Starting /dee2/code/volunteer_pipeline.sh SRR14458912 current disk space = 1539795632128 free memory = 1607444468 SRR14458912 SRAfilesize 44fce355cc3f5d806e4b342c580d894c SRR14458912.sra SRR14458912.sra file validated SRR14458912 is paired end SRR14458912 is conventional basespace SRR14458912 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458912_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.942 32.0 32.0 32.0 32.0 32.0 2 31.1055 32.0 32.0 32.0 32.0 32.0 3 31.29125 32.0 32.0 32.0 32.0 32.0 4 31.27175 32.0 32.0 32.0 32.0 32.0 5 31.349 32.0 32.0 32.0 32.0 32.0 6 34.40925 36.0 36.0 36.0 32.0 36.0 7 34.6325 36.0 36.0 36.0 32.0 36.0 8 34.37725 36.0 36.0 36.0 32.0 36.0 9 34.508 36.0 36.0 36.0 32.0 36.0 10-14 34.55925 36.0 36.0 36.0 32.0 36.0 15-19 34.476099999999995 36.0 36.0 36.0 32.0 36.0 20-24 34.460300000000004 36.0 36.0 36.0 32.0 36.0 25-29 34.287099999999995 36.0 36.0 36.0 32.0 36.0 30-34 34.103049999999996 36.0 36.0 36.0 32.0 36.0 35-39 34.08015 36.0 36.0 36.0 32.0 36.0 40-44 33.89785 36.0 36.0 36.0 32.0 36.0 45-49 33.88225 36.0 36.0 36.0 32.0 36.0 50-54 33.71575 36.0 36.0 36.0 30.0 36.0 55-59 33.54265 36.0 36.0 36.0 24.6 36.0 60-64 33.37070000000001 36.0 36.0 36.0 24.6 36.0 65-69 33.300349999999995 36.0 36.0 36.0 23.4 36.0 70-74 33.01025 36.0 32.8 36.0 20.8 36.0 75-79 32.92229999999999 36.0 32.0 36.0 22.2 36.0 80-84 32.856 36.0 32.0 36.0 23.4 36.0 85-89 32.85365 36.0 32.0 36.0 19.6 36.0 90-94 32.85255 36.0 32.0 36.0 19.6 36.0 95-99 32.57065 36.0 32.0 36.0 14.0 36.0 100-104 32.576800000000006 36.0 32.0 36.0 15.4 36.0 105-109 32.425050000000006 36.0 32.0 36.0 14.0 36.0 110-114 32.438399999999994 36.0 32.0 36.0 14.0 36.0 115-119 32.28465 36.0 32.0 36.0 14.0 36.0 120-124 32.17315 36.0 32.0 36.0 14.0 36.0 125-129 31.950399999999995 36.0 32.0 36.0 14.0 36.0 130-134 31.86035 36.0 32.0 36.0 14.0 36.0 135-139 31.75125 36.0 32.0 36.0 14.0 36.0 140-144 31.2726 36.0 29.0 36.0 14.0 36.0 145-149 30.949100000000005 36.0 27.0 36.0 14.0 36.0 150-151 28.842624999999998 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 2.0 22 13.0 23 23.0 24 30.0 25 49.0 26 68.0 27 111.0 28 134.0 29 174.0 30 208.0 31 282.0 32 366.0 33 571.0 34 946.0 35 1019.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.625 11.525 13.925 50.925 2 23.025000000000002 18.6 35.25 23.125 3 21.8 22.225 24.875 31.1 4 26.650000000000002 28.249999999999996 16.775000000000002 28.325 5 27.900000000000002 31.275 20.05 20.775 6 23.238906994234142 31.737277513161192 21.283529706693407 23.740285785911254 7 21.775 16.1 37.4 24.725 8 22.400000000000002 19.825 26.150000000000002 31.624999999999996 9 22.125 19.15 29.025000000000002 29.7 10-14 25.345000000000002 25.03 23.265 26.36 15-19 25.779999999999998 23.849999999999998 22.875 27.495000000000005 20-24 26.105 23.72 23.145 27.029999999999998 25-29 25.406270313515677 24.10120506025301 23.301165058252913 27.191359567978402 30-34 25.50755075507551 23.8973897389739 23.582358235823584 27.012701270127014 35-39 25.756590465709568 23.600620279125607 23.49057075684058 27.152218498324242 40-44 26.08195326962526 23.39520688447491 23.004953219592736 27.517886626307096 45-49 26.191907051282055 23.80809294871795 22.771434294871796 27.228565705128204 50-54 25.77236993640779 23.423964748885883 23.529117219968956 27.274548094737366 55-59 25.94765342960289 23.340352988367428 22.964300040112313 27.747693541917368 60-64 25.936686034862756 23.211781206171107 23.557403325986776 27.294129432979364 65-69 26.1375608287764 23.538855164802087 22.98700647168013 27.336577534741384 70-74 26.073681049154068 23.6910601661828 23.215537090799877 27.019721693863254 75-79 26.707048458149778 22.692230676812176 23.723468161794152 26.877252703243894 80-84 26.121754789655345 23.240458206192788 23.20044019808914 27.437346806062727 85-89 26.616330816540827 23.53617680884044 22.64613230661533 27.2013600680034 90-94 26.590000000000003 23.165 23.41 26.834999999999997 95-99 26.38 23.044999999999998 23.330000000000002 27.245 100-104 26.465 22.655 23.95 26.93 105-109 26.295 23.115 23.32 27.27 110-114 26.846342317115855 23.04115205760288 22.906145307265362 27.2063603180159 115-119 26.979999999999997 23.44 22.615 26.965 120-124 27.125 23.599999999999998 22.155 27.12 125-129 27.515 23.235 22.465 26.784999999999997 130-134 27.355 23.885 22.005 26.755000000000003 135-139 27.284999999999997 24.295 22.195 26.224999999999998 140-144 27.284999999999997 24.099999999999998 22.06 26.555 145-149 27.055 24.6 21.34 27.005000000000003 150-151 26.724999999999998 24.825 21.1375 27.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 2.5 28 3.0 29 2.0 30 2.5 31 3.5 32 5.5 33 12.5 34 19.5 35 26.0 36 35.5 37 45.5 38 61.0 39 78.5 40 90.0 41 111.0 42 116.5 43 124.5 44 154.5 45 153.0 46 147.5 47 149.0 48 136.5 49 132.0 50 135.0 51 125.0 52 108.5 53 109.5 54 119.5 55 115.0 56 111.0 57 108.0 58 105.0 59 115.0 60 124.0 61 112.5 62 104.5 63 102.0 64 95.0 65 76.0 66 67.0 67 75.5 68 72.5 69 66.0 70 55.5 71 58.0 72 50.0 73 36.0 74 35.0 75 25.5 76 17.5 77 15.5 78 13.0 79 12.0 80 8.0 81 4.0 82 2.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.01 35-39 0.045 40-44 0.065 45-49 0.16 50-54 0.145 55-59 0.27999999999999997 60-64 0.18 65-69 0.335 70-74 0.11 75-79 0.12 80-84 0.045 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91221856817607 97.75 2 1.0118897040222614 2.0 3 0.05059448520111307 0.15 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.45 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.2625 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458912 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458912_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9095 32.0 32.0 32.0 32.0 32.0 2 30.58825 32.0 32.0 32.0 32.0 32.0 3 30.44225 32.0 32.0 32.0 32.0 32.0 4 30.62875 32.0 32.0 32.0 32.0 32.0 5 30.47075 32.0 32.0 32.0 32.0 32.0 6 33.7915 36.0 36.0 36.0 32.0 36.0 7 33.801 36.0 36.0 36.0 32.0 36.0 8 33.8915 36.0 36.0 36.0 32.0 36.0 9 33.92575 36.0 36.0 36.0 32.0 36.0 10-14 33.84425 36.0 36.0 36.0 32.0 36.0 15-19 33.81985 36.0 36.0 36.0 31.0 36.0 20-24 33.712599999999995 36.0 36.0 36.0 30.0 36.0 25-29 33.6687 36.0 36.0 36.0 28.0 36.0 30-34 33.5553 36.0 36.0 36.0 25.6 36.0 35-39 33.4009 36.0 36.0 36.0 22.2 36.0 40-44 33.4375 36.0 36.0 36.0 24.6 36.0 45-49 33.2778 36.0 36.0 36.0 19.4 36.0 50-54 33.131899999999995 36.0 36.0 36.0 16.8 36.0 55-59 32.93925 36.0 36.0 36.0 15.4 36.0 60-64 32.754650000000005 36.0 36.0 36.0 14.0 36.0 65-69 32.3908 36.0 32.0 36.0 14.0 36.0 70-74 32.0815 36.0 32.8 36.0 14.0 36.0 75-79 31.88005 36.0 32.0 36.0 14.0 36.0 80-84 31.6204 36.0 32.0 36.0 14.0 36.0 85-89 31.77725 36.0 32.0 36.0 14.0 36.0 90-94 31.36195 36.0 32.0 36.0 14.0 36.0 95-99 31.298750000000002 36.0 32.0 36.0 14.0 36.0 100-104 31.3293 36.0 32.0 36.0 14.0 36.0 105-109 31.191300000000002 36.0 32.0 36.0 14.0 36.0 110-114 31.062900000000003 36.0 32.0 36.0 14.0 36.0 115-119 30.640749999999997 36.0 27.0 36.0 14.0 36.0 120-124 30.655 36.0 30.0 36.0 14.0 36.0 125-129 30.2954 36.0 27.0 36.0 14.0 36.0 130-134 29.76355 33.6 27.0 36.0 14.0 36.0 135-139 29.1861 32.0 27.0 36.0 14.0 36.0 140-144 29.089999999999996 32.0 27.0 36.0 14.0 36.0 145-149 29.1697 32.0 27.0 36.0 14.0 36.0 150-151 26.2195 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 5.0 10 7.0 11 7.0 12 7.0 13 8.0 14 5.0 15 15.0 16 6.0 17 5.0 18 15.0 19 6.0 20 3.0 21 22.0 22 29.0 23 40.0 24 56.0 25 65.0 26 99.0 27 133.0 28 163.0 29 196.0 30 285.0 31 344.0 32 425.0 33 590.0 34 911.0 35 551.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.767825869402053 11.48361270953215 11.533650237678259 53.214911183387535 2 24.224999999999998 17.549999999999997 37.05 21.175 3 24.575 21.275 24.45 29.7 4 28.1 26.424999999999997 16.825000000000003 28.65 5 29.475 30.375000000000004 19.35 20.8 6 24.349999999999998 32.875 19.3 23.474999999999998 7 21.525 15.675 36.75 26.05 8 22.225 20.025000000000002 25.900000000000002 31.85 9 22.95 18.775 29.5 28.775000000000002 10-14 24.665 24.62 23.3 27.415 15-19 26.055 23.685000000000002 22.86 27.400000000000002 20-24 25.39 24.01 23.395 27.205000000000002 25-29 25.895000000000003 23.785 23.335 26.985 30-34 25.42389836442755 23.958385434902215 23.398189366278196 27.21952683439204 35-39 25.992381716118686 23.832197273456295 22.724538893344025 27.450882117080994 40-44 25.96004606218395 23.581835477895158 23.056125769789215 27.401992690131678 45-49 26.641236699457938 23.81047982332865 22.886970487853844 26.661312989359566 50-54 26.665659465176006 23.915999395679105 22.767789696328748 26.650551442816134 55-59 25.856776206532135 23.813597705198532 22.49509335212118 27.834532736148155 60-64 26.319773897244374 23.417785404259615 23.185626324820834 27.07681437367518 65-69 26.336803800667134 23.95127868189629 22.409784696249872 27.302132821186696 70-74 26.647738795376192 23.57026972216589 22.86047454877307 26.921516933684853 75-79 26.512265732134694 23.221087917111078 23.078876530042155 27.18776982071207 80-84 26.126584856662767 24.593920260705737 22.602983858648606 26.67651102398289 85-89 27.24867724867725 23.092185592185594 22.954822954822955 26.704314204314205 90-94 26.761783439490443 23.571974522292994 22.552866242038217 27.113375796178346 95-99 26.409329327290322 23.24183938483475 23.328410653358457 27.020420634516473 100-104 27.027715508457305 23.670266965559406 22.661503973914815 26.640513552068473 105-109 26.620830150241915 23.32060096765979 23.213649096002037 26.844919786096256 110-114 27.07058343533252 23.735210118319053 22.516319869441045 26.677886576907383 115-119 26.961585615038825 23.682059664895792 22.818757662443808 26.537597057621575 120-124 27.04817428659098 23.47857215914902 22.552930346732126 26.920323207527876 125-129 27.38905666171879 23.96478476736449 22.485540256948354 26.16061831396837 130-134 27.917093142272265 23.664278403275333 22.446264073694984 25.972364380757423 135-139 27.94999231439258 24.02008505405544 22.672541886560435 25.35738074499155 140-144 29.496366055891084 23.973794656566692 21.609171870201656 24.920667417340567 145-149 29.097605893186003 24.6060978105177 21.685082872928177 24.61121342336812 150-151 29.36132087546397 24.40803788557532 22.296173044925123 23.93446819403558 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.5 20 2.5 21 1.0 22 2.0 23 3.5 24 3.0 25 3.5 26 4.0 27 4.0 28 5.0 29 5.5 30 5.5 31 9.0 32 12.0 33 15.5 34 24.5 35 32.0 36 35.5 37 40.5 38 51.0 39 69.0 40 92.0 41 113.5 42 123.5 43 125.5 44 128.5 45 139.5 46 150.0 47 152.0 48 141.0 49 138.0 50 138.5 51 117.5 52 108.0 53 109.5 54 109.0 55 115.0 56 120.0 57 113.5 58 103.0 59 107.5 60 110.5 61 94.5 62 85.5 63 91.5 64 91.5 65 84.0 66 77.5 67 77.5 68 73.5 69 60.0 70 64.0 71 61.0 72 48.0 73 43.0 74 37.5 75 35.5 76 25.5 77 15.0 78 12.0 79 7.5 80 5.5 81 6.0 82 4.0 83 4.0 84 2.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.24 40-44 0.135 45-49 0.38 50-54 0.715 55-59 0.645 60-64 0.9299999999999999 65-69 1.0699999999999998 70-74 1.38 75-79 1.555 80-84 1.805 85-89 1.72 90-94 1.875 95-99 1.815 100-104 1.8599999999999999 105-109 1.825 110-114 1.96 115-119 2.12 120-124 2.23 125-129 2.315 130-134 2.3 135-139 2.415 140-144 2.31 145-149 2.26 150-151 2.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96333754740834 97.85000000000001 2 0.9608091024020228 1.9 3 0.05056890012642225 0.15 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.0125 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 7.075 0.0 0.0 0.0 0.0 138-139 8.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATAG 10 0.0067147487 145.81013 145 >>END_MODULE Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015533 spots for SRR14458912.sra Written 1015533 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra Read 1015532 spots for SRR14458912.sra Written 1015532 spots for SRR14458912.sra SRR ids: ['SRR14458912.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q3knc306 SRR14458912.sra spots: 20310641 blocks: [[1, 1015532], [1015533, 2031064], [2031065, 3046596], [3046597, 4062128], [4062129, 5077660], [5077661, 6093192], [6093193, 7108724], [7108725, 8124256], [8124257, 9139788], [9139789, 10155320], [10155321, 11170852], [11170853, 12186384], [12186385, 13201916], [13201917, 14217448], [14217449, 15232980], [15232981, 16248512], [16248513, 17264044], [17264045, 18279576], [18279577, 19295108], [19295109, 20310641]] SRR14458912 file size 6880744 SRR14458912 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458912 SRR14458912_1.fastq SRR14458912_2.fastq Input file: SRR14458912_1.fastq Paired file: SRR14458912_2.fastq trimmed: SRR14458912-trimmed-pair1.fastq, SRR14458912-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 20:03:12 2024 >> started Sat Dec 7 20:04:27 2024 >> done (74.712s) 20310641 read pairs processed; of these: 4017 ( 0.02%) short read pairs filtered out after trimming by size control 777 ( 0.00%) empty read pairs filtered out after trimming by size control 20305847 (99.98%) read pairs available; of these: 3185755 (15.69%) trimmed read pairs available after processing 17120092 (84.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 200 0.00% 19 198 0.00% 20 142 0.00% 21 182 0.00% 22 166 0.00% 23 149 0.00% 24 178 0.00% 25 113 0.00% 26 152 0.00% 27 147 0.00% 28 118 0.00% 29 137 0.00% 30 130 0.00% 31 131 0.00% 32 144 0.00% 33 129 0.00% 34 381 0.00% 35 120 0.00% 36 145 0.00% 37 127 0.00% 38 148 0.00% 39 106 0.00% 40 128 0.00% 41 161 0.00% 42 97 0.00% 43 119 0.00% 44 97 0.00% 45 148 0.00% 46 113 0.00% 47 133 0.00% 48 150 0.00% 49 159 0.00% 50 142 0.00% 51 131 0.00% 52 145 0.00% 53 166 0.00% 54 147 0.00% 55 162 0.00% 56 191 0.00% 57 180 0.00% 58 223 0.00% 59 253 0.00% 60 249 0.00% 61 291 0.00% 62 290 0.00% 63 293 0.00% 64 274 0.00% 65 330 0.00% 66 316 0.00% 67 394 0.00% 68 433 0.00% 69 481 0.00% 70 546 0.00% 71 662 0.00% 72 635 0.00% 73 702 0.00% 74 797 0.00% 75 766 0.00% 76 918 0.00% 77 945 0.00% 78 1052 0.01% 79 1275 0.01% 80 1411 0.01% 81 1643 0.01% 82 1893 0.01% 83 2164 0.01% 84 2323 0.01% 85 2453 0.01% 86 2791 0.01% 87 3109 0.02% 88 3991 0.02% 89 5701 0.03% 90 6868 0.03% 91 6179 0.03% 92 6132 0.03% 93 6309 0.03% 94 7294 0.04% 95 8462 0.04% 96 9010 0.04% 97 9289 0.05% 98 10184 0.05% 99 12135 0.06% 100 13547 0.07% 101 13989 0.07% 102 14238 0.07% 103 15930 0.08% 104 17649 0.09% 105 18081 0.09% 106 19651 0.10% 107 20571 0.10% 108 21094 0.10% 109 23495 0.12% 110 26086 0.13% 111 27067 0.13% 112 30007 0.15% 113 32539 0.16% 114 34963 0.17% 115 37583 0.19% 116 38918 0.19% 117 39315 0.19% 118 41182 0.20% 119 43497 0.21% 120 45203 0.22% 121 48592 0.24% 122 53093 0.26% 123 55310 0.27% 124 59007 0.29% 125 62170 0.31% 126 64058 0.32% 127 65113 0.32% 128 66789 0.33% 129 68427 0.34% 130 71099 0.35% 131 73366 0.36% 132 76224 0.38% 133 80520 0.40% 134 84921 0.42% 135 86151 0.42% 136 87665 0.43% 137 88625 0.44% 138 89348 0.44% 139 90418 0.45% 140 91873 0.45% 141 92660 0.46% 142 96719 0.48% 143 99211 0.49% 144 100482 0.49% 145 102671 0.51% 146 101175 0.50% 147 103911 0.51% 148 109436 0.54% 149 106287 0.52% 150 108351 0.53% 151 17120092 84.31% 20305847 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=7 prefix-density=0.58 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=21.60 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=6 prefix-density=0.57 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=18.67 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458912 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 20:07:54 Started mapping on | Dec 07 20:07:54 Finished on | Dec 07 20:11:46 Mapping speed, Million of reads per hour | 315.09 Number of input reads | 20305847 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18152901 Uniquely mapped reads % | 89.40% Average mapped length | 291.68 Number of splices: Total | 18081169 Number of splices: Annotated (sjdb) | 17094513 Number of splices: GT/AG | 17836805 Number of splices: GC/AG | 206752 Number of splices: AT/AC | 6843 Number of splices: Non-canonical | 30769 Mismatch rate per base, % | 0.73% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429933 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 52870 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.57% % of reads unmapped: other | 2.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1723373 1723373 1723373 N_multimapping 429933 429933 429933 N_noFeature 625789 9175752 9274125 N_ambiguous 409239 42913 42166 UnstrandedReadsAssigned:17117873 PositiveStrandReadsAssigned:8934236 NegativeStrandReadsAssigned:8836610 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458912 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458912-trimmed-pair1.fastq SRR14458912-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,305,847 reads, 18,501,609 reads pseudoaligned [quant] estimated average fragment length: 236.732 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,315 rounds 52973 SRR14458912.ke.tsv 35125 SRR14458912.se.tsv 88098 total ==> SRR14458912.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.679 0 0 PNS24247 1044 808.268 20.6311 1.77189 PNS24249 1928 1692.27 131.063 5.37627 PNS24246 1044 808.268 20.6311 1.77189 PNS24248 1044 808.268 20.6311 1.77189 PNS24244 1471 1235.27 23.0441 1.295 PNS24243 293 103.47 4 2.68359 KQK14069 1603 1367.27 7872.55 399.699 KQK14071 474 250.716 231.63 64.1334 ==> SRR14458912.se.tsv <== BRADI_1g14170v3 8626 BRADI_1g53295v3 40 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 2108 BRADI_1g74790v3 657 BRADI_1g09890v3 3 BRADI_1g77505v3 422 BRADI_1g48960v3 0 SRR14458912 completed mapping pipeline successfully