Starting /dee2/code/volunteer_pipeline.sh SRR14458906 current disk space = 1540213338112 free memory = 1599201708 SRR14458906 SRAfilesize 43ad5fa440fb06118cd3a2836dc6ca82 SRR14458906.sra SRR14458906.sra file validated SRR14458906 is paired end SRR14458906 is conventional basespace SRR14458906 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.867 32.0 32.0 32.0 32.0 32.0 2 31.0205 32.0 32.0 32.0 32.0 32.0 3 31.11175 32.0 32.0 32.0 32.0 32.0 4 31.25375 32.0 32.0 32.0 32.0 32.0 5 31.1785 32.0 32.0 32.0 32.0 32.0 6 34.02125 36.0 36.0 36.0 32.0 36.0 7 34.42 36.0 36.0 36.0 32.0 36.0 8 34.0395 36.0 36.0 36.0 32.0 36.0 9 34.36725 36.0 36.0 36.0 32.0 36.0 10-14 34.28255 36.0 36.0 36.0 32.0 36.0 15-19 34.346349999999994 36.0 36.0 36.0 32.0 36.0 20-24 34.242399999999996 36.0 36.0 36.0 32.0 36.0 25-29 33.952600000000004 36.0 36.0 36.0 31.0 36.0 30-34 33.9114 36.0 36.0 36.0 32.0 36.0 35-39 33.786649999999995 36.0 36.0 36.0 32.0 36.0 40-44 33.68475 36.0 36.0 36.0 28.0 36.0 45-49 33.6425 36.0 36.0 36.0 28.0 36.0 50-54 33.465900000000005 36.0 36.0 36.0 24.4 36.0 55-59 33.28685 36.0 36.0 36.0 22.2 36.0 60-64 33.16779999999999 36.0 36.0 36.0 21.0 36.0 65-69 33.07645000000001 36.0 36.0 36.0 19.6 36.0 70-74 32.7402 36.0 32.0 36.0 14.0 36.0 75-79 32.58845 36.0 32.0 36.0 14.0 36.0 80-84 32.65595 36.0 32.0 36.0 18.2 36.0 85-89 32.50795000000001 36.0 32.0 36.0 14.0 36.0 90-94 32.4652 36.0 32.0 36.0 15.4 36.0 95-99 32.38325 36.0 32.0 36.0 14.0 36.0 100-104 32.29905 36.0 32.0 36.0 14.0 36.0 105-109 32.15255 36.0 32.0 36.0 14.0 36.0 110-114 32.13335 36.0 32.0 36.0 14.0 36.0 115-119 32.03654999999999 36.0 32.0 36.0 14.0 36.0 120-124 31.939100000000003 36.0 32.0 36.0 14.0 36.0 125-129 31.6887 36.0 32.0 36.0 14.0 36.0 130-134 31.6462 36.0 32.0 36.0 14.0 36.0 135-139 31.510550000000002 36.0 32.0 36.0 14.0 36.0 140-144 30.9706 36.0 29.0 36.0 14.0 36.0 145-149 30.54905 34.4 27.0 36.0 14.0 36.0 150-151 28.394625 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 2.0 19 6.0 20 4.0 21 5.0 22 12.0 23 17.0 24 30.0 25 48.0 26 80.0 27 112.0 28 152.0 29 196.0 30 261.0 31 329.0 32 439.0 33 535.0 34 913.0 35 858.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.400000000000002 13.075000000000001 11.875 48.65 2 22.675 19.175 30.2 27.950000000000003 3 23.05 20.0 23.525 33.425 4 26.25 23.549999999999997 19.025 31.175000000000004 5 28.15 28.449999999999996 19.05 24.349999999999998 6 27.54385964912281 31.127819548872182 19.298245614035086 22.030075187969924 7 24.099999999999998 19.625 33.225 23.05 8 22.475 21.575 26.25 29.7 9 23.175 21.65 28.425 26.75 10-14 25.495 24.915000000000003 22.685 26.905 15-19 26.064999999999998 23.985 22.884999999999998 27.065 20-24 25.685000000000002 23.76 22.96 27.595 25-29 25.65128256412821 23.656182809140457 23.53117655882794 27.161358067903397 30-34 25.90759075907591 23.54235423542354 23.682368236823685 26.86768676867687 35-39 25.841628732929816 22.92531639237657 23.315491971387125 27.917562903306486 40-44 26.246246246246248 23.983983983983983 22.32232232232232 27.44744744744745 45-49 26.155772602053595 23.551214625594792 22.79489105935387 27.498121712997747 50-54 26.265965439519157 22.96018031555222 22.875031304783374 27.89882294014525 55-59 25.978843936431545 23.19647064721512 23.53236075600341 27.292324660349927 60-64 26.496668503581983 22.66920494965182 23.325484695155556 27.508641851610644 65-69 26.43828058383909 23.519085118122085 22.907157546270753 27.135476751768067 70-74 26.969499674462867 22.49712024840988 22.847698702859716 27.68568137426754 75-79 26.733119615307555 22.80605089160489 23.201763173712685 27.259066319374874 80-84 27.186311787072242 23.46407844706824 22.673604162497497 26.676005603362018 85-89 27.385954381752704 23.299319727891156 22.784113645458184 26.53061224489796 90-94 27.045 23.0 22.48 27.474999999999998 95-99 27.12 22.89 23.200000000000003 26.790000000000003 100-104 27.377737773777376 23.03230323032303 22.767276727672765 26.82268226822682 105-109 27.134999999999998 24.065 22.264999999999997 26.534999999999997 110-114 27.28772877287729 23.042304230423042 22.98229822982298 26.687668766876687 115-119 27.661383069153455 23.481174058702937 22.281114055702787 26.57632881644082 120-124 27.63 23.025000000000002 22.634999999999998 26.71 125-129 27.92 23.47 22.14 26.47 130-134 28.28 23.515 22.3 25.905 135-139 28.061403070153506 23.176158807940396 21.911095554777738 26.851342567128356 140-144 27.779999999999998 23.89 21.895 26.435 145-149 28.084999999999997 23.95 21.51 26.455000000000002 150-151 26.9125 24.7875 21.337500000000002 26.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 1.5 30 5.0 31 7.0 32 9.0 33 15.0 34 19.5 35 27.5 36 33.0 37 46.5 38 61.0 39 71.0 40 84.5 41 95.0 42 109.0 43 122.5 44 129.0 45 135.5 46 139.5 47 132.5 48 143.0 49 148.5 50 133.5 51 116.5 52 116.0 53 121.5 54 114.5 55 105.5 56 104.0 57 114.0 58 119.0 59 113.5 60 97.0 61 92.5 62 108.0 63 111.5 64 102.5 65 88.5 66 83.5 67 91.0 68 86.5 69 69.5 70 59.5 71 55.5 72 48.0 73 45.0 74 41.5 75 34.5 76 26.5 77 18.5 78 12.0 79 9.5 80 6.0 81 2.5 82 3.0 83 2.5 84 2.0 85 1.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.01 35-39 0.045 40-44 0.1 45-49 0.17500000000000002 50-54 0.17500000000000002 55-59 0.265 60-64 0.19499999999999998 65-69 0.315 70-74 0.165 75-79 0.18 80-84 0.06 85-89 0.04 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.01 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5542957923910304 1.0999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.9750000000000001 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.487500000000001 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.487500000000001 0.0 0.0 0.0 0.0 138-139 8.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACGT 20 0.00593511 29.0 135-139 ACGTCTG 20 0.00593511 29.0 140-144 GTCTGAA 20 0.00593511 29.0 140-144 GCACACG 20 0.00593511 29.0 135-139 >>END_MODULE SRR14458906 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.395 32.0 32.0 32.0 32.0 32.0 2 29.89625 32.0 32.0 32.0 21.0 32.0 3 29.8585 32.0 32.0 32.0 21.0 32.0 4 29.95425 32.0 32.0 32.0 21.0 32.0 5 29.88925 32.0 32.0 32.0 21.0 32.0 6 32.856 36.0 36.0 36.0 21.0 36.0 7 32.98875 36.0 36.0 36.0 21.0 36.0 8 32.893 36.0 36.0 36.0 21.0 36.0 9 32.793 36.0 36.0 36.0 21.0 36.0 10-14 32.731049999999996 36.0 34.4 36.0 16.8 36.0 15-19 32.70235000000001 36.0 36.0 36.0 16.8 36.0 20-24 32.71039999999999 36.0 36.0 36.0 16.8 36.0 25-29 32.561249999999994 36.0 34.4 36.0 14.0 36.0 30-34 32.62665 36.0 36.0 36.0 14.0 36.0 35-39 32.384550000000004 36.0 34.4 36.0 14.0 36.0 40-44 32.407 36.0 34.4 36.0 14.0 36.0 45-49 32.23365 36.0 33.6 36.0 14.0 36.0 50-54 32.1107 36.0 32.8 36.0 14.0 36.0 55-59 31.901100000000003 36.0 32.0 36.0 14.0 36.0 60-64 31.731500000000004 36.0 32.0 36.0 14.0 36.0 65-69 31.33865 36.0 32.0 36.0 14.0 36.0 70-74 30.99805 36.0 32.0 36.0 14.0 36.0 75-79 30.807299999999998 36.0 31.0 36.0 14.0 36.0 80-84 30.488799999999998 36.0 28.0 36.0 14.0 36.0 85-89 30.773450000000004 36.0 32.0 36.0 14.0 36.0 90-94 30.2942 36.0 28.0 36.0 14.0 36.0 95-99 30.3139 36.0 27.0 36.0 14.0 36.0 100-104 30.30295 36.0 27.0 36.0 14.0 36.0 105-109 30.1826 36.0 27.0 36.0 14.0 36.0 110-114 30.096999999999998 36.0 27.0 36.0 14.0 36.0 115-119 29.714999999999996 36.0 27.0 36.0 14.0 36.0 120-124 29.751299999999997 36.0 27.0 36.0 14.0 36.0 125-129 29.3264 35.2 27.0 36.0 14.0 36.0 130-134 28.8996 32.8 27.0 36.0 14.0 36.0 135-139 28.267599999999998 32.0 24.6 36.0 14.0 36.0 140-144 28.207150000000002 32.0 24.6 36.0 14.0 36.0 145-149 28.26105 32.0 24.6 36.0 14.0 36.0 150-151 25.572125 29.5 17.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 3.0 9 1.0 10 6.0 11 10.0 12 1.0 13 6.0 14 6.0 15 4.0 16 12.0 17 9.0 18 14.0 19 11.0 20 16.0 21 14.0 22 36.0 23 55.0 24 88.0 25 131.0 26 175.0 27 211.0 28 229.0 29 306.0 30 330.0 31 402.0 32 464.0 33 580.0 34 628.0 35 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.95 12.2 10.525 51.324999999999996 2 23.45 16.6 32.475 27.474999999999998 3 23.225 17.825 23.799999999999997 35.15 4 27.875 21.7 17.775 32.65 5 29.275000000000002 25.900000000000002 20.4 24.425 6 26.85 30.15 19.375 23.625 7 23.625 19.625 33.2 23.549999999999997 8 22.925 21.25 25.825 30.0 9 24.25 19.6 27.55 28.599999999999998 10-14 25.3 24.645 22.98 27.075 15-19 25.619999999999997 23.945 22.965 27.47 20-24 25.515 24.03 23.189999999999998 27.265 25-29 26.355 23.32 22.925 27.400000000000002 30-34 25.986891479461647 23.925551608545554 22.919897933656877 27.16765897833592 35-39 26.380952380952383 23.829573934837093 22.76190476190476 27.02756892230577 40-44 26.4243516571543 23.44047261439872 22.954841293681785 27.180334434765197 45-49 26.23370110330993 23.64593781344032 22.48244734202608 27.63791374122367 50-54 26.18245790399598 23.242020608193013 22.975622015581802 27.599899472229204 55-59 26.5890149613415 23.677076011647756 22.231147705592928 27.50276132141781 60-64 26.56768998490186 23.11021640664318 23.014594866633114 27.30749874182184 65-69 26.242063891968154 23.762974906782222 23.02227149047667 26.97268971077295 70-74 26.830131445904954 23.286147623862487 22.30030333670374 27.583417593528818 75-79 26.368839588714987 22.975231727700958 22.711847236995393 27.944081446588665 80-84 26.523042528326812 23.708144911335808 22.585234490117372 27.183578070220012 85-89 26.52791878172589 22.86294416243655 23.233502538071065 27.375634517766496 90-94 26.988000813504172 23.215375228798045 22.437461866992066 27.359162090705713 95-99 26.942425936277246 23.258295645103917 22.47065399664617 27.328624421972663 100-104 27.24083583303676 23.47857033911231 22.20245055671361 27.07814327113732 105-109 27.646490826853686 22.767698327997156 22.0511256797276 27.534685165421557 110-114 27.132532573289904 23.513843648208468 22.38904723127036 26.96457654723127 115-119 27.489431059950082 23.2618550399837 22.304283604135893 26.94443029593032 120-124 27.932704562834566 22.926331888860567 22.16161101198063 26.979352536324242 125-129 27.377065904917362 23.00550907977964 22.510712099571517 27.106712915731485 130-134 28.672719853091206 23.63293205468272 21.980208120791676 25.714139971434403 135-139 28.820737868041025 23.12598867173547 22.069704546614275 25.98356891360923 140-144 29.35087450920402 23.048289225434704 22.00805670287084 25.592779562490435 145-149 29.200877148248257 23.438217145188432 22.168392064868172 25.19251364169514 150-151 29.067245119305856 24.052571136914636 21.42401429118285 25.456169452596654 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.0 21 1.5 22 0.5 23 1.5 24 2.5 25 2.0 26 2.0 27 2.0 28 2.5 29 5.5 30 9.0 31 11.0 32 12.0 33 14.5 34 15.0 35 24.0 36 45.0 37 52.5 38 53.0 39 63.5 40 79.0 41 101.5 42 106.5 43 117.5 44 128.5 45 132.0 46 143.0 47 135.5 48 142.5 49 149.5 50 134.0 51 117.5 52 116.5 53 118.0 54 107.5 55 102.0 56 96.0 57 102.5 58 107.5 59 106.5 60 113.0 61 106.5 62 101.0 63 108.5 64 106.5 65 85.5 66 73.0 67 72.0 68 74.5 69 73.0 70 70.5 71 64.5 72 57.0 73 52.5 74 39.5 75 27.5 76 22.0 77 21.0 78 18.5 79 10.0 80 4.5 81 6.5 82 5.0 83 2.5 84 2.5 85 1.0 86 1.0 87 1.5 88 1.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.065 35-39 0.25 40-44 0.13 45-49 0.3 50-54 0.525 55-59 0.41000000000000003 60-64 0.65 65-69 0.77 70-74 1.0999999999999999 75-79 1.2850000000000001 80-84 1.595 85-89 1.5 90-94 1.66 95-99 1.6049999999999998 100-104 1.6549999999999998 105-109 1.6150000000000002 110-114 1.76 115-119 1.8350000000000002 120-124 1.925 125-129 1.9800000000000002 130-134 1.9800000000000002 135-139 2.015 140-144 1.9449999999999998 145-149 1.955 150-151 2.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.65 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.9625000000000004 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138-139 7.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGCT 10 0.0069754543 143.9875 3 GCGTCGT 20 0.005773944 29.162025 135-139 CGTGTAG 25 4.8157125E-4 29.162025 140-144 >>END_MODULE Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra Read 990480 spots for SRR14458906.sra Written 990480 spots for SRR14458906.sra SRR ids: ['SRR14458906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i0ljgkpf SRR14458906.sra spots: 19809600 blocks: [[1, 990480], [990481, 1980960], [1980961, 2971440], [2971441, 3961920], [3961921, 4952400], [4952401, 5942880], [5942881, 6933360], [6933361, 7923840], [7923841, 8914320], [8914321, 9904800], [9904801, 10895280], [10895281, 11885760], [11885761, 12876240], [12876241, 13866720], [13866721, 14857200], [14857201, 15847680], [15847681, 16838160], [16838161, 17828640], [17828641, 18819120], [18819121, 19809600]] SRR14458906 file size 6710468 SRR14458906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458906 SRR14458906_1.fastq SRR14458906_2.fastq Input file: SRR14458906_1.fastq Paired file: SRR14458906_2.fastq trimmed: SRR14458906-trimmed-pair1.fastq, SRR14458906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:23:05 2024 >> started Sat Dec 7 19:23:29 2024 >> done (23.385s) 19809600 read pairs processed; of these: 2873 ( 0.01%) short read pairs filtered out after trimming by size control 6052 ( 0.03%) empty read pairs filtered out after trimming by size control 19800675 (99.95%) read pairs available; of these: 3081025 (15.56%) trimmed read pairs available after processing 16719650 (84.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 142 0.00% 19 133 0.00% 20 142 0.00% 21 119 0.00% 22 126 0.00% 23 125 0.00% 24 114 0.00% 25 115 0.00% 26 112 0.00% 27 101 0.00% 28 120 0.00% 29 151 0.00% 30 126 0.00% 31 116 0.00% 32 107 0.00% 33 96 0.00% 34 130 0.00% 35 99 0.00% 36 130 0.00% 37 100 0.00% 38 111 0.00% 39 105 0.00% 40 108 0.00% 41 121 0.00% 42 108 0.00% 43 104 0.00% 44 109 0.00% 45 129 0.00% 46 117 0.00% 47 127 0.00% 48 136 0.00% 49 141 0.00% 50 157 0.00% 51 159 0.00% 52 167 0.00% 53 188 0.00% 54 175 0.00% 55 184 0.00% 56 177 0.00% 57 195 0.00% 58 202 0.00% 59 192 0.00% 60 220 0.00% 61 276 0.00% 62 261 0.00% 63 293 0.00% 64 265 0.00% 65 300 0.00% 66 311 0.00% 67 347 0.00% 68 396 0.00% 69 441 0.00% 70 444 0.00% 71 610 0.00% 72 638 0.00% 73 683 0.00% 74 718 0.00% 75 743 0.00% 76 783 0.00% 77 806 0.00% 78 905 0.00% 79 1046 0.01% 80 1245 0.01% 81 1469 0.01% 82 1746 0.01% 83 2055 0.01% 84 2168 0.01% 85 2279 0.01% 86 2364 0.01% 87 2731 0.01% 88 3482 0.02% 89 5162 0.03% 90 6071 0.03% 91 5613 0.03% 92 5693 0.03% 93 6311 0.03% 94 6981 0.04% 95 7944 0.04% 96 8428 0.04% 97 8473 0.04% 98 9075 0.05% 99 10843 0.05% 100 12401 0.06% 101 12981 0.07% 102 13705 0.07% 103 15846 0.08% 104 17575 0.09% 105 17954 0.09% 106 19087 0.10% 107 19465 0.10% 108 19705 0.10% 109 21431 0.11% 110 24445 0.12% 111 25377 0.13% 112 28912 0.15% 113 31549 0.16% 114 35497 0.18% 115 38154 0.19% 116 38638 0.20% 117 38913 0.20% 118 39232 0.20% 119 40762 0.21% 120 42051 0.21% 121 45816 0.23% 122 50467 0.25% 123 54403 0.27% 124 59658 0.30% 125 62659 0.32% 126 64591 0.33% 127 64171 0.32% 128 64693 0.33% 129 63972 0.32% 130 66661 0.34% 131 68920 0.35% 132 72729 0.37% 133 79029 0.40% 134 83597 0.42% 135 86256 0.44% 136 87497 0.44% 137 87844 0.44% 138 86367 0.44% 139 85523 0.43% 140 85959 0.43% 141 86790 0.44% 142 91446 0.46% 143 95091 0.48% 144 98342 0.50% 145 102330 0.52% 146 101043 0.51% 147 103607 0.52% 148 105963 0.54% 149 103434 0.52% 150 102252 0.52% 151 16719650 84.44% 19800675 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=9 prefix-density=0.56 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=37.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=11 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=18.13 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458906 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:24:26 Started mapping on | Dec 07 19:24:26 Finished on | Dec 07 19:28:33 Mapping speed, Million of reads per hour | 288.59 Number of input reads | 19800675 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17758225 Uniquely mapped reads % | 89.68% Average mapped length | 290.82 Number of splices: Total | 17548306 Number of splices: Annotated (sjdb) | 16580738 Number of splices: GT/AG | 17312774 Number of splices: GC/AG | 199394 Number of splices: AT/AC | 6846 Number of splices: Non-canonical | 29292 Mismatch rate per base, % | 0.90% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302115 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 22787 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.08% % of reads unmapped: other | 1.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1740895 1740895 1740895 N_multimapping 302115 302115 302115 N_noFeature 524830 8882342 9081203 N_ambiguous 409820 49182 45913 UnstrandedReadsAssigned:16823575 PositiveStrandReadsAssigned:8826701 NegativeStrandReadsAssigned:8631109 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458906-trimmed-pair1.fastq SRR14458906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,800,675 reads, 18,252,599 reads pseudoaligned [quant] estimated average fragment length: 229.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR14458906.ke.tsv 35125 SRR14458906.se.tsv 88098 total ==> SRR14458906.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.441 0 0 PNS24247 1044 815.191 34.1358 2.9812 PNS24249 1928 1699.19 133.329 5.58629 PNS24246 1044 815.191 34.1358 2.9812 PNS24248 1044 815.191 34.1358 2.9812 PNS24244 1471 1242.19 28.263 1.61983 PNS24243 293 102.577 4 2.77618 KQK14069 1603 1374.19 9387.05 486.32 KQK14071 474 253.862 361.051 101.254 ==> SRR14458906.se.tsv <== BRADI_1g14170v3 10415 BRADI_1g53295v3 38 BRADI_1g59795v3 299 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1917 BRADI_1g74790v3 658 BRADI_1g09890v3 9 BRADI_1g77505v3 376 BRADI_1g48960v3 0 SRR14458906 completed mapping pipeline successfully