Starting /dee2/code/volunteer_pipeline.sh SRR14458909 current disk space = 1539947479040 free memory = 1599660852 SRR14458909 SRAfilesize 5b86c4bbe3b6914353dc3337f86cb338 SRR14458909.sra SRR14458909.sra file validated SRR14458909 is paired end SRR14458909 is conventional basespace SRR14458909 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458909_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17575 32.0 32.0 32.0 32.0 32.0 2 31.1615 32.0 32.0 32.0 32.0 32.0 3 31.201 32.0 32.0 32.0 32.0 32.0 4 31.31475 32.0 32.0 32.0 32.0 32.0 5 31.29525 32.0 32.0 32.0 32.0 32.0 6 34.17 36.0 36.0 36.0 32.0 36.0 7 34.52175 36.0 36.0 36.0 32.0 36.0 8 34.35225 36.0 36.0 36.0 32.0 36.0 9 34.56325 36.0 36.0 36.0 32.0 36.0 10-14 34.48805 36.0 36.0 36.0 32.0 36.0 15-19 34.489549999999994 36.0 36.0 36.0 32.0 36.0 20-24 34.397400000000005 36.0 36.0 36.0 32.0 36.0 25-29 34.209900000000005 36.0 36.0 36.0 32.0 36.0 30-34 34.05295 36.0 36.0 36.0 32.0 36.0 35-39 34.032 36.0 36.0 36.0 32.0 36.0 40-44 33.83299999999999 36.0 36.0 36.0 32.0 36.0 45-49 33.8168 36.0 36.0 36.0 32.0 36.0 50-54 33.7072 36.0 36.0 36.0 28.8 36.0 55-59 33.497550000000004 36.0 36.0 36.0 25.8 36.0 60-64 33.3566 36.0 36.0 36.0 25.8 36.0 65-69 33.09085 36.0 36.0 36.0 21.0 36.0 70-74 32.9182 36.0 32.8 36.0 20.8 36.0 75-79 32.78060000000001 36.0 32.0 36.0 19.6 36.0 80-84 32.7882 36.0 32.0 36.0 19.6 36.0 85-89 32.70395 36.0 32.0 36.0 18.2 36.0 90-94 32.7518 36.0 32.0 36.0 18.2 36.0 95-99 32.6415 36.0 32.0 36.0 18.2 36.0 100-104 32.55335000000001 36.0 32.0 36.0 15.4 36.0 105-109 32.4503 36.0 32.0 36.0 14.0 36.0 110-114 32.4675 36.0 32.0 36.0 14.0 36.0 115-119 32.1363 36.0 32.0 36.0 14.0 36.0 120-124 32.08819999999999 36.0 32.0 36.0 14.0 36.0 125-129 31.96825 36.0 32.0 36.0 14.0 36.0 130-134 31.94925 36.0 32.0 36.0 14.0 36.0 135-139 31.695249999999998 36.0 32.0 36.0 14.0 36.0 140-144 31.311950000000003 36.0 29.0 36.0 14.0 36.0 145-149 30.876150000000003 36.0 27.0 36.0 14.0 36.0 150-151 28.600625 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 3.0 21 12.0 22 8.0 23 23.0 24 37.0 25 48.0 26 63.0 27 100.0 28 144.0 29 176.0 30 210.0 31 290.0 32 386.0 33 576.0 34 976.0 35 947.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.925 12.45 13.125 49.5 2 21.55 17.349999999999998 30.75 30.349999999999998 3 21.725 20.549999999999997 23.724999999999998 34.0 4 25.8 23.375 19.8 31.025000000000002 5 28.7 26.974999999999998 20.7 23.625 6 26.621417797888387 31.02061337355455 19.78381096028155 22.574157868275517 7 21.95 20.25 34.775 23.025000000000002 8 22.275 21.95 27.150000000000002 28.625 9 22.975 20.549999999999997 29.275000000000002 27.200000000000003 10-14 25.180000000000003 25.445 23.200000000000003 26.174999999999997 15-19 25.979999999999997 23.805 23.630000000000003 26.584999999999997 20-24 26.14 23.765 22.82 27.275 25-29 26.101525381345336 23.360840210052515 22.9057264316079 27.631907976994246 30-34 25.71399989996499 23.87335567448607 23.023058070324616 27.389586355224328 35-39 25.992093279287392 23.81023870289746 23.409898413651604 26.787769604163543 40-44 26.224827171626092 23.2591924656848 23.224125839094278 27.291854523594832 45-49 26.447440974484937 22.993633766103564 22.983608200912325 27.57531705849917 50-54 26.218504232830735 23.39828683063668 23.06767519911837 27.315533737414217 55-59 26.728596535274917 23.384383630429326 22.821993472257095 27.06502636203866 60-64 25.921283529706695 23.645023815492607 23.25896214590123 27.174730508899476 65-69 26.79603840933085 23.296968478206225 22.779146347594388 27.127846764868536 70-74 26.56946740818678 23.54326369056566 22.471065684653542 27.416203216594013 75-79 26.393623420894325 23.360737918588327 22.959695207539603 27.28594345297774 80-84 26.803143300465486 23.45462735872666 22.949096551378947 26.793132789428903 85-89 26.620324064812962 23.339667933586718 22.729545909181837 27.310462092418486 90-94 26.655 23.935000000000002 22.605 26.805 95-99 26.715 23.415 22.89 26.979999999999997 100-104 27.134999999999998 24.154999999999998 22.295 26.415 105-109 26.784999999999997 23.755000000000003 23.31 26.150000000000002 110-114 26.939999999999998 23.93 21.990000000000002 27.139999999999997 115-119 27.155 23.31 22.61 26.924999999999997 120-124 27.025 23.57 22.56 26.845000000000002 125-129 27.395000000000003 23.59 22.66 26.355 130-134 27.375 23.45 22.855 26.32 135-139 27.975 23.985 22.035 26.005 140-144 27.155 24.135 22.314999999999998 26.395000000000003 145-149 26.895000000000003 24.075 22.085 26.945000000000004 150-151 26.6625 24.825 21.425 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 1.5 28 2.5 29 5.0 30 5.0 31 8.0 32 10.5 33 10.5 34 15.5 35 19.5 36 24.5 37 38.5 38 51.0 39 65.0 40 76.5 41 103.0 42 122.5 43 140.5 44 166.5 45 166.0 46 153.0 47 149.0 48 145.0 49 136.0 50 135.5 51 128.0 52 122.0 53 114.0 54 97.0 55 92.5 56 102.0 57 107.0 58 109.5 59 114.5 60 105.5 61 99.0 62 100.5 63 86.5 64 83.5 65 89.0 66 86.5 67 89.0 68 81.5 69 67.5 70 65.0 71 56.5 72 48.0 73 45.0 74 40.5 75 34.0 76 22.0 77 16.0 78 13.5 79 10.5 80 7.5 81 3.5 82 1.5 83 0.5 84 0.5 85 2.0 86 1.5 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5499999999999999 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.025 30-34 0.034999999999999996 35-39 0.08499999999999999 40-44 0.19 45-49 0.255 50-54 0.185 55-59 0.42500000000000004 60-64 0.27499999999999997 65-69 0.545 70-74 0.20500000000000002 75-79 0.26 80-84 0.105 85-89 0.02 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.4778672032193159 0.95 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.4625000000000004 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 4.1125 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.7 0.0 0.0 0.0 0.0 136-137 6.4625 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAAAA 10 0.006830828 145.0 145 >>END_MODULE SRR14458909 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458909_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.91725 32.0 32.0 32.0 32.0 32.0 2 30.39625 32.0 32.0 32.0 32.0 32.0 3 30.4395 32.0 32.0 32.0 32.0 32.0 4 30.68425 32.0 32.0 32.0 32.0 32.0 5 30.5385 32.0 32.0 32.0 32.0 32.0 6 33.86225 36.0 36.0 36.0 32.0 36.0 7 33.93075 36.0 36.0 36.0 32.0 36.0 8 33.88625 36.0 36.0 36.0 32.0 36.0 9 33.73325 36.0 36.0 36.0 32.0 36.0 10-14 33.90435 36.0 36.0 36.0 32.0 36.0 15-19 33.780800000000006 36.0 36.0 36.0 30.0 36.0 20-24 33.84615 36.0 36.0 36.0 30.0 36.0 25-29 33.6388 36.0 36.0 36.0 28.0 36.0 30-34 33.617399999999996 36.0 36.0 36.0 25.8 36.0 35-39 33.436449999999994 36.0 36.0 36.0 24.6 36.0 40-44 33.47095 36.0 36.0 36.0 25.8 36.0 45-49 33.316649999999996 36.0 36.0 36.0 20.8 36.0 50-54 33.08695 36.0 36.0 36.0 16.8 36.0 55-59 32.9035 36.0 36.0 36.0 15.4 36.0 60-64 32.6798 36.0 36.0 36.0 14.0 36.0 65-69 32.34115 36.0 32.0 36.0 14.0 36.0 70-74 31.947900000000004 36.0 32.0 36.0 14.0 36.0 75-79 31.842149999999997 36.0 32.0 36.0 14.0 36.0 80-84 31.479899999999997 36.0 32.0 36.0 14.0 36.0 85-89 31.648500000000002 36.0 32.0 36.0 14.0 36.0 90-94 31.3082 36.0 32.0 36.0 14.0 36.0 95-99 31.1615 36.0 32.0 36.0 14.0 36.0 100-104 31.13395 36.0 32.0 36.0 14.0 36.0 105-109 31.10985 36.0 32.0 36.0 14.0 36.0 110-114 30.8358 36.0 31.0 36.0 14.0 36.0 115-119 30.437600000000003 36.0 27.0 36.0 14.0 36.0 120-124 30.510699999999996 36.0 30.0 36.0 14.0 36.0 125-129 30.057100000000002 35.2 27.0 36.0 14.0 36.0 130-134 29.699350000000003 33.6 27.0 36.0 14.0 36.0 135-139 28.9159 32.0 27.0 36.0 14.0 36.0 140-144 28.869149999999998 32.0 25.8 36.0 14.0 36.0 145-149 28.9959 32.0 27.0 36.0 14.0 36.0 150-151 26.037375 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 4.0 10 12.0 11 9.0 12 7.0 13 6.0 14 4.0 15 18.0 16 7.0 17 15.0 18 15.0 19 9.0 20 15.0 21 20.0 22 30.0 23 44.0 24 59.0 25 65.0 26 84.0 27 135.0 28 163.0 29 212.0 30 251.0 31 365.0 32 403.0 33 565.0 34 839.0 35 643.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.468351263447584 11.983987990993244 12.584438328746561 50.96322241681261 2 23.355838959739934 16.729182295573892 30.057514378594647 29.857464366091524 3 23.599999999999998 18.675 23.599999999999998 34.125 4 27.075 21.05 18.8 33.074999999999996 5 29.425 25.224999999999998 21.224999999999998 24.125 6 25.124999999999996 31.624999999999996 20.1 23.150000000000002 7 22.825 19.650000000000002 33.85 23.674999999999997 8 22.675 21.875 26.6 28.849999999999998 9 23.0 20.599999999999998 28.799999999999997 27.6 10-14 25.619999999999997 25.330000000000002 22.62 26.43 15-19 25.335 24.05 23.345 27.27 20-24 25.415 24.62 23.315 26.650000000000002 25-29 25.72 24.085 22.82 27.375 30-34 25.904066423248135 23.833341669584353 23.228129845445906 27.034462061721605 35-39 26.21914509331728 23.64539434075858 23.414609672887817 26.720850893036324 40-44 26.499449284069286 23.5756483428457 23.195153699809754 26.729748673275257 45-49 25.706966698478073 24.0142649053192 23.185493997689488 27.093274398513234 50-54 25.79619441780649 23.610760611719577 23.600666229243426 26.992378741230503 55-59 26.17439516129032 24.032258064516128 22.721774193548384 27.07157258064516 60-64 26.037716770311945 23.550230041963697 23.16092825724253 27.251124930481822 65-69 26.46969389823637 23.986418001216297 22.567403202919117 26.976484897628218 70-74 25.969997457411647 23.71726417493008 23.152809560132216 27.15992880752606 75-79 25.905363418733764 23.21601385422503 23.50124789894565 27.37737482809555 80-84 25.966653027823238 24.007774140752865 22.882569558101473 27.143003273322424 85-89 26.519873301318075 23.32686216409523 22.923265556350263 27.229998978236438 90-94 26.454321999180664 23.837566571077424 23.07455960671856 26.63355182302335 95-99 26.205944038058217 24.267225945061128 22.691697785052945 26.835132231827714 100-104 26.98372069212655 23.76369407187468 22.4889935497082 26.76359168629057 105-109 25.838788870703766 23.7060147299509 23.204787234042552 27.25040916530278 110-114 26.764102564102565 23.774358974358975 22.77948717948718 26.682051282051283 115-119 26.95370703385912 23.161896932641422 23.038586035040847 26.845809998458613 120-124 27.095446359660407 23.750964754309237 22.598404939542064 26.55518394648829 125-129 27.284904688304994 24.14734672849047 22.40597630087584 26.1617722823287 130-134 27.459459459459463 23.38738738738739 22.63063063063063 26.522522522522525 135-139 28.406395048994327 23.130479628674575 22.87261474987107 25.59051057246003 140-144 28.43536014004016 24.10029346650878 22.231375173763066 25.232971219688 145-149 29.002523301920803 23.755085225809776 22.210206498789844 25.03218497347958 150-151 28.900914830563075 23.50212601468883 23.55366576472104 24.04329339002706 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 2.5 16 2.5 17 1.5 18 2.0 19 1.5 20 2.0 21 4.0 22 2.5 23 1.5 24 2.5 25 3.0 26 4.5 27 6.0 28 6.0 29 5.5 30 6.5 31 9.0 32 13.0 33 12.0 34 18.0 35 31.0 36 34.5 37 43.5 38 64.0 39 76.5 40 94.0 41 115.5 42 116.0 43 119.0 44 127.0 45 139.0 46 152.0 47 163.0 48 159.5 49 156.5 50 141.5 51 114.5 52 109.0 53 104.5 54 108.0 55 106.5 56 105.0 57 101.5 58 105.5 59 104.0 60 100.5 61 99.0 62 95.5 63 94.5 64 79.0 65 69.0 66 77.5 67 82.0 68 69.5 69 70.5 70 72.5 71 62.0 72 48.5 73 38.5 74 38.0 75 32.5 76 22.5 77 17.0 78 11.5 79 7.5 80 5.5 81 4.0 82 1.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.33999999999999997 40-44 0.13 45-49 0.455 50-54 0.935 55-59 0.8 60-64 1.105 65-69 1.34 70-74 1.675 75-79 1.8350000000000002 80-84 2.2399999999999998 85-89 2.13 90-94 2.36 95-99 2.255 100-104 2.33 105-109 2.2399999999999998 110-114 2.5 115-119 2.685 120-124 2.825 125-129 2.9499999999999997 130-134 2.875 135-139 3.05 140-144 2.8850000000000002 145-149 2.905 150-151 2.9875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.4124999999999996 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.9250000000000003 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.325 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417910 spots for SRR14458909.sra Written 1417910 spots for SRR14458909.sra Read 1417925 spots for SRR14458909.sra Written 1417925 spots for SRR14458909.sra SRR ids: ['SRR14458909.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sgnvqvfi SRR14458909.sra spots: 28358215 blocks: [[1, 1417910], [1417911, 2835820], [2835821, 4253730], [4253731, 5671640], [5671641, 7089550], [7089551, 8507460], [8507461, 9925370], [9925371, 11343280], [11343281, 12761190], [12761191, 14179100], [14179101, 15597010], [15597011, 17014920], [17014921, 18432830], [18432831, 19850740], [19850741, 21268650], [21268651, 22686560], [22686561, 24104470], [24104471, 25522380], [25522381, 26940290], [26940291, 28358215]] SRR14458909 file size 9615661 SRR14458909 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458909 SRR14458909_1.fastq SRR14458909_2.fastq Input file: SRR14458909_1.fastq Paired file: SRR14458909_2.fastq trimmed: SRR14458909-trimmed-pair1.fastq, SRR14458909-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:44:42 2024 >> started Sat Dec 7 19:45:16 2024 >> done (33.703s) 28358215 read pairs processed; of these: 4774 ( 0.02%) short read pairs filtered out after trimming by size control 8008 ( 0.03%) empty read pairs filtered out after trimming by size control 28345433 (99.95%) read pairs available; of these: 3957136 (13.96%) trimmed read pairs available after processing 24388297 (86.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 251 0.00% 19 210 0.00% 20 211 0.00% 21 194 0.00% 22 188 0.00% 23 190 0.00% 24 206 0.00% 25 142 0.00% 26 185 0.00% 27 189 0.00% 28 166 0.00% 29 221 0.00% 30 179 0.00% 31 166 0.00% 32 199 0.00% 33 173 0.00% 34 219 0.00% 35 168 0.00% 36 154 0.00% 37 156 0.00% 38 184 0.00% 39 149 0.00% 40 166 0.00% 41 205 0.00% 42 170 0.00% 43 196 0.00% 44 165 0.00% 45 166 0.00% 46 204 0.00% 47 201 0.00% 48 223 0.00% 49 227 0.00% 50 243 0.00% 51 191 0.00% 52 232 0.00% 53 249 0.00% 54 257 0.00% 55 233 0.00% 56 248 0.00% 57 274 0.00% 58 314 0.00% 59 285 0.00% 60 331 0.00% 61 346 0.00% 62 401 0.00% 63 448 0.00% 64 415 0.00% 65 408 0.00% 66 448 0.00% 67 485 0.00% 68 573 0.00% 69 544 0.00% 70 669 0.00% 71 832 0.00% 72 862 0.00% 73 994 0.00% 74 1029 0.00% 75 1079 0.00% 76 1119 0.00% 77 1219 0.00% 78 1326 0.00% 79 1561 0.01% 80 1836 0.01% 81 2084 0.01% 82 2513 0.01% 83 2863 0.01% 84 3060 0.01% 85 3205 0.01% 86 3437 0.01% 87 3832 0.01% 88 5115 0.02% 89 7273 0.03% 90 8834 0.03% 91 7786 0.03% 92 7635 0.03% 93 8373 0.03% 94 9292 0.03% 95 10792 0.04% 96 11243 0.04% 97 11148 0.04% 98 11936 0.04% 99 14553 0.05% 100 16535 0.06% 101 16871 0.06% 102 17367 0.06% 103 20042 0.07% 104 22207 0.08% 105 22707 0.08% 106 23729 0.08% 107 23790 0.08% 108 24224 0.09% 109 26344 0.09% 110 30004 0.11% 111 31187 0.11% 112 35435 0.13% 113 38953 0.14% 114 43724 0.15% 115 47075 0.17% 116 47437 0.17% 117 47512 0.17% 118 47899 0.17% 119 49973 0.18% 120 52127 0.18% 121 56135 0.20% 122 61950 0.22% 123 67783 0.24% 124 74011 0.26% 125 77855 0.27% 126 80310 0.28% 127 80529 0.28% 128 80764 0.28% 129 81360 0.29% 130 84231 0.30% 131 86644 0.31% 132 91599 0.32% 133 100986 0.36% 134 107887 0.38% 135 111256 0.39% 136 113420 0.40% 137 113006 0.40% 138 111253 0.39% 139 110528 0.39% 140 111614 0.39% 141 112664 0.40% 142 119319 0.42% 143 124620 0.44% 144 128814 0.45% 145 134541 0.47% 146 134742 0.48% 147 137627 0.49% 148 141506 0.50% 149 136380 0.48% 150 138212 0.49% 151 24388297 86.04% 28345433 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=7 prefix-density=0.56 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=16.99 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=9 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=23.09 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458909 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:46:11 Started mapping on | Dec 07 19:46:11 Finished on | Dec 07 19:51:37 Mapping speed, Million of reads per hour | 313.02 Number of input reads | 28345433 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 25732858 Uniquely mapped reads % | 90.78% Average mapped length | 292.44 Number of splices: Total | 25658574 Number of splices: Annotated (sjdb) | 24288990 Number of splices: GT/AG | 25318814 Number of splices: GC/AG | 289597 Number of splices: AT/AC | 9979 Number of splices: Non-canonical | 40184 Mismatch rate per base, % | 0.69% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406846 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 42628 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.95% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2206414 2206414 2206414 N_multimapping 406846 406846 406846 N_noFeature 705152 12837088 13128249 N_ambiguous 570506 52216 51267 UnstrandedReadsAssigned:24457200 PositiveStrandReadsAssigned:12843554 NegativeStrandReadsAssigned:12553342 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458909 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458909-trimmed-pair1.fastq SRR14458909-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,345,433 reads, 26,142,653 reads pseudoaligned [quant] estimated average fragment length: 237.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR14458909.ke.tsv 35125 SRR14458909.se.tsv 88098 total ==> SRR14458909.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.744 0 0 PNS24247 1044 807.555 31.2402 1.92076 PNS24249 1928 1691.55 186.036 5.4606 PNS24246 1044 807.555 31.2402 1.92076 PNS24248 1044 807.555 31.2402 1.92076 PNS24244 1471 1234.55 47.2434 1.90003 PNS24243 293 100.104 4 1.98399 KQK14069 1603 1366.55 8846.62 321.425 KQK14071 474 248.814 512.445 102.259 ==> SRR14458909.se.tsv <== BRADI_1g14170v3 10773 BRADI_1g53295v3 61 BRADI_1g59795v3 397 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 3081 BRADI_1g74790v3 965 BRADI_1g09890v3 17 BRADI_1g77505v3 599 BRADI_1g48960v3 0 SRR14458909 completed mapping pipeline successfully