Starting /dee2/code/volunteer_pipeline.sh SRR14458910 current disk space = 1539996946432 free memory = 1607452200 SRR14458910 SRAfilesize a60929b07faecece7353eeb3479fd775 SRR14458910.sra SRR14458910.sra file validated SRR14458910 is paired end SRR14458910 is conventional basespace SRR14458910 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09025 32.0 32.0 32.0 32.0 32.0 2 31.28075 32.0 32.0 32.0 32.0 32.0 3 31.198 32.0 32.0 32.0 32.0 32.0 4 31.27825 32.0 32.0 32.0 32.0 32.0 5 31.269 32.0 32.0 32.0 32.0 32.0 6 34.32425 36.0 36.0 36.0 32.0 36.0 7 34.5865 36.0 36.0 36.0 32.0 36.0 8 34.4175 36.0 36.0 36.0 32.0 36.0 9 34.4705 36.0 36.0 36.0 32.0 36.0 10-14 34.5013 36.0 36.0 36.0 32.0 36.0 15-19 34.477650000000004 36.0 36.0 36.0 32.0 36.0 20-24 34.463049999999996 36.0 36.0 36.0 32.0 36.0 25-29 34.26275 36.0 36.0 36.0 32.0 36.0 30-34 34.08434999999999 36.0 36.0 36.0 32.0 36.0 35-39 33.9838 36.0 36.0 36.0 32.0 36.0 40-44 33.88505 36.0 36.0 36.0 32.0 36.0 45-49 33.774350000000005 36.0 36.0 36.0 32.0 36.0 50-54 33.644999999999996 36.0 36.0 36.0 27.8 36.0 55-59 33.44755 36.0 36.0 36.0 25.8 36.0 60-64 33.34675 36.0 36.0 36.0 24.6 36.0 65-69 33.260450000000006 36.0 36.0 36.0 22.2 36.0 70-74 33.047799999999995 36.0 32.8 36.0 23.4 36.0 75-79 32.89425 36.0 32.0 36.0 21.0 36.0 80-84 32.88825 36.0 32.0 36.0 21.0 36.0 85-89 32.8296 36.0 32.0 36.0 21.0 36.0 90-94 32.866749999999996 36.0 32.0 36.0 19.6 36.0 95-99 32.691649999999996 36.0 32.0 36.0 16.8 36.0 100-104 32.59125 36.0 32.0 36.0 15.4 36.0 105-109 32.5106 36.0 32.0 36.0 15.4 36.0 110-114 32.593900000000005 36.0 32.0 36.0 15.4 36.0 115-119 32.38035 36.0 32.0 36.0 14.0 36.0 120-124 32.2716 36.0 32.0 36.0 14.0 36.0 125-129 32.02795 36.0 32.0 36.0 14.0 36.0 130-134 31.952800000000003 36.0 32.0 36.0 14.0 36.0 135-139 31.80215 36.0 32.0 36.0 14.0 36.0 140-144 31.347649999999998 36.0 29.0 36.0 14.0 36.0 145-149 30.853550000000002 36.0 27.0 36.0 14.0 36.0 150-151 28.742125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 1.0 20 4.0 21 4.0 22 18.0 23 24.0 24 39.0 25 54.0 26 68.0 27 99.0 28 121.0 29 157.0 30 192.0 31 266.0 32 412.0 33 530.0 34 979.0 35 1030.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.75 13.0 12.675 51.575 2 23.025000000000002 16.775000000000002 32.4 27.800000000000004 3 21.9 19.650000000000002 22.7 35.75 4 26.424999999999997 23.7 18.675 31.2 5 28.575 27.750000000000004 20.025000000000002 23.65 6 26.22703246916688 32.066448527561036 20.01006795872137 21.69645104455072 7 23.45 18.925 34.2 23.425 8 23.075000000000003 22.05 25.724999999999998 29.15 9 23.925 20.8 29.15 26.125 10-14 25.44 25.069999999999997 22.759999999999998 26.729999999999997 15-19 25.345000000000002 24.04 23.23 27.384999999999998 20-24 25.735000000000003 23.845 23.435 26.985 25-29 25.87405591957185 23.618266393237633 23.238133346671336 27.269544340519182 30-34 26.27839487641349 24.121885319723805 22.74592214550185 26.85379765836085 35-39 26.18141770124149 23.868642370845013 22.476972366840208 27.472967561073286 40-44 25.828611542897256 23.712580855438 22.980494409065837 27.478313192598907 45-49 26.430722891566266 24.01104417670683 22.610441767068274 26.947791164658636 50-54 26.240280912967144 23.99799347880612 22.93955354903436 26.822172059192372 55-59 26.566428643266622 23.116765563713166 22.810017097455496 27.506788695564723 60-64 26.200873362445414 23.405109672238115 22.817848717562615 27.576168247753852 65-69 26.343625648516593 23.492671132826274 23.230745982974867 26.932957235682263 70-74 26.685731487055993 23.479831426851295 23.113586193056392 26.720850893036324 75-79 26.47663973503287 23.636272394238972 23.159532292868974 26.727555577859185 80-84 26.456006810556364 23.396264209524766 22.980619960939457 27.167109018979417 85-89 26.616654163540886 23.305826456614152 23.15078769692423 26.926731682920728 90-94 27.245 23.549999999999997 22.675 26.529999999999998 95-99 26.99 23.015 22.925 27.07 100-104 27.155 23.415 22.79 26.640000000000004 105-109 26.39 23.724999999999998 22.814999999999998 27.07 110-114 27.125 22.735 23.015 27.125 115-119 26.765 23.93 22.96 26.345000000000002 120-124 27.1 23.24 23.044999999999998 26.615 125-129 26.895000000000003 23.580000000000002 22.535 26.99 130-134 27.900000000000002 23.65 22.085 26.365 135-139 26.784999999999997 23.735 22.695 26.784999999999997 140-144 27.139999999999997 24.52 22.03 26.31 145-149 28.215 24.240000000000002 21.285 26.26 150-151 25.9625 25.0375 21.55 27.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 1.0 25 1.0 26 2.0 27 2.0 28 2.0 29 2.5 30 5.0 31 7.0 32 11.5 33 14.0 34 11.5 35 19.5 36 33.0 37 46.5 38 57.5 39 70.0 40 85.5 41 106.0 42 118.5 43 134.0 44 143.5 45 136.0 46 133.5 47 134.5 48 143.0 49 152.5 50 144.0 51 129.0 52 111.5 53 107.0 54 116.0 55 118.5 56 126.0 57 126.5 58 122.0 59 116.0 60 102.5 61 92.0 62 97.0 63 94.5 64 80.5 65 74.5 66 77.5 67 82.0 68 80.0 69 66.0 70 54.0 71 56.0 72 51.5 73 45.0 74 42.5 75 31.0 76 19.0 77 19.0 78 15.0 79 9.0 80 8.0 81 4.5 82 2.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.675 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.034999999999999996 30-34 0.06999999999999999 35-39 0.12 40-44 0.28500000000000003 45-49 0.4 50-54 0.325 55-59 0.5700000000000001 60-64 0.385 65-69 0.735 70-74 0.33999999999999997 75-79 0.365 80-84 0.155 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.528834046839587 1.05 3 0.02518257365902795 0.075 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.6375 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.9625 0.0 0.0 0.0 0.0 128-129 4.425000000000001 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.3 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.9624999999999995 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458910 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89725 32.0 32.0 32.0 32.0 32.0 2 30.4735 32.0 32.0 32.0 32.0 32.0 3 30.53625 32.0 32.0 32.0 32.0 32.0 4 30.5095 32.0 32.0 32.0 32.0 32.0 5 30.69625 32.0 32.0 32.0 32.0 32.0 6 33.65375 36.0 36.0 36.0 21.0 36.0 7 33.864 36.0 36.0 36.0 32.0 36.0 8 33.75375 36.0 36.0 36.0 32.0 36.0 9 33.69625 36.0 36.0 36.0 32.0 36.0 10-14 33.7958 36.0 36.0 36.0 32.0 36.0 15-19 33.67825 36.0 36.0 36.0 28.8 36.0 20-24 33.69035 36.0 36.0 36.0 29.0 36.0 25-29 33.65005000000001 36.0 36.0 36.0 28.0 36.0 30-34 33.50285 36.0 36.0 36.0 23.4 36.0 35-39 33.23604999999999 36.0 36.0 36.0 18.2 36.0 40-44 33.394349999999996 36.0 36.0 36.0 22.2 36.0 45-49 33.2267 36.0 36.0 36.0 19.6 36.0 50-54 33.07395 36.0 36.0 36.0 16.8 36.0 55-59 32.8634 36.0 36.0 36.0 15.4 36.0 60-64 32.5644 36.0 36.0 36.0 14.0 36.0 65-69 32.1293 36.0 32.0 36.0 14.0 36.0 70-74 31.775599999999997 36.0 32.0 36.0 14.0 36.0 75-79 31.6453 36.0 32.0 36.0 14.0 36.0 80-84 31.44365 36.0 32.0 36.0 14.0 36.0 85-89 31.35555 36.0 32.0 36.0 14.0 36.0 90-94 31.142450000000004 36.0 32.0 36.0 14.0 36.0 95-99 31.070100000000004 36.0 32.0 36.0 14.0 36.0 100-104 30.985899999999997 36.0 32.0 36.0 14.0 36.0 105-109 30.911199999999997 36.0 32.0 36.0 14.0 36.0 110-114 30.801550000000002 36.0 31.0 36.0 14.0 36.0 115-119 30.35145 36.0 27.0 36.0 14.0 36.0 120-124 30.2937 36.0 27.0 36.0 14.0 36.0 125-129 29.910400000000003 36.0 27.0 36.0 14.0 36.0 130-134 29.43145 33.6 27.0 36.0 14.0 36.0 135-139 28.7478 32.0 27.0 36.0 14.0 36.0 140-144 28.7565 32.0 27.0 36.0 14.0 36.0 145-149 28.901699999999998 32.0 27.0 36.0 14.0 36.0 150-151 26.107374999999998 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 6.0 10 14.0 11 8.0 12 7.0 13 5.0 14 7.0 15 16.0 16 10.0 17 15.0 18 20.0 19 12.0 20 14.0 21 20.0 22 35.0 23 33.0 24 73.0 25 73.0 26 113.0 27 125.0 28 145.0 29 214.0 30 274.0 31 330.0 32 422.0 33 509.0 34 869.0 35 628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.6 11.175 10.549999999999999 53.675 2 23.35 16.900000000000002 32.2 27.55 3 23.425 18.425 23.925 34.225 4 28.525 23.0 17.525 30.95 5 29.325000000000003 28.050000000000004 19.775000000000002 22.85 6 26.25 31.724999999999998 19.525000000000002 22.5 7 24.375 17.974999999999998 34.725 22.925 8 22.425 20.925 26.85 29.799999999999997 9 24.349999999999998 20.424999999999997 27.975 27.250000000000004 10-14 25.845000000000002 25.09 22.675 26.39 15-19 25.935000000000002 24.19 22.665 27.21 20-24 25.474999999999998 23.880000000000003 23.11 27.534999999999997 25-29 25.96 24.060000000000002 23.01 26.97 30-34 25.93463790601071 24.368149742255145 22.551423852660026 27.14578849907412 35-39 25.927415301095806 24.680808283904696 22.479139439026845 26.912636975972653 40-44 25.992381716118686 23.53147554129912 23.27085004009623 27.205292702485966 45-49 25.989638348171624 23.303656757708367 23.25335747698808 27.453347417131933 50-54 26.44340051522958 23.821791180481892 22.98328029499419 26.75152800929434 55-59 26.803291100903536 23.76962293675231 22.40169602745949 27.025389934884657 60-64 26.106329113924048 23.559493670886074 23.11898734177215 27.21518987341772 65-69 25.733989148623294 23.862887277521423 23.33045991582577 27.072663658029512 70-74 26.33723892002038 23.082017320427916 23.097300050942433 27.483443708609272 75-79 26.221972521579247 23.356657643393433 23.183002196230657 27.238367638796667 80-84 26.25987888740634 23.894077799445757 22.51873139690034 27.32731191624756 85-89 26.379707916986934 24.058416602613374 23.054060978734306 26.507814501665383 90-94 26.97327852004111 23.55601233299075 22.58992805755396 26.880781089414185 95-99 26.726572528883185 23.861360718870348 22.618741976893453 26.793324775353017 100-104 27.365663207644097 23.420322613788144 22.310695571766157 26.9033186068016 105-109 27.364639466256097 23.571978444957658 22.566076469078777 26.49730561970747 110-114 26.54762517367365 23.97468224154788 22.698502547213504 26.779190037564966 115-119 26.794011357769747 23.835828600929272 22.194114610221995 27.17604543107899 120-124 27.65968450995604 23.284199637962246 22.77734678044996 26.278769071631757 125-129 27.9790597626082 23.573316747006686 21.976882807235786 26.47074068314933 130-134 27.704663212435232 23.259067357512954 22.601036269430054 26.435233160621763 135-139 28.99813316739266 23.288736776602363 22.085666874092514 25.627463181912468 140-144 28.425791761540054 24.16166425170772 21.983026288553095 25.429517698199135 145-149 29.23761710056415 24.817556027120748 21.411935200041405 24.532891672273692 150-151 28.943278943278944 24.825174825174827 21.56177156177156 24.669774669774668 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.5 18 4.5 19 4.0 20 3.0 21 3.0 22 3.0 23 4.5 24 4.0 25 3.5 26 4.0 27 5.5 28 8.5 29 7.0 30 7.0 31 7.5 32 10.0 33 12.0 34 19.5 35 34.0 36 40.5 37 54.5 38 64.5 39 72.5 40 86.0 41 101.0 42 113.0 43 128.0 44 142.5 45 135.0 46 144.5 47 145.5 48 133.5 49 147.0 50 131.5 51 117.5 52 119.0 53 107.5 54 105.0 55 104.0 56 100.0 57 96.0 58 116.0 59 121.5 60 103.5 61 96.5 62 92.0 63 92.5 64 93.0 65 86.0 66 72.0 67 72.5 68 79.0 69 70.0 70 57.0 71 56.5 72 57.0 73 45.5 74 36.5 75 30.0 76 21.0 77 14.0 78 13.5 79 12.0 80 6.0 81 3.0 82 3.0 83 2.5 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.095 35-39 0.53 40-44 0.24 45-49 0.5950000000000001 50-54 1.015 55-59 0.9450000000000001 60-64 1.25 65-69 1.395 70-74 1.8499999999999999 75-79 2.105 80-84 2.5700000000000003 85-89 2.4250000000000003 90-94 2.7 95-99 2.625 100-104 2.67 105-109 2.5749999999999997 110-114 2.835 115-119 3.15 120-124 3.325 125-129 3.535 130-134 3.5000000000000004 135-139 3.58 140-144 3.38 145-149 3.395 150-151 3.4750000000000005 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.6554071086463322 1.3 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.137499999999999 0.0 0.0 0.0 0.0 130-131 4.6375 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATG 10 0.0071167517 143.025 1 TCCATGT 10 0.0071167517 143.025 2 CGTCGTG 35 0.0033035462 20.956045 145 GCGTCGT 35 0.0033035462 20.956043 140-144 >>END_MODULE Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra Read 1508936 spots for SRR14458910.sra Written 1508936 spots for SRR14458910.sra SRR ids: ['SRR14458910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jt4r4f22 SRR14458910.sra spots: 30178720 blocks: [[1, 1508936], [1508937, 3017872], [3017873, 4526808], [4526809, 6035744], [6035745, 7544680], [7544681, 9053616], [9053617, 10562552], [10562553, 12071488], [12071489, 13580424], [13580425, 15089360], [15089361, 16598296], [16598297, 18107232], [18107233, 19616168], [19616169, 21125104], [21125105, 22634040], [22634041, 24142976], [24142977, 25651912], [25651913, 27160848], [27160849, 28669784], [28669785, 30178720]] SRR14458910 file size 10234349 SRR14458910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458910 SRR14458910_1.fastq SRR14458910_2.fastq Input file: SRR14458910_1.fastq Paired file: SRR14458910_2.fastq trimmed: SRR14458910-trimmed-pair1.fastq, SRR14458910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:53:07 2024 >> started Sat Dec 7 19:55:09 2024 >> done (121.945s) 30178720 read pairs processed; of these: 6242 ( 0.02%) short read pairs filtered out after trimming by size control 3224 ( 0.01%) empty read pairs filtered out after trimming by size control 30169254 (99.97%) read pairs available; of these: 4764969 (15.79%) trimmed read pairs available after processing 25404285 (84.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 265 0.00% 19 278 0.00% 20 282 0.00% 21 257 0.00% 22 248 0.00% 23 257 0.00% 24 238 0.00% 25 220 0.00% 26 247 0.00% 27 223 0.00% 28 227 0.00% 29 243 0.00% 30 243 0.00% 31 229 0.00% 32 220 0.00% 33 205 0.00% 34 307 0.00% 35 177 0.00% 36 208 0.00% 37 183 0.00% 38 231 0.00% 39 235 0.00% 40 188 0.00% 41 210 0.00% 42 212 0.00% 43 193 0.00% 44 211 0.00% 45 206 0.00% 46 204 0.00% 47 214 0.00% 48 221 0.00% 49 226 0.00% 50 243 0.00% 51 259 0.00% 52 246 0.00% 53 281 0.00% 54 264 0.00% 55 257 0.00% 56 273 0.00% 57 315 0.00% 58 346 0.00% 59 371 0.00% 60 370 0.00% 61 415 0.00% 62 472 0.00% 63 474 0.00% 64 504 0.00% 65 539 0.00% 66 523 0.00% 67 583 0.00% 68 635 0.00% 69 702 0.00% 70 781 0.00% 71 914 0.00% 72 1057 0.00% 73 1148 0.00% 74 1189 0.00% 75 1263 0.00% 76 1309 0.00% 77 1513 0.01% 78 1605 0.01% 79 1878 0.01% 80 2159 0.01% 81 2601 0.01% 82 3007 0.01% 83 3329 0.01% 84 3759 0.01% 85 3986 0.01% 86 4239 0.01% 87 4673 0.02% 88 6045 0.02% 89 8372 0.03% 90 10004 0.03% 91 9235 0.03% 92 9463 0.03% 93 10385 0.03% 94 11293 0.04% 95 13051 0.04% 96 13530 0.04% 97 13598 0.05% 98 14489 0.05% 99 17351 0.06% 100 19800 0.07% 101 20660 0.07% 102 21300 0.07% 103 24084 0.08% 104 27028 0.09% 105 27473 0.09% 106 29341 0.10% 107 29751 0.10% 108 30412 0.10% 109 33047 0.11% 110 36520 0.12% 111 39003 0.13% 112 43368 0.14% 113 48063 0.16% 114 53155 0.18% 115 56912 0.19% 116 57936 0.19% 117 58476 0.19% 118 59217 0.20% 119 61333 0.20% 120 64198 0.21% 121 69748 0.23% 122 76114 0.25% 123 82698 0.27% 124 89720 0.30% 125 94034 0.31% 126 97201 0.32% 127 97212 0.32% 128 98708 0.33% 129 98629 0.33% 130 103014 0.34% 131 106473 0.35% 132 111907 0.37% 133 122042 0.40% 134 128760 0.43% 135 132781 0.44% 136 135388 0.45% 137 135093 0.45% 138 133316 0.44% 139 134131 0.44% 140 135006 0.45% 141 135599 0.45% 142 142944 0.47% 143 149490 0.50% 144 152926 0.51% 145 158214 0.52% 146 158268 0.52% 147 161499 0.54% 148 166394 0.55% 149 160594 0.53% 150 163383 0.54% 151 25404285 84.21% 30169254 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=8 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=20.39 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=8 prefix-density=0.53 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=17.03 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458910 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:56:13 Started mapping on | Dec 07 19:56:13 Finished on | Dec 07 20:04:03 Mapping speed, Million of reads per hour | 231.08 Number of input reads | 30169254 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 26689364 Uniquely mapped reads % | 88.47% Average mapped length | 291.59 Number of splices: Total | 26339043 Number of splices: Annotated (sjdb) | 24904422 Number of splices: GT/AG | 25987920 Number of splices: GC/AG | 295950 Number of splices: AT/AC | 10411 Number of splices: Non-canonical | 44762 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 574970 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 87270 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.01% % of reads unmapped: other | 3.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2905647 2905647 2905647 N_multimapping 574970 574970 574970 N_noFeature 817924 13395899 13629311 N_ambiguous 594009 59920 58065 UnstrandedReadsAssigned:25277431 PositiveStrandReadsAssigned:13233545 NegativeStrandReadsAssigned:13001988 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458910-trimmed-pair1.fastq SRR14458910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,169,254 reads, 27,179,182 reads pseudoaligned [quant] estimated average fragment length: 232.837 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR14458910.ke.tsv 35125 SRR14458910.se.tsv 88098 total ==> SRR14458910.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.442 0 0 PNS24247 1044 812.163 38.6875 2.25629 PNS24249 1928 1696.16 178.515 4.98509 PNS24246 1044 812.163 38.6875 2.25629 PNS24248 1044 812.163 38.6875 2.25629 PNS24244 1471 1239.16 46.423 1.77448 PNS24243 293 103.488 6 2.74617 KQK14069 1603 1371.16 8220.42 283.97 KQK14071 474 253.625 416.511 77.786 ==> SRR14458910.se.tsv <== BRADI_1g14170v3 9800 BRADI_1g53295v3 49 BRADI_1g59795v3 390 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 3312 BRADI_1g74790v3 919 BRADI_1g09890v3 10 BRADI_1g77505v3 632 BRADI_1g48960v3 0 SRR14458910 completed mapping pipeline successfully