Starting /dee2/code/volunteer_pipeline.sh SRR14458907 current disk space = 1540076519424 free memory = 1602379604 SRR14458907 SRAfilesize 599a64744588d508499dd1c7cd963d81 SRR14458907.sra SRR14458907.sra file validated SRR14458907 is paired end SRR14458907 is conventional basespace SRR14458907 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07375 32.0 32.0 32.0 32.0 32.0 2 31.183 32.0 32.0 32.0 32.0 32.0 3 31.25825 32.0 32.0 32.0 32.0 32.0 4 31.37425 32.0 32.0 32.0 32.0 32.0 5 31.35675 32.0 32.0 32.0 32.0 32.0 6 34.40825 36.0 36.0 36.0 32.0 36.0 7 34.58525 36.0 36.0 36.0 32.0 36.0 8 34.4475 36.0 36.0 36.0 32.0 36.0 9 34.4615 36.0 36.0 36.0 32.0 36.0 10-14 34.51995000000001 36.0 36.0 36.0 32.0 36.0 15-19 34.5529 36.0 36.0 36.0 32.0 36.0 20-24 34.47595 36.0 36.0 36.0 32.0 36.0 25-29 34.28375 36.0 36.0 36.0 32.0 36.0 30-34 34.10455 36.0 36.0 36.0 32.0 36.0 35-39 34.018299999999996 36.0 36.0 36.0 32.0 36.0 40-44 33.904900000000005 36.0 36.0 36.0 32.0 36.0 45-49 33.916199999999996 36.0 36.0 36.0 32.0 36.0 50-54 33.8036 36.0 36.0 36.0 30.0 36.0 55-59 33.54365 36.0 36.0 36.0 25.8 36.0 60-64 33.3544 36.0 36.0 36.0 23.4 36.0 65-69 33.326350000000005 36.0 36.0 36.0 23.4 36.0 70-74 33.053 36.0 33.6 36.0 21.0 36.0 75-79 32.936350000000004 36.0 32.0 36.0 21.0 36.0 80-84 32.8507 36.0 32.0 36.0 21.0 36.0 85-89 32.891949999999994 36.0 32.0 36.0 22.2 36.0 90-94 32.799 36.0 32.0 36.0 16.8 36.0 95-99 32.56400000000001 36.0 32.0 36.0 15.4 36.0 100-104 32.5305 36.0 32.0 36.0 15.4 36.0 105-109 32.48395000000001 36.0 32.0 36.0 14.0 36.0 110-114 32.450950000000006 36.0 32.0 36.0 14.0 36.0 115-119 32.3521 36.0 32.0 36.0 14.0 36.0 120-124 32.1631 36.0 32.0 36.0 14.0 36.0 125-129 31.96305 36.0 32.0 36.0 14.0 36.0 130-134 31.953300000000002 36.0 32.0 36.0 14.0 36.0 135-139 31.71385 36.0 32.0 36.0 14.0 36.0 140-144 31.3311 36.0 29.0 36.0 14.0 36.0 145-149 30.78945 36.0 27.0 36.0 14.0 36.0 150-151 28.725125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 5.0 21 4.0 22 12.0 23 20.0 24 39.0 25 49.0 26 65.0 27 95.0 28 139.0 29 161.0 30 243.0 31 257.0 32 362.0 33 537.0 34 952.0 35 1055.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.35 10.9 11.75 52.0 2 21.675 17.974999999999998 32.625 27.725 3 21.9 21.55 21.85 34.699999999999996 4 27.575 24.725 17.125 30.575000000000003 5 27.474999999999998 28.499999999999996 20.95 23.075000000000003 6 26.065162907268167 32.08020050125313 19.423558897243108 22.431077694235587 7 23.225 18.55 34.65 23.575 8 22.7 20.95 26.375 29.975 9 24.175 20.075000000000003 28.95 26.8 10-14 25.419999999999998 24.68 23.119999999999997 26.779999999999998 15-19 25.915 23.255 23.080000000000002 27.750000000000004 20-24 26.229999999999997 23.465 22.814999999999998 27.49 25-29 26.133920088013202 23.473521028154224 23.04345651847777 27.349102365354806 30-34 25.501375343835956 23.595898974743687 23.1807951987997 27.721930482620653 35-39 26.440864518711226 23.359015409245547 22.91374824894937 27.28637182309386 40-44 26.58354614190576 23.148565419858798 22.45756346702719 27.81032497120825 45-49 25.90681362725451 22.84068136272545 23.17635270541082 28.07615230460922 50-54 26.395354657856533 22.335686038944786 23.406917955648996 27.86204134754968 55-59 26.38784414021363 23.589589288400784 22.310816909884156 27.71174966150143 60-64 26.50197925539911 23.355213709475372 23.104675051360424 27.038131983765094 65-69 26.3020572002007 22.839939789262417 22.870045158053188 27.987957852483692 70-74 26.296815541758463 23.10735029040657 23.09733627077909 27.49849789705588 75-79 26.823529411764707 22.5531914893617 22.988735919899874 27.63454317897372 80-84 27.196317790674406 23.06383830298179 22.37842705623374 27.361416850110064 85-89 27.202241008453804 22.76024210894903 23.060377169726376 26.97713971287079 90-94 27.06906035905386 22.878431764764713 22.37335600340051 27.679151872780917 95-99 26.87037407481496 22.814562912582517 22.999599919983996 27.315463092618526 100-104 27.421855463865967 22.9057264316079 22.410602650662664 27.261815453863463 105-109 26.680336067213446 22.884576915383075 23.189637927585515 27.245449089817964 110-114 27.825565113022606 22.934586917383477 22.104420884176832 27.135427085417085 115-119 27.240448089617924 23.084616923384676 22.349469893978796 27.325465093018604 120-124 27.282728272827285 23.54235423542354 21.902190219021904 27.27272727272727 125-129 27.487748774877485 23.27732773277328 22.037203720372037 27.197719771977198 130-134 27.571378568928445 23.316165808290414 21.951097554877744 27.161358067903397 135-139 27.821391069553474 23.91119555977799 21.476073803690184 26.79133956697835 140-144 27.855 23.18 21.73 27.235 145-149 27.544999999999998 23.385 21.855 27.215 150-151 27.3 23.5875 21.8625 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 1.0 27 1.0 28 2.5 29 3.0 30 4.0 31 7.0 32 8.0 33 12.0 34 14.5 35 17.5 36 33.5 37 43.0 38 47.0 39 65.5 40 76.0 41 96.0 42 123.0 43 125.5 44 136.5 45 146.0 46 158.0 47 161.5 48 154.0 49 143.0 50 133.5 51 123.0 52 104.5 53 102.0 54 106.0 55 106.5 56 98.0 57 101.5 58 102.0 59 97.0 60 100.5 61 99.5 62 100.5 63 97.5 64 92.0 65 93.5 66 92.0 67 77.5 68 66.0 69 72.0 70 73.0 71 59.5 72 52.0 73 52.0 74 47.5 75 40.0 76 34.5 77 26.0 78 15.5 79 12.5 80 10.5 81 8.0 82 5.0 83 2.5 84 2.0 85 1.5 86 1.0 87 1.5 88 2.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.025 35-39 0.06 40-44 0.145 45-49 0.2 50-54 0.11499999999999999 55-59 0.295 60-64 0.215 65-69 0.35000000000000003 70-74 0.13999999999999999 75-79 0.125 80-84 0.06 85-89 0.045 90-94 0.015 95-99 0.02 100-104 0.025 105-109 0.02 110-114 0.02 115-119 0.02 120-124 0.01 125-129 0.01 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6306760847628659 1.25 3 0.10090817356205853 0.3 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.025 112-113 1.0625 0.0 0.0 0.0 0.025 114-115 1.45 0.0 0.0 0.0 0.025 116-117 1.8625 0.0 0.0 0.0 0.025 118-119 2.1375 0.0 0.0 0.0 0.025 120-121 2.3375 0.0 0.0 0.0 0.025 122-123 2.6500000000000004 0.0 0.0 0.0 0.025 124-125 3.2125 0.0 0.0 0.0 0.025 126-127 3.6875 0.0 0.0 0.0 0.025 128-129 4.175 0.0 0.0 0.0 0.025 130-131 4.699999999999999 0.0 0.0 0.0 0.025 132-133 5.237500000000001 0.0 0.0 0.0 0.025 134-135 5.975 0.0 0.0 0.0 0.025 136-137 6.8125 0.0 0.0 0.0 0.025 138-139 7.55 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCAG 10 0.006830828 145.0 9 >>END_MODULE SRR14458907 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.06975 32.0 32.0 32.0 32.0 32.0 2 30.65475 32.0 32.0 32.0 32.0 32.0 3 30.66925 32.0 32.0 32.0 32.0 32.0 4 30.759 32.0 32.0 32.0 32.0 32.0 5 30.751 32.0 32.0 32.0 32.0 32.0 6 34.0085 36.0 36.0 36.0 32.0 36.0 7 34.09875 36.0 36.0 36.0 32.0 36.0 8 34.03275 36.0 36.0 36.0 32.0 36.0 9 33.86325 36.0 36.0 36.0 32.0 36.0 10-14 33.94304999999999 36.0 36.0 36.0 32.0 36.0 15-19 33.957049999999995 36.0 36.0 36.0 32.0 36.0 20-24 33.8215 36.0 36.0 36.0 31.0 36.0 25-29 33.76145 36.0 36.0 36.0 29.0 36.0 30-34 33.6572 36.0 36.0 36.0 29.0 36.0 35-39 33.61944999999999 36.0 36.0 36.0 27.0 36.0 40-44 33.56135 36.0 36.0 36.0 25.8 36.0 45-49 33.45635 36.0 36.0 36.0 23.2 36.0 50-54 33.28505 36.0 36.0 36.0 19.4 36.0 55-59 33.2063 36.0 36.0 36.0 22.2 36.0 60-64 32.82764999999999 36.0 36.0 36.0 14.0 36.0 65-69 32.56365 36.0 32.0 36.0 14.0 36.0 70-74 32.23074999999999 36.0 32.8 36.0 14.0 36.0 75-79 32.019200000000005 36.0 32.0 36.0 14.0 36.0 80-84 31.786449999999995 36.0 32.0 36.0 14.0 36.0 85-89 31.86115 36.0 32.0 36.0 14.0 36.0 90-94 31.6021 36.0 32.0 36.0 14.0 36.0 95-99 31.5212 36.0 32.0 36.0 14.0 36.0 100-104 31.424 36.0 32.0 36.0 14.0 36.0 105-109 31.40655 36.0 32.0 36.0 14.0 36.0 110-114 31.10115 36.0 32.0 36.0 14.0 36.0 115-119 30.83145 36.0 30.0 36.0 14.0 36.0 120-124 30.81895 36.0 30.0 36.0 14.0 36.0 125-129 30.357 35.2 28.0 36.0 14.0 36.0 130-134 29.808299999999996 34.4 27.0 36.0 14.0 36.0 135-139 29.223450000000003 32.0 27.0 36.0 14.0 36.0 140-144 29.3042 32.8 27.0 36.0 14.0 36.0 145-149 29.396949999999997 32.0 27.0 36.0 14.0 36.0 150-151 26.416625 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 8.0 11 5.0 12 7.0 13 8.0 14 8.0 15 10.0 16 9.0 17 9.0 18 19.0 19 11.0 20 10.0 21 23.0 22 33.0 23 28.0 24 52.0 25 66.0 26 110.0 27 103.0 28 172.0 29 185.0 30 251.0 31 286.0 32 391.0 33 570.0 34 886.0 35 737.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.956239059764943 10.72768192048012 11.10277569392348 53.21330332583146 2 22.400000000000002 17.95 33.875 25.775 3 22.3 19.275000000000002 22.1 36.325 4 27.825 23.075000000000003 17.825 31.275 5 29.825000000000003 26.525 19.725 23.925 6 25.900000000000002 31.075000000000003 18.65 24.375 7 24.25 18.35 32.7 24.7 8 23.3 21.2 26.625 28.875 9 23.05 19.7 30.175 27.075 10-14 25.424999999999997 24.959999999999997 22.755 26.86 15-19 25.629999999999995 23.54 23.015 27.815 20-24 25.85 23.990000000000002 23.26 26.900000000000002 25-29 26.71633581679084 23.761188059402972 22.72613630681534 26.796339816990848 30-34 25.619090499774877 23.74305868227525 23.347841312721997 27.290009505227875 35-39 26.08695652173913 23.998196754157483 22.124824684431978 27.79002203967141 40-44 25.8434277705476 23.465812393632994 22.865151666833516 27.825608168985884 45-49 26.06732554056088 23.37831736316661 22.80138463853911 27.752972457733406 50-54 26.344113061409246 23.064929839561437 23.074988683800232 27.515968415229093 55-59 26.532663316582916 23.457286432160803 22.668341708542712 27.341708542713565 60-64 25.910808767951625 23.834719072814313 23.03854875283447 27.215923406399593 65-69 26.72148514352015 23.45255511274782 22.64036725016395 27.185592493568077 70-74 26.397814097050045 23.599655922683805 22.709102868997622 27.29342711126853 75-79 26.636248415716096 23.44233206590621 22.271229404309253 27.65019011406844 80-84 26.05816737126267 23.81704273417206 23.24657464473081 26.878215249834465 85-89 26.820956256358087 23.270600203458798 22.863682604272633 27.044760935910478 90-94 27.258813325850724 23.167185347686342 22.804958930666803 26.769042395796134 95-99 26.764151424058696 23.044785244815817 23.126305599429358 27.064757731696133 100-104 27.042742017749667 23.089870447822094 22.6767316127716 27.190655921656635 105-109 26.49921027156468 23.105925510775972 22.96326489020227 27.431599327457075 110-114 27.33732045187344 23.161069365639218 22.343198895874867 27.158411286612484 115-119 27.17680803114116 23.37123540258144 22.31100184388445 27.14095472239295 120-124 26.970613877634754 23.503769424073027 22.001128262987844 27.524488435304374 125-129 27.78462803123716 22.996300863131935 22.256473489519113 26.962597616111793 130-134 27.717586649550707 23.501925545571247 21.709884467265724 27.070603337612326 135-139 28.538390379278443 23.537876451845 22.109158186864015 25.814574982012537 140-144 29.02381441182509 23.73742557996305 21.643399712584685 25.595360295627177 145-149 29.193821522040338 23.85179863498743 21.152563247293067 25.80181659567917 150-151 28.576932956588745 24.608271256100693 21.230413562805033 25.584382224505525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.5 19 1.5 20 0.5 21 1.0 22 1.5 23 2.0 24 1.0 25 2.0 26 4.0 27 5.5 28 6.5 29 7.5 30 8.5 31 9.0 32 8.5 33 12.5 34 21.5 35 29.5 36 33.0 37 37.5 38 45.5 39 69.0 40 84.5 41 94.5 42 111.0 43 127.0 44 153.0 45 163.5 46 154.5 47 138.0 48 143.0 49 146.5 50 128.5 51 123.5 52 120.0 53 110.5 54 106.0 55 103.5 56 94.0 57 93.5 58 97.5 59 88.5 60 94.5 61 105.0 62 97.0 63 94.5 64 99.5 65 89.5 66 91.5 67 86.0 68 76.5 69 77.5 70 69.5 71 58.0 72 50.0 73 42.5 74 39.0 75 35.0 76 24.5 77 25.5 78 19.0 79 12.0 80 8.0 81 3.0 82 2.0 83 1.0 84 1.0 85 2.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.055 35-39 0.18 40-44 0.11 45-49 0.335 50-54 0.585 55-59 0.5 60-64 0.775 65-69 0.885 70-74 1.185 75-79 1.375 80-84 1.8350000000000002 85-89 1.7000000000000002 90-94 1.9949999999999999 95-99 1.865 100-104 1.97 105-109 1.865 110-114 2.185 115-119 2.3800000000000003 120-124 2.505 125-129 2.68 130-134 2.625 135-139 2.71 140-144 2.58 145-149 2.565 150-151 2.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6811301715438951 1.35 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.550000000000001 0.0 0.0 0.0 0.0 132-133 5.074999999999999 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.550000000000001 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086295 spots for SRR14458907.sra Written 1086295 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra Read 1086294 spots for SRR14458907.sra Written 1086294 spots for SRR14458907.sra SRR ids: ['SRR14458907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1ri_d7nj SRR14458907.sra spots: 21725881 blocks: [[1, 1086294], [1086295, 2172588], [2172589, 3258882], [3258883, 4345176], [4345177, 5431470], [5431471, 6517764], [6517765, 7604058], [7604059, 8690352], [8690353, 9776646], [9776647, 10862940], [10862941, 11949234], [11949235, 13035528], [13035529, 14121822], [14121823, 15208116], [15208117, 16294410], [16294411, 17380704], [17380705, 18466998], [18466999, 19553292], [19553293, 20639586], [20639587, 21725881]] SRR14458907 file size 7361704 SRR14458907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458907 SRR14458907_1.fastq SRR14458907_2.fastq Input file: SRR14458907_1.fastq Paired file: SRR14458907_2.fastq trimmed: SRR14458907-trimmed-pair1.fastq, SRR14458907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:34:04 2024 >> started Sat Dec 7 19:34:30 2024 >> done (25.737s) 21725881 read pairs processed; of these: 4685 ( 0.02%) short read pairs filtered out after trimming by size control 2759 ( 0.01%) empty read pairs filtered out after trimming by size control 21718437 (99.97%) read pairs available; of these: 3257911 (15.00%) trimmed read pairs available after processing 18460526 (85.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 213 0.00% 19 235 0.00% 20 180 0.00% 21 174 0.00% 22 166 0.00% 23 215 0.00% 24 203 0.00% 25 179 0.00% 26 157 0.00% 27 164 0.00% 28 184 0.00% 29 177 0.00% 30 139 0.00% 31 152 0.00% 32 163 0.00% 33 156 0.00% 34 208 0.00% 35 139 0.00% 36 141 0.00% 37 125 0.00% 38 136 0.00% 39 130 0.00% 40 123 0.00% 41 147 0.00% 42 151 0.00% 43 147 0.00% 44 115 0.00% 45 124 0.00% 46 125 0.00% 47 148 0.00% 48 149 0.00% 49 172 0.00% 50 174 0.00% 51 151 0.00% 52 151 0.00% 53 186 0.00% 54 199 0.00% 55 174 0.00% 56 201 0.00% 57 213 0.00% 58 222 0.00% 59 244 0.00% 60 280 0.00% 61 265 0.00% 62 270 0.00% 63 290 0.00% 64 276 0.00% 65 337 0.00% 66 329 0.00% 67 335 0.00% 68 390 0.00% 69 458 0.00% 70 498 0.00% 71 581 0.00% 72 658 0.00% 73 745 0.00% 74 796 0.00% 75 801 0.00% 76 899 0.00% 77 948 0.00% 78 1080 0.00% 79 1178 0.01% 80 1436 0.01% 81 1684 0.01% 82 2044 0.01% 83 2286 0.01% 84 2492 0.01% 85 2629 0.01% 86 2762 0.01% 87 3188 0.01% 88 4095 0.02% 89 5764 0.03% 90 6916 0.03% 91 6491 0.03% 92 6344 0.03% 93 7053 0.03% 94 7911 0.04% 95 9120 0.04% 96 9525 0.04% 97 9479 0.04% 98 10480 0.05% 99 12430 0.06% 100 13920 0.06% 101 14551 0.07% 102 15015 0.07% 103 17283 0.08% 104 19022 0.09% 105 19705 0.09% 106 20866 0.10% 107 21160 0.10% 108 21659 0.10% 109 23815 0.11% 110 26216 0.12% 111 27658 0.13% 112 30823 0.14% 113 34377 0.16% 114 38043 0.18% 115 40384 0.19% 116 41653 0.19% 117 41708 0.19% 118 41916 0.19% 119 43799 0.20% 120 45627 0.21% 121 48633 0.22% 122 53575 0.25% 123 58191 0.27% 124 62375 0.29% 125 65773 0.30% 126 67323 0.31% 127 68044 0.31% 128 68026 0.31% 129 68478 0.32% 130 70998 0.33% 131 73007 0.34% 132 76209 0.35% 133 82867 0.38% 134 87756 0.40% 135 90087 0.41% 136 91187 0.42% 137 91162 0.42% 138 91283 0.42% 139 90801 0.42% 140 90296 0.42% 141 90926 0.42% 142 95346 0.44% 143 98654 0.45% 144 101665 0.47% 145 105279 0.48% 146 105055 0.48% 147 106589 0.49% 148 111507 0.51% 149 106248 0.49% 150 108776 0.50% 151 18460526 85.00% 21718437 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=10 prefix-density=0.51 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=38.52 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=TGCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=7 prefix-density=0.55 prefix-fanout=3.3 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.53 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=GCCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR14458907 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:35:23 Started mapping on | Dec 07 19:35:23 Finished on | Dec 07 19:38:59 Mapping speed, Million of reads per hour | 361.97 Number of input reads | 21718437 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19670158 Uniquely mapped reads % | 90.57% Average mapped length | 291.66 Number of splices: Total | 19633810 Number of splices: Annotated (sjdb) | 18539748 Number of splices: GT/AG | 19370925 Number of splices: GC/AG | 221985 Number of splices: AT/AC | 7924 Number of splices: Non-canonical | 32976 Mismatch rate per base, % | 0.71% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 325092 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 34742 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.12% % of reads unmapped: other | 1.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1723725 1723725 1723725 N_multimapping 325092 325092 325092 N_noFeature 558849 9873711 10007190 N_ambiguous 449641 54173 52190 UnstrandedReadsAssigned:18661668 PositiveStrandReadsAssigned:9742274 NegativeStrandReadsAssigned:9610778 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458907-trimmed-pair1.fastq SRR14458907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,718,437 reads, 19,966,475 reads pseudoaligned [quant] estimated average fragment length: 242.794 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 SRR14458907.ke.tsv 35125 SRR14458907.se.tsv 88098 total ==> SRR14458907.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.548 0 0 PNS24247 1044 802.206 26.0517 2.0994 PNS24249 1928 1686.21 133.837 5.13113 PNS24246 1044 802.206 26.0517 2.0994 PNS24248 1044 802.206 26.0517 2.0994 PNS24244 1471 1229.21 37.0076 1.94631 PNS24243 293 101.937 0 0 KQK14069 1603 1361.21 6724.14 319.344 KQK14071 474 247.071 171.202 44.7953 ==> SRR14458907.se.tsv <== BRADI_1g14170v3 7434 BRADI_1g53295v3 70 BRADI_1g59795v3 303 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 2413 BRADI_1g74790v3 631 BRADI_1g09890v3 13 BRADI_1g77505v3 425 BRADI_1g48960v3 0 SRR14458907 completed mapping pipeline successfully