Starting /dee2/code/volunteer_pipeline.sh SRR14458908 current disk space = 1539985289216 free memory = 1601707620 SRR14458908 SRAfilesize edcf9bd1486b670eaae3a055c9c203e6 SRR14458908.sra SRR14458908.sra file validated SRR14458908 is paired end SRR14458908 is conventional basespace SRR14458908 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458908_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.122 32.0 32.0 32.0 32.0 32.0 2 31.1035 32.0 32.0 32.0 32.0 32.0 3 31.1435 32.0 32.0 32.0 32.0 32.0 4 31.26875 32.0 32.0 32.0 32.0 32.0 5 31.37225 32.0 32.0 32.0 32.0 32.0 6 34.297 36.0 36.0 36.0 32.0 36.0 7 34.51425 36.0 36.0 36.0 32.0 36.0 8 34.60575 36.0 36.0 36.0 32.0 36.0 9 34.55675 36.0 36.0 36.0 32.0 36.0 10-14 34.4573 36.0 36.0 36.0 32.0 36.0 15-19 34.4695 36.0 36.0 36.0 32.0 36.0 20-24 34.406400000000005 36.0 36.0 36.0 32.0 36.0 25-29 34.2316 36.0 36.0 36.0 32.0 36.0 30-34 34.078500000000005 36.0 36.0 36.0 32.0 36.0 35-39 33.9718 36.0 36.0 36.0 32.0 36.0 40-44 33.8914 36.0 36.0 36.0 32.0 36.0 45-49 33.80705 36.0 36.0 36.0 32.0 36.0 50-54 33.717200000000005 36.0 36.0 36.0 30.0 36.0 55-59 33.51515 36.0 36.0 36.0 25.8 36.0 60-64 33.37075 36.0 36.0 36.0 24.6 36.0 65-69 33.21085000000001 36.0 36.0 36.0 22.2 36.0 70-74 33.08365 36.0 33.6 36.0 23.4 36.0 75-79 32.92595 36.0 32.0 36.0 23.4 36.0 80-84 32.849500000000006 36.0 32.0 36.0 19.6 36.0 85-89 32.850199999999994 36.0 32.0 36.0 19.6 36.0 90-94 32.809999999999995 36.0 32.0 36.0 19.4 36.0 95-99 32.598400000000005 36.0 32.0 36.0 18.2 36.0 100-104 32.57365 36.0 32.0 36.0 14.0 36.0 105-109 32.472300000000004 36.0 32.0 36.0 14.0 36.0 110-114 32.41760000000001 36.0 32.0 36.0 14.0 36.0 115-119 32.27175 36.0 32.0 36.0 14.0 36.0 120-124 32.2024 36.0 32.0 36.0 14.0 36.0 125-129 31.963600000000003 36.0 32.0 36.0 14.0 36.0 130-134 31.9421 36.0 32.0 36.0 14.0 36.0 135-139 31.7661 36.0 32.0 36.0 14.0 36.0 140-144 31.275599999999997 36.0 29.0 36.0 14.0 36.0 145-149 30.87425 35.2 27.0 36.0 14.0 36.0 150-151 28.789875000000002 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 4.0 21 13.0 22 15.0 23 20.0 24 35.0 25 51.0 26 77.0 27 73.0 28 114.0 29 170.0 30 224.0 31 311.0 32 364.0 33 558.0 34 950.0 35 1018.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.0 12.525 12.75 48.725 2 21.75 18.175 29.95 30.125 3 22.400000000000002 20.275000000000002 23.275000000000002 34.050000000000004 4 26.700000000000003 23.674999999999997 17.875 31.75 5 28.425 28.299999999999997 20.474999999999998 22.8 6 26.68172690763052 31.275100401606426 19.026104417670684 23.01706827309237 7 24.375 18.775 34.699999999999996 22.15 8 23.3 21.125 26.674999999999997 28.9 9 22.875 20.025000000000002 29.299999999999997 27.800000000000004 10-14 25.840000000000003 25.240000000000002 22.425 26.495 15-19 25.619999999999997 23.715 22.96 27.705000000000002 20-24 26.11 23.93 23.205000000000002 26.755000000000003 25-29 26.467940382114634 23.662098629588876 23.362008602580776 26.507952385715715 30-34 26.330798479087452 23.734240544326596 23.05383229937963 26.881128677206323 35-39 26.166166166166168 23.553553553553552 22.867867867867865 27.41241241241241 40-44 26.13881232773741 23.833625657729893 23.061889250814332 26.965672763718366 45-49 26.797713368769433 23.503159161568547 22.169290943736836 27.529836525925184 50-54 26.365640974240755 23.774681768066554 22.952791420266614 26.90688583742608 55-59 26.313676286072774 23.166875784190715 23.357590966122963 27.161856963613552 60-64 26.66098380384095 23.266308980594694 22.80499423356566 27.2677129819987 65-69 26.703175241157556 23.40233118971061 22.930064308681672 26.964429260450164 70-74 26.733814391661653 22.89035878933654 23.08077771096412 27.295049108037684 75-79 26.081507845004765 23.730512807659533 22.642738984410247 27.545240362925462 80-84 27.077492991589907 23.598317981577893 22.3468161794153 26.977372847416902 85-89 27.153576788394197 22.661330665332667 22.73136568284142 27.453726863431715 90-94 26.721680420105027 22.570642660665165 23.045761440360092 27.66191547886972 95-99 26.680336067213446 23.579715943188635 22.189437887577515 27.550510102020404 100-104 27.25681420355089 23.005751437859466 22.655663915978995 27.081770442610654 105-109 26.790358071614325 22.894578915783157 22.729545909181837 27.58551710342068 110-114 27.339568849097184 23.428199869954483 22.192767468614015 27.03946381233432 115-119 26.771692923230805 23.680920230057513 22.545636409102276 27.001750437609402 120-124 27.541885471367845 22.885721430357588 22.310577644411104 27.261815453863463 125-129 27.595519103820763 24.274854970994202 21.629325865173037 26.500300060012 130-134 27.33273327332733 23.717371737173718 21.797179717971797 27.15271527152715 135-139 27.817781778177817 23.337333733373335 21.407140714071407 27.437743774377438 140-144 28.14281428142814 23.7023702370237 21.137113711371136 27.017701770177016 145-149 27.894999999999996 24.545 21.325 26.235000000000003 150-151 27.800000000000004 24.4875 20.375 27.3375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 0.5 26 0.5 27 0.5 28 0.5 29 4.0 30 9.0 31 11.0 32 9.5 33 11.0 34 18.0 35 23.5 36 30.0 37 39.5 38 51.5 39 68.5 40 79.0 41 93.0 42 111.5 43 125.0 44 140.5 45 138.5 46 141.5 47 153.5 48 154.5 49 150.5 50 133.0 51 121.0 52 112.5 53 114.5 54 114.5 55 106.0 56 109.0 57 108.0 58 122.0 59 122.0 60 105.0 61 101.5 62 98.0 63 93.0 64 87.5 65 88.5 66 86.0 67 77.5 68 70.0 69 63.0 70 60.5 71 58.0 72 49.0 73 43.5 74 41.0 75 34.5 76 27.5 77 20.0 78 17.5 79 15.0 80 10.5 81 6.0 82 3.5 83 2.5 84 1.0 85 2.0 86 1.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.03 30-34 0.06 35-39 0.1 40-44 0.22499999999999998 45-49 0.29 50-54 0.22999999999999998 55-59 0.375 60-64 0.28500000000000003 65-69 0.48 70-74 0.22 75-79 0.255 80-84 0.12 85-89 0.05 90-94 0.025 95-99 0.02 100-104 0.025 105-109 0.02 110-114 0.034999999999999996 115-119 0.025 120-124 0.025 125-129 0.02 130-134 0.01 135-139 0.01 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.5544354838709677 1.0999999999999999 3 0.12600806451612903 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 5.05 0.0 0.0 0.0 0.0 130-131 5.8125 0.0 0.0 0.0 0.0 132-133 6.550000000000001 0.0 0.0 0.0 0.0 134-135 7.35 0.0 0.0 0.0 0.0 136-137 8.2875 0.0 0.0 0.0 0.0 138-139 9.149999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458908 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458908_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92525 32.0 32.0 32.0 32.0 32.0 2 30.40525 32.0 32.0 32.0 32.0 32.0 3 30.44925 32.0 32.0 32.0 32.0 32.0 4 30.60475 32.0 32.0 32.0 32.0 32.0 5 30.527 32.0 32.0 32.0 32.0 32.0 6 33.7985 36.0 36.0 36.0 32.0 36.0 7 34.0165 36.0 36.0 36.0 32.0 36.0 8 33.97625 36.0 36.0 36.0 32.0 36.0 9 33.8325 36.0 36.0 36.0 32.0 36.0 10-14 33.771249999999995 36.0 36.0 36.0 29.8 36.0 15-19 33.66425 36.0 36.0 36.0 27.8 36.0 20-24 33.63545 36.0 36.0 36.0 27.8 36.0 25-29 33.55355 36.0 36.0 36.0 25.6 36.0 30-34 33.5297 36.0 36.0 36.0 24.6 36.0 35-39 33.31575 36.0 36.0 36.0 19.2 36.0 40-44 33.353899999999996 36.0 36.0 36.0 20.8 36.0 45-49 33.2903 36.0 36.0 36.0 18.2 36.0 50-54 33.07925 36.0 36.0 36.0 15.4 36.0 55-59 32.9147 36.0 36.0 36.0 14.0 36.0 60-64 32.70375 36.0 36.0 36.0 14.0 36.0 65-69 32.359449999999995 36.0 32.0 36.0 14.0 36.0 70-74 31.9447 36.0 32.0 36.0 14.0 36.0 75-79 31.73295 36.0 32.0 36.0 14.0 36.0 80-84 31.597749999999998 36.0 32.0 36.0 14.0 36.0 85-89 31.59035 36.0 32.0 36.0 14.0 36.0 90-94 31.296699999999998 36.0 32.0 36.0 14.0 36.0 95-99 31.288 36.0 32.0 36.0 14.0 36.0 100-104 31.20785 36.0 32.0 36.0 14.0 36.0 105-109 31.05945 36.0 32.0 36.0 14.0 36.0 110-114 31.000400000000003 36.0 32.0 36.0 14.0 36.0 115-119 30.651400000000002 36.0 28.0 36.0 14.0 36.0 120-124 30.614750000000004 36.0 30.0 36.0 14.0 36.0 125-129 30.2212 35.2 27.0 36.0 14.0 36.0 130-134 29.713150000000002 33.6 27.0 36.0 14.0 36.0 135-139 29.07255 32.0 27.0 36.0 14.0 36.0 140-144 29.0465 32.0 27.0 36.0 14.0 36.0 145-149 29.177300000000002 32.0 27.0 36.0 14.0 36.0 150-151 26.156625 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 4.0 9 6.0 10 8.0 11 8.0 12 3.0 13 10.0 14 8.0 15 10.0 16 13.0 17 13.0 18 12.0 19 12.0 20 15.0 21 30.0 22 40.0 23 41.0 24 46.0 25 69.0 26 99.0 27 123.0 28 163.0 29 193.0 30 249.0 31 331.0 32 400.0 33 558.0 34 877.0 35 659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.55 11.450000000000001 10.549999999999999 51.449999999999996 2 23.125 16.775000000000002 31.25 28.849999999999998 3 23.3 19.425 22.6 34.675 4 26.974999999999998 21.85 18.975 32.2 5 30.425 25.55 20.25 23.775 6 26.75 30.4 19.5 23.35 7 23.549999999999997 21.05 32.7 22.7 8 23.674999999999997 22.125 25.575 28.625 9 23.799999999999997 21.175 28.125 26.900000000000002 10-14 25.64 25.290000000000003 22.81 26.26 15-19 26.22 24.015 22.02 27.744999999999997 20-24 25.755 23.72 22.61 27.915 25-29 26.471323566178306 23.43617180859043 22.71113555677784 27.38136906845342 30-34 26.054752014413694 23.66748410990441 22.576447625243983 27.70131625043792 35-39 25.47789875068988 24.238623250213237 22.81872459986955 27.46475339922733 40-44 26.709412412963985 23.31813855632921 22.34133146320693 27.631117567499874 45-49 26.238891399307125 24.054827534267208 22.407993171662397 27.298287894763266 50-54 26.482293083471863 23.202861316810235 22.60843282454284 27.706412775175053 55-59 26.1360201511335 23.1536523929471 23.259445843828715 27.450881612090676 60-64 26.494345718901453 23.349151857835217 22.718093699515347 27.43840872374798 65-69 26.76241529280874 23.030241731566704 23.20724183270962 27.00010114291494 70-74 26.508959845677442 23.33113356007919 22.72704198182649 27.432864612416875 75-79 26.525320317266626 23.41366687004271 22.717103925157616 27.343908887533047 80-84 26.52280379553107 23.584328129782676 22.4211815120906 27.471686562595654 85-89 26.62658582564834 23.798848524991083 22.097111122433382 27.477454526927193 90-94 26.94546568627451 22.983047385620914 22.778799019607842 27.29268790849673 95-99 26.37110351512678 23.075353298301106 23.202897811336157 27.350645375235956 100-104 27.204043085405072 23.44683240594211 22.349277655827247 26.999846852825566 105-109 26.977811782708493 23.14205559806172 22.983932670237184 26.896199948992606 110-114 27.25227528377135 23.463544329686062 22.793741691379488 26.490438695163103 115-119 27.227114478804015 23.02375588777391 22.496416137620315 27.25271349580176 120-124 27.957981040225466 23.438380732769666 22.116320778888035 26.487317448116833 125-129 27.597352624288135 23.646811348827665 22.235903750448927 26.519932276435277 130-134 27.664375833418813 23.36137039696379 22.08944507128936 26.884808698328033 135-139 27.94170472622774 24.621542566839434 21.511777082157334 25.92497562477549 140-144 28.31214109926169 24.28219852337982 21.96472518457752 25.440935192780966 145-149 28.932526661197706 24.512920426579164 21.78527481542248 24.769278096800658 150-151 29.408746953956648 24.137488777735026 21.328716172887006 25.125048095421317 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.5 15 1.5 16 1.0 17 1.0 18 1.5 19 0.5 20 1.0 21 1.5 22 3.0 23 4.0 24 4.0 25 4.0 26 4.0 27 5.0 28 6.0 29 7.0 30 8.5 31 9.0 32 11.5 33 17.5 34 18.5 35 17.0 36 25.0 37 35.5 38 47.0 39 63.5 40 78.0 41 95.5 42 113.0 43 121.5 44 124.0 45 126.0 46 145.0 47 156.5 48 153.0 49 154.5 50 142.0 51 124.0 52 115.0 53 106.0 54 93.0 55 103.5 56 118.5 57 106.5 58 109.5 59 124.5 60 113.5 61 100.5 62 104.5 63 105.5 64 94.5 65 87.0 66 85.0 67 74.0 68 68.0 69 71.0 70 63.5 71 49.0 72 47.5 73 52.0 74 39.0 75 27.0 76 26.5 77 24.0 78 19.5 79 11.0 80 3.5 81 3.0 82 3.5 83 3.5 84 3.5 85 2.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.095 35-39 0.345 40-44 0.185 45-49 0.415 50-54 0.745 55-59 0.75 60-64 0.96 65-69 1.13 70-74 1.505 75-79 1.66 80-84 1.9900000000000002 85-89 1.865 90-94 2.08 95-99 1.9949999999999999 100-104 2.0549999999999997 105-109 1.975 110-114 2.21 115-119 2.34 120-124 2.4250000000000003 125-129 2.545 130-134 2.5100000000000002 135-139 2.565 140-144 2.48 145-149 2.48 150-151 2.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.5875000000000004 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.6 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.699999999999999 0.0 0.0 0.0 0.0 130-131 5.4 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.762499999999999 0.0 0.0 0.0 0.0 136-137 7.575 0.0 0.0 0.0 0.0 138-139 8.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACAGC 10 0.0069754543 143.9875 5 >>END_MODULE Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090161 spots for SRR14458908.sra Written 1090161 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra Read 1090158 spots for SRR14458908.sra Written 1090158 spots for SRR14458908.sra SRR ids: ['SRR14458908.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2z3_8dr3 SRR14458908.sra spots: 21803163 blocks: [[1, 1090158], [1090159, 2180316], [2180317, 3270474], [3270475, 4360632], [4360633, 5450790], [5450791, 6540948], [6540949, 7631106], [7631107, 8721264], [8721265, 9811422], [9811423, 10901580], [10901581, 11991738], [11991739, 13081896], [13081897, 14172054], [14172055, 15262212], [15262213, 16352370], [16352371, 17442528], [17442529, 18532686], [18532687, 19622844], [19622845, 20713002], [20713003, 21803163]] SRR14458908 file size 7387968 SRR14458908 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458908 SRR14458908_1.fastq SRR14458908_2.fastq Input file: SRR14458908_1.fastq Paired file: SRR14458908_2.fastq trimmed: SRR14458908-trimmed-pair1.fastq, SRR14458908-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:38:27 2024 >> started Sat Dec 7 19:38:53 2024 >> done (26.301s) 21803163 read pairs processed; of these: 2721 ( 0.01%) short read pairs filtered out after trimming by size control 7237 ( 0.03%) empty read pairs filtered out after trimming by size control 21793205 (99.95%) read pairs available; of these: 3530361 (16.20%) trimmed read pairs available after processing 18262844 (83.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 137 0.00% 19 112 0.00% 20 147 0.00% 21 131 0.00% 22 134 0.00% 23 116 0.00% 24 128 0.00% 25 106 0.00% 26 115 0.00% 27 99 0.00% 28 112 0.00% 29 152 0.00% 30 121 0.00% 31 101 0.00% 32 110 0.00% 33 103 0.00% 34 127 0.00% 35 96 0.00% 36 126 0.00% 37 88 0.00% 38 111 0.00% 39 96 0.00% 40 104 0.00% 41 111 0.00% 42 102 0.00% 43 92 0.00% 44 120 0.00% 45 121 0.00% 46 125 0.00% 47 125 0.00% 48 149 0.00% 49 157 0.00% 50 148 0.00% 51 164 0.00% 52 164 0.00% 53 149 0.00% 54 155 0.00% 55 179 0.00% 56 152 0.00% 57 186 0.00% 58 238 0.00% 59 227 0.00% 60 278 0.00% 61 275 0.00% 62 291 0.00% 63 338 0.00% 64 356 0.00% 65 352 0.00% 66 357 0.00% 67 387 0.00% 68 461 0.00% 69 510 0.00% 70 611 0.00% 71 662 0.00% 72 810 0.00% 73 949 0.00% 74 887 0.00% 75 918 0.00% 76 949 0.00% 77 1132 0.01% 78 1227 0.01% 79 1541 0.01% 80 1629 0.01% 81 1887 0.01% 82 2345 0.01% 83 2701 0.01% 84 3021 0.01% 85 3194 0.01% 86 3524 0.02% 87 3730 0.02% 88 4683 0.02% 89 6407 0.03% 90 7718 0.04% 91 7341 0.03% 92 7600 0.03% 93 8282 0.04% 94 9347 0.04% 95 10482 0.05% 96 10823 0.05% 97 11048 0.05% 98 11575 0.05% 99 13537 0.06% 100 15789 0.07% 101 16484 0.08% 102 17312 0.08% 103 19845 0.09% 104 21516 0.10% 105 22364 0.10% 106 23557 0.11% 107 23546 0.11% 108 23712 0.11% 109 25842 0.12% 110 28501 0.13% 111 30146 0.14% 112 33938 0.16% 113 37350 0.17% 114 41652 0.19% 115 44678 0.21% 116 45377 0.21% 117 45009 0.21% 118 45280 0.21% 119 46196 0.21% 120 48809 0.22% 121 52283 0.24% 122 57638 0.26% 123 62329 0.29% 124 68056 0.31% 125 71846 0.33% 126 73374 0.34% 127 73084 0.34% 128 72873 0.33% 129 72832 0.33% 130 74937 0.34% 131 77198 0.35% 132 81491 0.37% 133 89813 0.41% 134 94315 0.43% 135 97492 0.45% 136 99634 0.46% 137 99646 0.46% 138 96900 0.44% 139 96520 0.44% 140 96915 0.44% 141 97505 0.45% 142 102362 0.47% 143 107492 0.49% 144 110834 0.51% 145 114778 0.53% 146 114180 0.52% 147 116617 0.54% 148 119844 0.55% 149 115725 0.53% 150 115244 0.53% 151 18262844 83.80% 21793205 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=10 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=22.01 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=10 prefix-density=0.52 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=18.75 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458908 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:39:59 Started mapping on | Dec 07 19:39:59 Finished on | Dec 07 19:44:04 Mapping speed, Million of reads per hour | 320.23 Number of input reads | 21793205 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18834107 Uniquely mapped reads % | 86.42% Average mapped length | 291.34 Number of splices: Total | 17899384 Number of splices: Annotated (sjdb) | 16922639 Number of splices: GT/AG | 17660830 Number of splices: GC/AG | 201744 Number of splices: AT/AC | 6532 Number of splices: Non-canonical | 30278 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483383 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 88639 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.12% % of reads unmapped: other | 4.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2476203 2476203 2476203 N_multimapping 483383 483383 483383 N_noFeature 602546 9445519 9643894 N_ambiguous 445766 52705 49966 UnstrandedReadsAssigned:17785795 PositiveStrandReadsAssigned:9335883 NegativeStrandReadsAssigned:9140247 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458908 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458908-trimmed-pair1.fastq SRR14458908-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,793,205 reads, 19,260,574 reads pseudoaligned [quant] estimated average fragment length: 231.017 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR14458908.ke.tsv 35125 SRR14458908.se.tsv 88098 total ==> SRR14458908.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.278 0 0 PNS24247 1044 813.983 25.8948 2.09557 PNS24249 1928 1697.98 134.239 5.20772 PNS24246 1044 813.983 25.8948 2.09557 PNS24248 1044 813.983 25.8948 2.09557 PNS24244 1471 1240.98 29.0769 1.54343 PNS24243 293 103.506 1 0.636409 KQK14069 1603 1372.98 4563.46 218.944 KQK14071 474 254.451 172.445 44.6428 ==> SRR14458908.se.tsv <== BRADI_1g14170v3 5185 BRADI_1g53295v3 47 BRADI_1g59795v3 325 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 2398 BRADI_1g74790v3 733 BRADI_1g09890v3 4 BRADI_1g77505v3 437 BRADI_1g48960v3 0 SRR14458908 completed mapping pipeline successfully