Starting /dee2/code/volunteer_pipeline.sh SRR14458905 current disk space = 1540200779776 free memory = 1440607036 SRR14458905 SRAfilesize f6c1a8f087baa4006f16e2cc9d8abf8c SRR14458905.sra SRR14458905.sra file validated SRR14458905 is paired end SRR14458905 is conventional basespace SRR14458905 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05675 32.0 32.0 32.0 32.0 32.0 2 31.1565 32.0 32.0 32.0 32.0 32.0 3 31.25925 32.0 32.0 32.0 32.0 32.0 4 31.3445 32.0 32.0 32.0 32.0 32.0 5 31.3975 32.0 32.0 32.0 32.0 32.0 6 34.3925 36.0 36.0 36.0 32.0 36.0 7 34.64975 36.0 36.0 36.0 32.0 36.0 8 34.5285 36.0 36.0 36.0 32.0 36.0 9 34.5555 36.0 36.0 36.0 32.0 36.0 10-14 34.5785 36.0 36.0 36.0 32.0 36.0 15-19 34.63295 36.0 36.0 36.0 32.0 36.0 20-24 34.587 36.0 36.0 36.0 32.0 36.0 25-29 34.362 36.0 36.0 36.0 32.0 36.0 30-34 34.248400000000004 36.0 36.0 36.0 32.0 36.0 35-39 34.15925 36.0 36.0 36.0 32.0 36.0 40-44 34.086749999999995 36.0 36.0 36.0 32.0 36.0 45-49 34.00885000000001 36.0 36.0 36.0 32.0 36.0 50-54 33.8591 36.0 36.0 36.0 30.0 36.0 55-59 33.68515 36.0 36.0 36.0 28.0 36.0 60-64 33.588 36.0 36.0 36.0 27.0 36.0 65-69 33.5439 36.0 36.0 36.0 27.0 36.0 70-74 33.227599999999995 36.0 35.2 36.0 25.8 36.0 75-79 33.05615 36.0 32.8 36.0 27.0 36.0 80-84 33.03035 36.0 32.0 36.0 23.4 36.0 85-89 32.9936 36.0 32.0 36.0 22.2 36.0 90-94 32.9382 36.0 32.0 36.0 22.0 36.0 95-99 32.7534 36.0 32.0 36.0 19.6 36.0 100-104 32.78915 36.0 32.0 36.0 19.6 36.0 105-109 32.650150000000004 36.0 32.0 36.0 15.4 36.0 110-114 32.673199999999994 36.0 32.0 36.0 16.8 36.0 115-119 32.536699999999996 36.0 32.0 36.0 15.4 36.0 120-124 32.387800000000006 36.0 32.0 36.0 14.0 36.0 125-129 32.16615 36.0 32.0 36.0 14.0 36.0 130-134 32.049800000000005 36.0 32.0 36.0 14.0 36.0 135-139 31.9954 36.0 32.0 36.0 14.0 36.0 140-144 31.5371 36.0 30.0 36.0 14.0 36.0 145-149 31.020050000000005 36.0 27.0 36.0 14.0 36.0 150-151 28.895875 32.0 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 4.0 20 4.0 21 2.0 22 11.0 23 17.0 24 29.0 25 52.0 26 56.0 27 82.0 28 123.0 29 141.0 30 214.0 31 261.0 32 385.0 33 544.0 34 991.0 35 1083.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.025 14.075 11.975 49.925000000000004 2 22.3 17.875 30.5 29.325000000000003 3 22.525000000000002 20.200000000000003 23.65 33.625 4 27.400000000000002 23.799999999999997 18.175 30.625000000000004 5 28.775000000000002 25.874999999999996 21.025 24.325 6 27.167919799498748 30.626566416040102 19.348370927318296 22.857142857142858 7 24.099999999999998 19.85 33.550000000000004 22.5 8 23.325000000000003 22.125 26.575 27.975 9 23.625 22.0 29.725 24.65 10-14 25.474999999999998 25.285000000000004 23.185 26.055 15-19 25.369999999999997 23.990000000000002 23.580000000000002 27.060000000000002 20-24 25.915 24.075 23.055 26.955000000000002 25-29 25.6501300260052 23.969793958791758 23.149629925985195 27.230446089217843 30-34 25.550110022004404 24.44488897779556 22.899579915983196 27.10542108421684 35-39 26.74337168584292 23.486743371685844 23.506753376688344 26.263131565782892 40-44 26.66700040048058 23.653384060873048 23.052663195835002 26.62695234281137 45-49 26.086085082928296 23.65084932605101 23.355213709475372 26.907851881545326 50-54 26.493714629138076 23.654029148094356 23.038012720989634 26.814243501777934 55-59 26.184626184626186 23.95326681040967 22.72476558190844 27.137341423055712 60-64 26.5517759631281 23.09002554982215 23.52086568809178 26.83733279895797 65-69 26.597772649744154 23.216614828935487 23.482492224340323 26.703120296980032 70-74 26.814243501777934 23.02298793008464 23.22331847548455 26.939450092652876 75-79 26.464697045568354 23.00951427140711 23.139709564346518 27.38607911867802 80-84 26.435861516910148 23.544126475885534 22.74864918951371 27.271362817690616 85-89 26.724008601290194 23.188478271740763 23.018452767915186 27.06906035905386 90-94 26.16 23.419999999999998 23.465 26.955000000000002 95-99 26.72 22.575 23.48 27.224999999999998 100-104 27.405 22.95 23.355 26.290000000000003 105-109 27.025 23.330000000000002 23.0 26.645000000000003 110-114 27.355 23.29 22.925 26.43 115-119 27.650000000000002 23.405 22.595000000000002 26.35 120-124 27.12 23.5 22.525000000000002 26.855 125-129 27.1 23.93 22.61 26.36 130-134 27.034999999999997 23.919999999999998 22.509999999999998 26.534999999999997 135-139 27.235 24.310000000000002 22.195 26.26 140-144 27.91 23.849999999999998 21.92 26.32 145-149 27.35 24.345 22.13 26.174999999999997 150-151 26.787499999999998 24.5375 22.8 25.874999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 0.5 26 0.0 27 0.0 28 0.5 29 2.0 30 4.5 31 8.5 32 10.0 33 11.0 34 16.5 35 25.5 36 37.0 37 46.5 38 55.0 39 71.0 40 85.0 41 103.0 42 123.0 43 131.0 44 143.0 45 144.0 46 148.0 47 165.0 48 152.0 49 142.0 50 143.0 51 132.0 52 116.5 53 102.5 54 108.5 55 120.0 56 114.0 57 108.5 58 108.5 59 95.5 60 93.0 61 95.0 62 99.0 63 103.5 64 81.5 65 65.0 66 73.0 67 75.0 68 75.5 69 82.5 70 79.5 71 66.0 72 51.0 73 40.5 74 32.0 75 25.5 76 28.0 77 21.5 78 11.5 79 10.0 80 5.5 81 3.0 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.02 35-39 0.05 40-44 0.12 45-49 0.215 50-54 0.165 55-59 0.28500000000000003 60-64 0.19499999999999998 65-69 0.33 70-74 0.165 75-79 0.15 80-84 0.06 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.6804435483870968 1.35 3 0.025201612903225805 0.075 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.6625 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458905 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.928 32.0 32.0 32.0 32.0 32.0 2 30.6155 32.0 32.0 32.0 32.0 32.0 3 30.768 32.0 32.0 32.0 32.0 32.0 4 30.72575 32.0 32.0 32.0 32.0 32.0 5 30.683 32.0 32.0 32.0 32.0 32.0 6 33.85825 36.0 36.0 36.0 32.0 36.0 7 33.98875 36.0 36.0 36.0 32.0 36.0 8 33.86475 36.0 36.0 36.0 32.0 36.0 9 34.05175 36.0 36.0 36.0 32.0 36.0 10-14 33.9299 36.0 36.0 36.0 32.0 36.0 15-19 33.84775 36.0 36.0 36.0 30.0 36.0 20-24 33.82365 36.0 36.0 36.0 31.0 36.0 25-29 33.75805 36.0 36.0 36.0 30.0 36.0 30-34 33.64594999999999 36.0 36.0 36.0 28.0 36.0 35-39 33.506899999999995 36.0 36.0 36.0 27.0 36.0 40-44 33.52315 36.0 36.0 36.0 26.8 36.0 45-49 33.36815 36.0 36.0 36.0 22.0 36.0 50-54 33.2573 36.0 36.0 36.0 19.6 36.0 55-59 33.1076 36.0 36.0 36.0 18.2 36.0 60-64 32.89895 36.0 36.0 36.0 15.4 36.0 65-69 32.55275 36.0 32.0 36.0 14.0 36.0 70-74 32.08895 36.0 32.8 36.0 14.0 36.0 75-79 31.9723 36.0 32.0 36.0 14.0 36.0 80-84 31.69675 36.0 32.0 36.0 14.0 36.0 85-89 31.8856 36.0 32.0 36.0 14.0 36.0 90-94 31.508599999999994 36.0 32.0 36.0 14.0 36.0 95-99 31.5298 36.0 32.0 36.0 14.0 36.0 100-104 31.438550000000003 36.0 32.0 36.0 14.0 36.0 105-109 31.4543 36.0 32.0 36.0 14.0 36.0 110-114 31.1153 36.0 32.0 36.0 14.0 36.0 115-119 30.866899999999998 36.0 31.0 36.0 14.0 36.0 120-124 30.81125 36.0 31.0 36.0 14.0 36.0 125-129 30.491300000000003 36.0 27.0 36.0 14.0 36.0 130-134 29.869300000000003 34.4 27.0 36.0 14.0 36.0 135-139 29.3673 32.8 27.0 36.0 14.0 36.0 140-144 29.3361 32.8 27.0 36.0 14.0 36.0 145-149 29.321849999999994 32.8 27.0 36.0 14.0 36.0 150-151 26.53025 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 3.0 10 6.0 11 8.0 12 7.0 13 6.0 14 5.0 15 7.0 16 15.0 17 10.0 18 9.0 19 14.0 20 8.0 21 16.0 22 29.0 23 41.0 24 51.0 25 71.0 26 93.0 27 106.0 28 164.0 29 205.0 30 228.0 31 334.0 32 408.0 33 592.0 34 913.0 35 648.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.912956478239117 11.78089044522261 10.380190095047524 51.92596298149075 2 23.85596399099775 16.92923230807702 31.332833208302073 27.881970492623154 3 23.575 19.5 22.575 34.35 4 27.1 22.5 19.325 31.075000000000003 5 28.925 26.900000000000002 19.075 25.1 6 26.825 30.875000000000004 19.825 22.475 7 23.875 19.625 33.95 22.55 8 21.5 23.35 26.525 28.625 9 23.875 21.0 28.225 26.900000000000002 10-14 25.745 25.064999999999998 23.24 25.95 15-19 25.765 24.005000000000003 22.98 27.250000000000004 20-24 25.34 24.005000000000003 23.955000000000002 26.700000000000003 25-29 25.619999999999997 24.565 23.155 26.66 30-34 25.722861430715362 24.34217108554277 23.186593296648326 26.74837418709355 35-39 25.66158781074579 24.213111467522054 23.100441058540497 27.02485966319166 40-44 26.104156234351528 23.960941412118178 23.119679519278918 26.81522283425138 45-49 25.565985643291 24.190552683098236 22.709703328146176 27.533758345464587 50-54 26.09724179585263 24.104086974028586 22.86088182001208 26.937789410106706 55-59 26.65895837522622 23.828674844158456 22.466318117836316 27.046048662779004 60-64 26.529480002017454 23.26120946184496 23.039289857265345 27.17002067887225 65-69 26.332272566550486 23.468202252866597 23.230792544324895 26.968732636258018 70-74 26.46224024328434 23.324885960466297 22.924480486568676 27.288393309680693 75-79 26.4643183433154 23.408790985686732 23.058572733732614 27.068317937265252 80-84 26.86194600101885 23.489556800815077 22.6286296484972 27.019867549668874 85-89 26.497074535741543 23.912490460442633 22.625286186720935 26.965148817094885 90-94 26.6092012649189 23.717229419565438 22.94195654391513 26.73161277160053 95-99 26.335099877700774 23.44578067672238 22.96167957602935 27.257439869547497 100-104 26.426931905126246 23.172660035705178 23.187962254526905 27.21244580464167 105-109 26.516155335847518 23.504229945979002 22.439098970543267 27.540515747630213 110-114 26.970424477703425 23.670633907135922 22.465137661541604 26.893803953619045 115-119 27.14855739717618 23.485778596275832 22.02271332105586 27.342950685492124 120-124 27.461325683843867 24.30591127958201 22.05716627394734 26.17559676262678 125-129 28.10688823921629 23.97804790480587 22.02903010719598 25.886033748781863 130-134 28.191980309711823 23.930878884217 21.82340272792534 26.053738078145834 135-139 28.31862946245384 24.122897004513746 22.009643003693068 25.54883052933935 140-144 29.071256595461296 24.132984990523028 22.119768454484916 24.67598995953076 145-149 28.66000512426339 24.084037919549065 22.14706635921086 25.108890596976686 150-151 28.556780312740322 24.391181748269673 22.289156626506024 24.762881312483977 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 2.0 17 4.0 18 2.0 19 0.5 20 1.5 21 2.0 22 3.0 23 4.5 24 3.0 25 1.5 26 3.5 27 3.5 28 6.0 29 8.5 30 7.0 31 9.5 32 11.0 33 12.5 34 16.0 35 25.0 36 33.0 37 42.5 38 62.5 39 75.5 40 89.5 41 104.5 42 118.0 43 133.5 44 140.5 45 146.5 46 147.0 47 141.5 48 138.0 49 144.5 50 144.5 51 143.0 52 133.5 53 113.0 54 103.5 55 101.5 56 108.0 57 107.0 58 105.5 59 106.5 60 99.0 61 86.5 62 82.5 63 82.5 64 74.5 65 68.0 66 75.0 67 82.0 68 77.5 69 79.5 70 71.5 71 60.0 72 55.5 73 42.5 74 36.5 75 32.0 76 23.0 77 17.0 78 11.0 79 7.5 80 6.5 81 4.5 82 4.0 83 2.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.05 35-39 0.24 40-44 0.15 45-49 0.395 50-54 0.66 55-59 0.54 60-64 0.865 65-69 1.015 70-74 1.35 75-79 1.49 80-84 1.8499999999999999 85-89 1.725 90-94 1.97 95-99 1.8800000000000001 100-104 1.975 105-109 1.8900000000000001 110-114 2.1149999999999998 115-119 2.26 120-124 2.39 125-129 2.5149999999999997 130-134 2.4899999999999998 135-139 2.52 140-144 2.395 145-149 2.4250000000000003 150-151 2.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.475 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.637499999999999 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.9 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGGG 10 0.0066678557 146.1282 145 GCCCGTT 10 0.007199208 142.475 1 >>END_MODULE Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013171 spots for SRR14458905.sra Written 1013171 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra Read 1013160 spots for SRR14458905.sra Written 1013160 spots for SRR14458905.sra SRR ids: ['SRR14458905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o8v45ojt SRR14458905.sra spots: 20263211 blocks: [[1, 1013160], [1013161, 2026320], [2026321, 3039480], [3039481, 4052640], [4052641, 5065800], [5065801, 6078960], [6078961, 7092120], [7092121, 8105280], [8105281, 9118440], [9118441, 10131600], [10131601, 11144760], [11144761, 12157920], [12157921, 13171080], [13171081, 14184240], [14184241, 15197400], [15197401, 16210560], [16210561, 17223720], [17223721, 18236880], [18236881, 19250040], [19250041, 20263211]] SRR14458905 file size 6864625 SRR14458905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458905 SRR14458905_1.fastq SRR14458905_2.fastq Input file: SRR14458905_1.fastq Paired file: SRR14458905_2.fastq trimmed: SRR14458905-trimmed-pair1.fastq, SRR14458905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:26:54 2024 >> started Sat Dec 7 19:29:45 2024 >> done (171.872s) 20263211 read pairs processed; of these: 2430 ( 0.01%) short read pairs filtered out after trimming by size control 4018 ( 0.02%) empty read pairs filtered out after trimming by size control 20256763 (99.97%) read pairs available; of these: 2987495 (14.75%) trimmed read pairs available after processing 17269268 (85.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 109 0.00% 19 123 0.00% 20 105 0.00% 21 89 0.00% 22 98 0.00% 23 96 0.00% 24 108 0.00% 25 85 0.00% 26 102 0.00% 27 96 0.00% 28 95 0.00% 29 104 0.00% 30 83 0.00% 31 91 0.00% 32 94 0.00% 33 80 0.00% 34 109 0.00% 35 85 0.00% 36 82 0.00% 37 84 0.00% 38 96 0.00% 39 96 0.00% 40 92 0.00% 41 105 0.00% 42 88 0.00% 43 105 0.00% 44 87 0.00% 45 103 0.00% 46 109 0.00% 47 103 0.00% 48 98 0.00% 49 119 0.00% 50 132 0.00% 51 110 0.00% 52 126 0.00% 53 147 0.00% 54 124 0.00% 55 132 0.00% 56 153 0.00% 57 155 0.00% 58 179 0.00% 59 198 0.00% 60 199 0.00% 61 243 0.00% 62 196 0.00% 63 226 0.00% 64 227 0.00% 65 239 0.00% 66 261 0.00% 67 281 0.00% 68 265 0.00% 69 330 0.00% 70 393 0.00% 71 494 0.00% 72 505 0.00% 73 543 0.00% 74 577 0.00% 75 535 0.00% 76 603 0.00% 77 687 0.00% 78 690 0.00% 79 794 0.00% 80 912 0.00% 81 1118 0.01% 82 1269 0.01% 83 1461 0.01% 84 1571 0.01% 85 1727 0.01% 86 1868 0.01% 87 2133 0.01% 88 2876 0.01% 89 4318 0.02% 90 5499 0.03% 91 4748 0.02% 92 4400 0.02% 93 4816 0.02% 94 5375 0.03% 95 6443 0.03% 96 6688 0.03% 97 6719 0.03% 98 7198 0.04% 99 9060 0.04% 100 10266 0.05% 101 10688 0.05% 102 10682 0.05% 103 12645 0.06% 104 14212 0.07% 105 14646 0.07% 106 15562 0.08% 107 15645 0.08% 108 15578 0.08% 109 17915 0.09% 110 19878 0.10% 111 21229 0.10% 112 24113 0.12% 113 27151 0.13% 114 30657 0.15% 115 32738 0.16% 116 33321 0.16% 117 33783 0.17% 118 34007 0.17% 119 35799 0.18% 120 37988 0.19% 121 40815 0.20% 122 45723 0.23% 123 50599 0.25% 124 55364 0.27% 125 58642 0.29% 126 60730 0.30% 127 60659 0.30% 128 61052 0.30% 129 61608 0.30% 130 63948 0.32% 131 66493 0.33% 132 71216 0.35% 133 78080 0.39% 134 84502 0.42% 135 86719 0.43% 136 88800 0.44% 137 88680 0.44% 138 87881 0.43% 139 86721 0.43% 140 87992 0.43% 141 88329 0.44% 142 94250 0.47% 143 99098 0.49% 144 103163 0.51% 145 107720 0.53% 146 107163 0.53% 147 109855 0.54% 148 113015 0.56% 149 108248 0.53% 150 108865 0.54% 151 17269268 85.25% 20256763 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=9 prefix-density=0.56 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=35.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.5 sequence=TGCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=10 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=30.64 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.9 sequence=TGCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR14458905 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:35:33 Started mapping on | Dec 07 19:35:34 Finished on | Dec 07 20:04:00 Mapping speed, Million of reads per hour | 42.75 Number of input reads | 20256763 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18441316 Uniquely mapped reads % | 91.04% Average mapped length | 292.52 Number of splices: Total | 18467793 Number of splices: Annotated (sjdb) | 17464791 Number of splices: GT/AG | 18220876 Number of splices: GC/AG | 211484 Number of splices: AT/AC | 7094 Number of splices: Non-canonical | 28339 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293890 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 28198 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.68% % of reads unmapped: other | 1.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1521989 1521989 1521989 N_multimapping 293890 293890 293890 N_noFeature 500260 9187983 9403619 N_ambiguous 442973 49789 48192 UnstrandedReadsAssigned:17498083 PositiveStrandReadsAssigned:9203544 NegativeStrandReadsAssigned:8989505 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458905-trimmed-pair1.fastq SRR14458905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,256,763 reads, 18,744,560 reads pseudoaligned [quant] estimated average fragment length: 233.54 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52973 SRR14458905.ke.tsv 35125 SRR14458905.se.tsv 88098 total ==> SRR14458905.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.709 0 0 PNS24247 1044 811.46 37.5745 3.16064 PNS24249 1928 1695.46 144.034 5.79865 PNS24246 1044 811.46 37.5745 3.16064 PNS24248 1044 811.46 37.5745 3.16064 PNS24244 1471 1238.46 25.2421 1.39121 PNS24243 293 102.001 2 1.33837 KQK14069 1603 1370.46 12340.5 614.63 KQK14071 474 252.442 405.249 109.574 ==> SRR14458905.se.tsv <== BRADI_1g14170v3 13598 BRADI_1g53295v3 48 BRADI_1g59795v3 327 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1666 BRADI_1g74790v3 662 BRADI_1g09890v3 16 BRADI_1g77505v3 495 BRADI_1g48960v3 0 SRR14458905 completed mapping pipeline successfully