Starting /dee2/code/volunteer_pipeline.sh SRR14458911 current disk space = 1539944255488 free memory = 1461373104 SRR14458911 SRAfilesize 72fd22e901e1200cab2a4c4dc84400a5 SRR14458911.sra SRR14458911.sra file validated SRR14458911 is paired end SRR14458911 is conventional basespace SRR14458911 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458911_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08375 32.0 32.0 32.0 32.0 32.0 2 31.2045 32.0 32.0 32.0 32.0 32.0 3 31.3775 32.0 32.0 32.0 32.0 32.0 4 31.3285 32.0 32.0 32.0 32.0 32.0 5 31.265 32.0 32.0 32.0 32.0 32.0 6 34.181 36.0 36.0 36.0 32.0 36.0 7 34.40825 36.0 36.0 36.0 32.0 36.0 8 34.37425 36.0 36.0 36.0 32.0 36.0 9 34.627 36.0 36.0 36.0 32.0 36.0 10-14 34.5147 36.0 36.0 36.0 32.0 36.0 15-19 34.51805 36.0 36.0 36.0 32.0 36.0 20-24 34.4944 36.0 36.0 36.0 32.0 36.0 25-29 34.22879999999999 36.0 36.0 36.0 32.0 36.0 30-34 34.0649 36.0 36.0 36.0 32.0 36.0 35-39 34.071799999999996 36.0 36.0 36.0 32.0 36.0 40-44 33.9301 36.0 36.0 36.0 32.0 36.0 45-49 33.859950000000005 36.0 36.0 36.0 32.0 36.0 50-54 33.71285 36.0 36.0 36.0 30.0 36.0 55-59 33.50475 36.0 36.0 36.0 25.8 36.0 60-64 33.4437 36.0 36.0 36.0 24.6 36.0 65-69 33.268649999999994 36.0 36.0 36.0 21.0 36.0 70-74 33.0801 36.0 33.6 36.0 22.2 36.0 75-79 32.9423 36.0 32.0 36.0 22.2 36.0 80-84 32.8361 36.0 32.0 36.0 21.0 36.0 85-89 32.78915 36.0 32.0 36.0 19.6 36.0 90-94 32.74265 36.0 32.0 36.0 16.8 36.0 95-99 32.713350000000005 36.0 32.0 36.0 21.0 36.0 100-104 32.62179999999999 36.0 32.0 36.0 16.8 36.0 105-109 32.40894999999999 36.0 32.0 36.0 14.0 36.0 110-114 32.54715 36.0 32.0 36.0 15.4 36.0 115-119 32.295550000000006 36.0 32.0 36.0 14.0 36.0 120-124 32.2235 36.0 32.0 36.0 14.0 36.0 125-129 31.967750000000002 36.0 32.0 36.0 14.0 36.0 130-134 31.960950000000004 36.0 32.0 36.0 14.0 36.0 135-139 31.8205 36.0 32.0 36.0 14.0 36.0 140-144 31.235300000000002 36.0 29.0 36.0 14.0 36.0 145-149 30.922499999999996 36.0 27.0 36.0 14.0 36.0 150-151 28.76125 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 6.0 21 7.0 22 10.0 23 23.0 24 34.0 25 46.0 26 70.0 27 99.0 28 115.0 29 177.0 30 230.0 31 268.0 32 396.0 33 510.0 34 970.0 35 1036.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.025 10.8 14.000000000000002 51.175000000000004 2 21.4 18.3 36.675000000000004 23.625 3 23.125 23.175 25.674999999999997 28.025 4 27.85 27.474999999999998 16.6 28.075 5 28.9 29.775000000000002 19.85 21.475 6 23.37011033099298 33.500501504513544 19.7592778335005 23.37011033099298 7 21.349999999999998 16.725 38.4 23.525 8 20.95 20.474999999999998 26.825 31.75 9 23.225 20.0 28.65 28.125 10-14 25.295 25.09 23.035 26.58 15-19 25.014999999999997 24.255 23.575 27.155 20-24 25.665 23.765 23.945 26.625 25-29 25.59011802360472 24.12982596519304 23.919783956791356 26.36027205441088 30-34 26.001500375093773 23.625906476619154 23.755938984746187 26.616654163540886 35-39 25.91684594986741 23.86050933106519 23.58032721268825 26.642317506379147 40-44 25.292939409113668 23.675513269904858 24.02603905858788 27.00550826239359 45-49 25.913488045711997 23.783269009072228 23.567740965365143 26.735501979850635 50-54 26.188686807956312 23.693571822235583 23.3278220351721 26.789919334636004 55-59 26.150218252972756 23.711805729767697 23.109728563544227 27.02824745371532 60-64 26.383597353118105 23.621415680770003 23.395829155805092 26.599157810306796 65-69 26.261611850364048 23.519959829274416 23.344212904845595 26.874215415515945 70-74 26.12332815709062 23.558583379251615 23.483444372088364 26.834644091569405 75-79 26.389376096216488 23.73340015033826 23.37759959909797 26.49962415434728 80-84 26.006006006006004 24.194194194194193 23.253253253253252 26.546546546546544 85-89 26.68334167083542 23.51175587793897 23.33166583291646 26.473236618309155 90-94 26.58 23.32 23.445 26.655 95-99 26.490000000000002 22.925 23.935000000000002 26.650000000000002 100-104 26.906345317265863 23.861193059652983 23.296164808240412 25.93629681484074 105-109 26.83 23.765 22.89 26.515 110-114 26.97134856742837 23.936196809840492 23.03115155757788 26.061303065153258 115-119 26.71 23.985 22.82 26.484999999999996 120-124 26.595000000000002 24.085 22.755 26.565 125-129 27.165 24.075 22.34 26.419999999999998 130-134 26.86 23.665 22.645 26.83 135-139 27.146357317865892 24.451222561128056 22.30611530576529 26.09630481524076 140-144 26.955000000000002 24.185000000000002 21.94 26.919999999999998 145-149 27.245 24.625 21.705 26.424999999999997 150-151 26.575 24.275 21.762500000000003 27.3875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 0.0 25 0.0 26 1.0 27 3.5 28 5.0 29 4.0 30 7.0 31 8.5 32 8.0 33 13.5 34 23.5 35 30.5 36 38.0 37 48.5 38 56.5 39 69.5 40 91.5 41 98.0 42 114.0 43 139.0 44 147.0 45 159.0 46 154.0 47 139.5 48 146.0 49 155.5 50 152.5 51 139.5 52 129.5 53 118.0 54 106.0 55 116.0 56 110.5 57 100.0 58 110.0 59 118.0 60 107.0 61 98.0 62 95.0 63 78.5 64 77.5 65 81.5 66 86.0 67 83.0 68 69.5 69 58.5 70 52.5 71 51.0 72 44.0 73 33.0 74 27.0 75 25.5 76 20.0 77 15.5 78 10.0 79 4.5 80 3.0 81 4.5 82 4.0 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.3 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.025 35-39 0.065 40-44 0.15 45-49 0.245 50-54 0.20500000000000002 55-59 0.345 60-64 0.26 65-69 0.42500000000000004 70-74 0.185 75-79 0.22499999999999998 80-84 0.1 85-89 0.05 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6300403225806451 1.25 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.6000000000000001 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.8125 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 7.3875 0.0 0.0 0.0 0.0 136-137 8.225000000000001 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGCCC 10 0.006830828 145.0 1 >>END_MODULE SRR14458911 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458911_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01775 32.0 32.0 32.0 32.0 32.0 2 30.69575 32.0 32.0 32.0 32.0 32.0 3 30.677 32.0 32.0 32.0 32.0 32.0 4 30.65025 32.0 32.0 32.0 32.0 32.0 5 30.72375 32.0 32.0 32.0 32.0 32.0 6 33.86175 36.0 36.0 36.0 32.0 36.0 7 34.08575 36.0 36.0 36.0 32.0 36.0 8 34.061 36.0 36.0 36.0 32.0 36.0 9 33.928 36.0 36.0 36.0 32.0 36.0 10-14 33.91485 36.0 36.0 36.0 31.0 36.0 15-19 33.898199999999996 36.0 36.0 36.0 32.0 36.0 20-24 33.791399999999996 36.0 36.0 36.0 30.0 36.0 25-29 33.876400000000004 36.0 36.0 36.0 31.0 36.0 30-34 33.763949999999994 36.0 36.0 36.0 30.0 36.0 35-39 33.63269999999999 36.0 36.0 36.0 29.0 36.0 40-44 33.6206 36.0 36.0 36.0 28.8 36.0 45-49 33.48805 36.0 36.0 36.0 25.8 36.0 50-54 33.27345 36.0 36.0 36.0 23.4 36.0 55-59 33.19695 36.0 36.0 36.0 20.8 36.0 60-64 33.013 36.0 36.0 36.0 18.2 36.0 65-69 32.6882 36.0 33.6 36.0 15.4 36.0 70-74 32.286199999999994 36.0 32.8 36.0 14.0 36.0 75-79 32.126050000000006 36.0 32.0 36.0 14.0 36.0 80-84 31.885850000000005 36.0 32.0 36.0 14.0 36.0 85-89 31.949199999999998 36.0 32.0 36.0 14.0 36.0 90-94 31.5637 36.0 32.0 36.0 14.0 36.0 95-99 31.58465 36.0 32.0 36.0 14.0 36.0 100-104 31.54925 36.0 32.0 36.0 14.0 36.0 105-109 31.45015 36.0 32.0 36.0 14.0 36.0 110-114 31.159000000000002 36.0 31.0 36.0 14.0 36.0 115-119 30.835199999999997 36.0 31.0 36.0 14.0 36.0 120-124 30.757150000000003 36.0 31.0 36.0 14.0 36.0 125-129 30.372149999999998 35.2 27.0 36.0 14.0 36.0 130-134 29.822900000000004 34.4 27.0 36.0 14.0 36.0 135-139 29.222249999999995 32.0 27.0 36.0 14.0 36.0 140-144 29.21505 32.0 27.0 36.0 14.0 36.0 145-149 29.14905 32.0 27.0 36.0 14.0 36.0 150-151 26.275375 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 6.0 10 5.0 11 7.0 12 5.0 13 7.0 14 5.0 15 4.0 16 10.0 17 16.0 18 9.0 19 4.0 20 9.0 21 18.0 22 28.0 23 31.0 24 52.0 25 79.0 26 109.0 27 111.0 28 139.0 29 222.0 30 260.0 31 297.0 32 392.0 33 583.0 34 900.0 35 690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.267450587940957 11.43357518138604 12.05904428321241 53.239929947460595 2 23.355838959739934 18.12953238309577 36.30907726931733 22.20555138784696 3 24.125 21.625 22.85 31.4 4 27.425 26.35 17.2 29.025000000000002 5 29.475 29.075 19.275000000000002 22.175 6 23.525 33.475 20.275000000000002 22.725 7 20.8 16.0 39.725 23.474999999999998 8 22.575 19.075 26.1 32.25 9 23.0 19.85 29.049999999999997 28.1 10-14 24.525 24.959999999999997 23.585 26.93 15-19 25.66 23.95 23.73 26.66 20-24 25.074999999999996 24.585 23.47 26.87 25-29 25.124999999999996 24.18 23.605 27.089999999999996 30-34 25.471556511732622 23.97058087757042 23.34517436333617 27.212688247360784 35-39 25.40486337427927 24.16144397092003 23.83554775632991 26.598144898470792 40-44 25.66593230522732 24.058682155017024 23.377728820348487 26.89765671940717 45-49 25.110463948584055 24.593291825667805 23.363125125527215 26.933119100220924 50-54 25.776882397381012 23.681692268949885 23.48526819440947 27.056157139259636 55-59 25.798501081434534 23.69599114732659 23.70102107539862 26.80448669584025 60-64 25.72609923356192 24.253731343283583 23.154497781363453 26.865671641791046 65-69 26.1760549162124 24.05612759943469 22.960831819099536 26.80698566525338 70-74 26.16647246567709 23.785399462992046 22.954556968438116 27.09357110289275 75-79 25.90468456580216 23.52941176470588 23.52941176470588 27.036491904786075 80-84 26.177743824802647 23.758594346829643 23.45301757066463 26.610644257703083 85-89 26.072137152159534 23.874446761967747 23.38098387342931 26.672432212443404 90-94 26.189626153924618 24.20564084255623 23.03769062069669 26.567042382822457 95-99 26.454406520631686 23.856342333163525 23.107488537952115 26.581762608252674 100-104 26.40836094825389 23.98164669895488 23.053785368340556 26.556206984450675 105-109 26.450068747772065 24.224677903956817 22.45251311300097 26.872740235270154 110-114 26.333265222721703 24.31548835308541 22.328361258684104 27.022885165508786 115-119 26.548491213689225 24.212305958297044 22.736820533838824 26.502382294174907 120-124 26.716617058400903 24.13014471928564 23.196140819049575 25.95709740326388 125-129 27.3157434552281 24.59496991205061 21.951344957053955 26.137941675667335 130-134 26.886695455480158 24.501336623483446 22.552950853382686 26.059017067653713 135-139 27.1422693138566 24.88427116551795 22.065631107910708 25.90782841271474 140-144 28.487088659582117 24.8678063555624 21.921043174700962 24.724061810154527 145-149 28.644790222359163 24.834386073024188 22.020233143326656 24.500590561289993 150-151 28.46865364850976 24.08787255909558 22.186536485097637 25.25693730729702 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 2.5 18 2.5 19 1.5 20 1.5 21 2.0 22 1.5 23 2.0 24 4.5 25 4.0 26 1.5 27 4.5 28 9.0 29 5.5 30 4.0 31 11.5 32 17.0 33 18.5 34 24.5 35 35.5 36 35.0 37 38.5 38 57.5 39 77.5 40 94.0 41 117.5 42 137.0 43 122.5 44 125.0 45 145.0 46 149.5 47 159.0 48 158.5 49 153.0 50 145.5 51 141.0 52 136.0 53 111.5 54 101.5 55 107.5 56 103.5 57 91.5 58 95.0 59 100.0 60 93.5 61 95.0 62 94.0 63 91.0 64 89.5 65 84.5 66 75.5 67 75.5 68 69.0 69 57.5 70 66.5 71 60.5 72 40.5 73 37.0 74 30.5 75 21.5 76 17.5 77 13.5 78 11.5 79 6.0 80 1.5 81 2.0 82 2.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.065 35-39 0.27499999999999997 40-44 0.13999999999999999 45-49 0.42 50-54 0.7250000000000001 55-59 0.5950000000000001 60-64 0.84 65-69 0.9400000000000001 70-74 1.3050000000000002 75-79 1.485 80-84 1.825 85-89 1.7149999999999999 90-94 1.965 95-99 1.8499999999999999 100-104 1.925 105-109 1.815 110-114 2.12 115-119 2.405 120-124 2.5700000000000003 125-129 2.785 130-134 2.74 135-139 2.79 140-144 2.605 145-149 2.635 150-151 2.7 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.9875 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.725 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.887499999999999 0.0 0.0 0.0 0.0 138-139 8.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGAAG 10 0.0065179584 147.24359 145 TCGATCG 10 0.0070373793 143.5625 3 >>END_MODULE Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108029 spots for SRR14458911.sra Written 1108029 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra Read 1108018 spots for SRR14458911.sra Written 1108018 spots for SRR14458911.sra SRR ids: ['SRR14458911.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i8rt7fyw SRR14458911.sra spots: 22160371 blocks: [[1, 1108018], [1108019, 2216036], [2216037, 3324054], [3324055, 4432072], [4432073, 5540090], [5540091, 6648108], [6648109, 7756126], [7756127, 8864144], [8864145, 9972162], [9972163, 11080180], [11080181, 12188198], [12188199, 13296216], [13296217, 14404234], [14404235, 15512252], [15512253, 16620270], [16620271, 17728288], [17728289, 18836306], [18836307, 19944324], [19944325, 21052342], [21052343, 22160371]] SRR14458911 file size 7509363 SRR14458911 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458911 SRR14458911_1.fastq SRR14458911_2.fastq Input file: SRR14458911_1.fastq Paired file: SRR14458911_2.fastq trimmed: SRR14458911-trimmed-pair1.fastq, SRR14458911-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 19:49:14 2024 >> started Sat Dec 7 19:49:41 2024 >> done (26.954s) 22160371 read pairs processed; of these: 3742 ( 0.02%) short read pairs filtered out after trimming by size control 2278 ( 0.01%) empty read pairs filtered out after trimming by size control 22154351 (99.97%) read pairs available; of these: 3659309 (16.52%) trimmed read pairs available after processing 18495042 (83.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 184 0.00% 19 166 0.00% 20 155 0.00% 21 164 0.00% 22 149 0.00% 23 183 0.00% 24 140 0.00% 25 132 0.00% 26 140 0.00% 27 138 0.00% 28 134 0.00% 29 144 0.00% 30 146 0.00% 31 103 0.00% 32 165 0.00% 33 113 0.00% 34 308 0.00% 35 139 0.00% 36 106 0.00% 37 127 0.00% 38 138 0.00% 39 107 0.00% 40 108 0.00% 41 143 0.00% 42 123 0.00% 43 142 0.00% 44 101 0.00% 45 125 0.00% 46 148 0.00% 47 134 0.00% 48 160 0.00% 49 164 0.00% 50 162 0.00% 51 178 0.00% 52 143 0.00% 53 175 0.00% 54 178 0.00% 55 167 0.00% 56 185 0.00% 57 206 0.00% 58 238 0.00% 59 272 0.00% 60 315 0.00% 61 359 0.00% 62 337 0.00% 63 315 0.00% 64 339 0.00% 65 395 0.00% 66 389 0.00% 67 468 0.00% 68 518 0.00% 69 587 0.00% 70 697 0.00% 71 781 0.00% 72 872 0.00% 73 946 0.00% 74 943 0.00% 75 1060 0.00% 76 1044 0.00% 77 1194 0.01% 78 1425 0.01% 79 1653 0.01% 80 1884 0.01% 81 2220 0.01% 82 2485 0.01% 83 2836 0.01% 84 2992 0.01% 85 3290 0.01% 86 3763 0.02% 87 4163 0.02% 88 5247 0.02% 89 6828 0.03% 90 8224 0.04% 91 7858 0.04% 92 7924 0.04% 93 8630 0.04% 94 9464 0.04% 95 10755 0.05% 96 11533 0.05% 97 11900 0.05% 98 12908 0.06% 99 15362 0.07% 100 17117 0.08% 101 17723 0.08% 102 18293 0.08% 103 20516 0.09% 104 22187 0.10% 105 23092 0.10% 106 24775 0.11% 107 25809 0.12% 108 26467 0.12% 109 29087 0.13% 110 32094 0.14% 111 33307 0.15% 112 36282 0.16% 113 39448 0.18% 114 43088 0.19% 115 45711 0.21% 116 46675 0.21% 117 47751 0.22% 118 49014 0.22% 119 51022 0.23% 120 53749 0.24% 121 57022 0.26% 122 61934 0.28% 123 65173 0.29% 124 69448 0.31% 125 72313 0.33% 126 74044 0.33% 127 75178 0.34% 128 77161 0.35% 129 78080 0.35% 130 81471 0.37% 131 83336 0.38% 132 86690 0.39% 133 90942 0.41% 134 95237 0.43% 135 97329 0.44% 136 98874 0.45% 137 99195 0.45% 138 100189 0.45% 139 101170 0.46% 140 101927 0.46% 141 102907 0.46% 142 107266 0.48% 143 109547 0.49% 144 111352 0.50% 145 112890 0.51% 146 112454 0.51% 147 114930 0.52% 148 120783 0.55% 149 116376 0.53% 150 119448 0.54% 151 18495042 83.48% 22154351 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=14 prefix-density=0.52 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=20.58 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.6 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=11 prefix-density=0.51 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.31 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.7 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGG SRR14458911 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 19:51:22 Started mapping on | Dec 07 19:51:22 Finished on | Dec 07 19:54:54 Mapping speed, Million of reads per hour | 376.21 Number of input reads | 22154351 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19316478 Uniquely mapped reads % | 87.19% Average mapped length | 291.34 Number of splices: Total | 18799301 Number of splices: Annotated (sjdb) | 17777402 Number of splices: GT/AG | 18548955 Number of splices: GC/AG | 211512 Number of splices: AT/AC | 7180 Number of splices: Non-canonical | 31654 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510320 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 95857 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 4.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2327945 2327945 2327945 N_multimapping 510320 510320 510320 N_noFeature 671561 9761820 9867464 N_ambiguous 439320 42911 42329 UnstrandedReadsAssigned:18205597 PositiveStrandReadsAssigned:9511747 NegativeStrandReadsAssigned:9406685 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458911 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458911-trimmed-pair1.fastq SRR14458911-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,154,351 reads, 19,724,102 reads pseudoaligned [quant] estimated average fragment length: 232.813 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR14458911.ke.tsv 35125 SRR14458911.se.tsv 88098 total ==> SRR14458911.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.386 33.7848 3.08184 PNS24247 1044 812.187 15.0684 1.19209 PNS24249 1928 1696.19 137.373 5.20389 PNS24246 1044 812.187 15.0684 1.19209 PNS24248 1044 812.187 15.0684 1.19209 PNS24244 1471 1239.19 38.6367 2.00338 PNS24243 293 104.972 4 2.44843 KQK14069 1603 1371.19 6557.54 307.287 KQK14071 474 253.506 250.664 63.5336 ==> SRR14458911.se.tsv <== BRADI_1g14170v3 7317 BRADI_1g53295v3 56 BRADI_1g59795v3 314 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 2408 BRADI_1g74790v3 638 BRADI_1g09890v3 10 BRADI_1g77505v3 411 BRADI_1g48960v3 0 SRR14458911 completed mapping pipeline successfully