished on | Dec 07 19:15:34 Mapping speed, Million of reads per hour | 368.85 Number of input reads | 22540655 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20380717 Uniquely mapped reads % | 90.42% Average mapped length | 290.59 Number of splices: Total | 19835235 Number of splices: Annotated (sjdb) | 18754262 Number of splices: GT/AG | 19565414 Number of splices: GC/AG | 227156 Number of splices: AT/AC | 7912 Number of splices: Non-canonical | 34753 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372543 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 39529 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.04% % of reads unmapped: other | 1.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1787950 1787950 1787950 N_multimapping 372543 372543 372543 N_noFeature 588749 10248575 10362863 N_ambiguous 458164 53861 51510 UnstrandedReadsAssigned:19333804 PositiveStrandReadsAssigned:10078281 NegativeStrandReadsAssigned:9966344 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458904-trimmed-pair1.fastq SRR14458904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,540,655 reads, 20,693,858 reads pseudoaligned [quant] estimated average fragment length: 231.765 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR14458904.ke.tsv 35125 SRR14458904.se.tsv 88098 total ==> SRR14458904.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.575 0 0 PNS24247 1044 813.235 33.9821 2.61016 PNS24249 1928 1697.23 134.817 4.96175 PNS24246 1044 813.235 33.9821 2.61016 PNS24248 1044 813.235 33.9821 2.61016 PNS24244 1471 1240.23 46.2367 2.32871 PNS24243 293 106.086 9 5.2993 KQK14069 1603 1372.23 7935.79 361.238 KQK14071 474 255.751 310.178 75.7574 ==> SRR14458904.se.tsv <== BRADI_1g14170v3 8856 BRADI_1g53295v3 55 BRADI_1g59795v3 292 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 2694 BRADI_1g74790v3 716 BRADI_1g09890v3 11 BRADI_1g77505v3 450 BRADI_1g48960v3 0 SRR14458904 completed mapping pipeline successfully