Starting /dee2/code/volunteer_pipeline.sh SRR14458913 current disk space = 1539783368704 free memory = 1607425264 SRR14458913 SRAfilesize 1dcdd6d1ac10168e12ab94a0218df9d6 SRR14458913.sra SRR14458913.sra file validated SRR14458913 is paired end SRR14458913 is conventional basespace SRR14458913 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458913_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.015 32.0 32.0 32.0 32.0 32.0 2 31.0545 32.0 32.0 32.0 32.0 32.0 3 31.21125 32.0 32.0 32.0 32.0 32.0 4 31.322 32.0 32.0 32.0 32.0 32.0 5 31.29925 32.0 32.0 32.0 32.0 32.0 6 34.12275 36.0 36.0 36.0 32.0 36.0 7 34.573 36.0 36.0 36.0 32.0 36.0 8 34.27675 36.0 36.0 36.0 32.0 36.0 9 34.37075 36.0 36.0 36.0 32.0 36.0 10-14 34.44015 36.0 36.0 36.0 32.0 36.0 15-19 34.4096 36.0 36.0 36.0 32.0 36.0 20-24 34.42325 36.0 36.0 36.0 32.0 36.0 25-29 34.149649999999994 36.0 36.0 36.0 32.0 36.0 30-34 33.9991 36.0 36.0 36.0 32.0 36.0 35-39 33.87755 36.0 36.0 36.0 32.0 36.0 40-44 33.79469999999999 36.0 36.0 36.0 32.0 36.0 45-49 33.72315 36.0 36.0 36.0 31.0 36.0 50-54 33.65125 36.0 36.0 36.0 26.6 36.0 55-59 33.2937 36.0 36.0 36.0 23.4 36.0 60-64 33.2531 36.0 36.0 36.0 22.2 36.0 65-69 33.1411 36.0 36.0 36.0 21.0 36.0 70-74 33.01155 36.0 32.8 36.0 23.4 36.0 75-79 32.814899999999994 36.0 32.0 36.0 19.6 36.0 80-84 32.7183 36.0 32.0 36.0 21.0 36.0 85-89 32.75005 36.0 32.0 36.0 18.2 36.0 90-94 32.76755 36.0 32.0 36.0 18.2 36.0 95-99 32.61675 36.0 32.0 36.0 16.8 36.0 100-104 32.56975 36.0 32.0 36.0 14.0 36.0 105-109 32.332800000000006 36.0 32.0 36.0 14.0 36.0 110-114 32.3968 36.0 32.0 36.0 14.0 36.0 115-119 32.138400000000004 36.0 32.0 36.0 14.0 36.0 120-124 32.21124999999999 36.0 32.0 36.0 14.0 36.0 125-129 31.91735 36.0 32.0 36.0 14.0 36.0 130-134 31.876599999999996 36.0 32.0 36.0 14.0 36.0 135-139 31.7177 36.0 32.0 36.0 14.0 36.0 140-144 31.174200000000003 36.0 29.0 36.0 14.0 36.0 145-149 30.837600000000002 36.0 27.0 36.0 14.0 36.0 150-151 28.719125 29.5 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 1.0 21 10.0 22 12.0 23 32.0 24 32.0 25 46.0 26 72.0 27 106.0 28 127.0 29 183.0 30 221.0 31 293.0 32 385.0 33 567.0 34 913.0 35 997.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.474999999999998 12.6 11.95 51.975 2 22.45 18.4 36.85 22.3 3 23.075000000000003 21.475 25.025 30.425 4 26.700000000000003 27.675 17.95 27.675 5 27.200000000000003 29.775000000000002 19.950000000000003 23.075000000000003 6 22.177520744279608 34.221775207442796 19.51219512195122 24.088508926326377 7 20.9 16.925 38.275 23.9 8 21.25 19.925 26.325 32.5 9 22.8 18.875 30.2 28.125 10-14 24.875 24.67 23.189999999999998 27.265 15-19 25.825 23.53 23.294999999999998 27.35 20-24 25.645 24.315 23.27 26.77 25-29 25.278791818772817 24.43866579986998 23.083462519377907 27.199079861979296 30-34 25.81532613045218 24.23469387755102 22.65906362545018 27.290916366546618 35-39 25.544267053701013 24.012812171562985 23.487312947299934 26.95560782743606 40-44 25.939284640817554 24.12583909427913 22.65304077747721 27.281835487426108 45-49 25.985357536856885 24.370674957376394 22.7008324140006 26.943135091766123 50-54 26.510369702434627 23.820258491133153 22.853421500851617 26.815950305580603 55-59 25.901919405084918 23.696110943623758 23.15345191438046 27.248517736910866 60-64 26.402689952825455 23.396567299006325 22.468132088728296 27.732610659439928 65-69 27.004580460059397 23.164040871797454 22.690894448079728 27.14048422006342 70-74 26.775244299674267 23.65823101979454 22.971686294161863 26.59483838636933 75-79 26.664327250852217 23.68658512131542 22.65390014036495 26.995187487467415 80-84 26.213835218740616 23.315647211933126 22.925217739513464 27.54529982981279 85-89 26.365546218487395 23.559423769507802 23.08923569427771 26.98579431772709 90-94 27.14678669667417 23.5008752188047 22.840710177544384 26.51162790697674 95-99 26.4502900580116 22.984596919383876 23.754750950190036 26.810362072414485 100-104 26.281570392598148 23.390847711927982 23.26081520380095 27.066766691672917 105-109 27.12678169542386 23.320830207551886 22.535633908477116 27.016754188547136 110-114 26.771692923230805 22.930732683170792 22.845711427856966 27.451862965741437 115-119 26.74668667166792 24.121030257564392 22.275568892223056 26.85671417854464 120-124 27.38184546136534 23.740935233808454 22.140535133783445 26.736684171042764 125-129 27.306826706676667 23.82595648912228 22.465616404101024 26.401600400100023 130-134 27.122712271227122 24.05740574057406 21.992199219921993 26.82768276827683 135-139 27.524128619292892 24.543681552232837 21.948292243836576 25.983897584637695 140-144 27.19271927192719 24.52245224522452 21.73717371737174 26.547654765476548 145-149 27.31136556827841 24.591229561478073 21.85609280464023 26.241312065603278 150-151 27.625 24.25 21.8875 26.237500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 0.5 26 0.5 27 1.5 28 2.0 29 3.5 30 5.5 31 5.0 32 7.0 33 11.5 34 16.0 35 23.5 36 31.0 37 35.0 38 47.0 39 72.0 40 89.5 41 100.5 42 122.0 43 146.5 44 147.5 45 155.5 46 175.0 47 163.5 48 148.5 49 147.0 50 138.0 51 129.5 52 133.0 53 125.5 54 108.5 55 95.5 56 90.0 57 112.0 58 114.5 59 93.5 60 98.5 61 98.5 62 100.0 63 94.0 64 84.5 65 79.0 66 71.5 67 76.0 68 72.5 69 60.0 70 57.0 71 61.5 72 58.0 73 43.5 74 29.0 75 26.5 76 24.0 77 19.0 78 15.5 79 8.0 80 5.0 81 6.0 82 4.5 83 2.5 84 0.5 85 0.5 86 0.5 87 0.0 88 1.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.575 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.04 35-39 0.095 40-44 0.19 45-49 0.29 50-54 0.19 55-59 0.49 60-64 0.37 65-69 0.6649999999999999 70-74 0.22499999999999998 75-79 0.26 80-84 0.11 85-89 0.04 90-94 0.025 95-99 0.02 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.01 135-139 0.015 140-144 0.01 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08998988877654 98.0 2 0.7836198179979776 1.55 3 0.07583417593528817 0.22499999999999998 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACAAT 10 0.006830828 145.0 1 TTCACCA 10 0.006830828 145.0 8 GAACTCC 20 0.00593511 29.0 140-144 CGTCTGA 20 0.00593511 29.0 135-139 >>END_MODULE SRR14458913 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458913_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.94075 32.0 32.0 32.0 32.0 32.0 2 30.556 32.0 32.0 32.0 32.0 32.0 3 30.51975 32.0 32.0 32.0 32.0 32.0 4 30.631 32.0 32.0 32.0 32.0 32.0 5 30.59125 32.0 32.0 32.0 32.0 32.0 6 33.8085 36.0 36.0 36.0 32.0 36.0 7 34.00875 36.0 36.0 36.0 32.0 36.0 8 33.865 36.0 36.0 36.0 32.0 36.0 9 33.89725 36.0 36.0 36.0 32.0 36.0 10-14 33.84585 36.0 36.0 36.0 32.0 36.0 15-19 33.77885 36.0 36.0 36.0 31.0 36.0 20-24 33.731049999999996 36.0 36.0 36.0 29.0 36.0 25-29 33.65295 36.0 36.0 36.0 27.8 36.0 30-34 33.5427 36.0 36.0 36.0 25.8 36.0 35-39 33.47065 36.0 36.0 36.0 24.6 36.0 40-44 33.47905000000001 36.0 36.0 36.0 25.8 36.0 45-49 33.27275 36.0 36.0 36.0 19.6 36.0 50-54 33.00075 36.0 36.0 36.0 15.4 36.0 55-59 32.932050000000004 36.0 36.0 36.0 16.8 36.0 60-64 32.636900000000004 36.0 36.0 36.0 14.0 36.0 65-69 32.29164999999999 36.0 32.0 36.0 14.0 36.0 70-74 31.8956 36.0 32.0 36.0 14.0 36.0 75-79 31.707550000000005 36.0 32.0 36.0 14.0 36.0 80-84 31.5279 36.0 32.0 36.0 14.0 36.0 85-89 31.607400000000002 36.0 32.0 36.0 14.0 36.0 90-94 31.243599999999997 36.0 32.0 36.0 14.0 36.0 95-99 31.2111 36.0 32.0 36.0 14.0 36.0 100-104 31.150799999999997 36.0 32.0 36.0 14.0 36.0 105-109 31.03405 36.0 32.0 36.0 14.0 36.0 110-114 30.785149999999998 36.0 31.0 36.0 14.0 36.0 115-119 30.47625 36.0 27.0 36.0 14.0 36.0 120-124 30.326549999999997 36.0 27.0 36.0 14.0 36.0 125-129 29.952599999999997 35.2 27.0 36.0 14.0 36.0 130-134 29.3829 32.8 27.0 36.0 14.0 36.0 135-139 28.785450000000004 32.0 27.0 36.0 14.0 36.0 140-144 28.816650000000003 32.0 27.0 36.0 14.0 36.0 145-149 28.84135 32.0 25.8 36.0 14.0 36.0 150-151 25.818125000000002 29.5 17.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 4.0 10 13.0 11 15.0 12 7.0 13 3.0 14 4.0 15 11.0 16 9.0 17 14.0 18 6.0 19 7.0 20 12.0 21 18.0 22 32.0 23 41.0 24 55.0 25 96.0 26 117.0 27 135.0 28 186.0 29 205.0 30 251.0 31 299.0 32 417.0 33 552.0 34 865.0 35 624.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.325000000000003 11.225 12.025 53.425 2 23.775 17.2 35.699999999999996 23.325000000000003 3 23.575 22.1 24.224999999999998 30.099999999999998 4 26.85 28.000000000000004 16.475 28.675 5 29.775000000000002 29.4 19.55 21.275 6 23.799999999999997 34.325 18.775 23.1 7 20.150000000000002 16.475 39.525 23.849999999999998 8 19.925 19.8 27.0 33.275 9 23.325000000000003 20.175 28.175 28.325 10-14 25.025 24.959999999999997 22.625 27.389999999999997 15-19 25.53 23.515 23.669999999999998 27.284999999999997 20-24 25.019999999999996 24.065 23.43 27.485 25-29 25.36626831341567 23.84619230961548 23.806190309515475 26.981349067453376 30-34 25.689129020961527 24.163289809395167 23.057681724948722 27.08989944469458 35-39 25.572059413890003 24.34765154556403 23.21356884785227 26.8667201926937 40-44 25.82744980221321 23.804516548996045 23.18361624355315 27.184417405237593 45-49 25.5996379544426 23.809523809523807 22.713330316287024 27.87750791974657 50-54 26.537723462276535 23.931926068073935 22.452277547722453 27.078072921927077 55-59 25.964593735814802 23.84122661017804 23.0140717203813 27.180107933625862 60-64 25.623387790197764 23.018562541095545 23.43331141570988 27.92473825299681 65-69 26.086736244806975 23.88286553855507 23.00638362549397 27.024014591143985 70-74 25.720970449112457 23.686485936625807 22.964243934693044 27.62829967956869 75-79 25.917057265131444 23.02832687996739 23.425718361524353 27.628897493376808 80-84 26.823782015234393 23.393487040539853 22.66244057052298 27.120290373702776 85-89 26.425981718837765 22.89741101976204 22.93315630904356 27.743450952356635 90-94 26.385832011055943 23.51947586630496 22.60326559860777 27.491426524031326 95-99 26.582796358801268 23.575738979236984 22.752378030070574 27.089086631891174 100-104 27.112658033474947 23.652556687311254 22.649332036648413 26.58545324256539 105-109 26.532699289257046 23.653934652554074 23.019890576264253 26.793475481924627 110-114 27.02827526043003 23.89798327089855 22.291784266434036 26.78195720223739 115-119 27.143151178347225 23.330245960687453 22.563548420294328 26.96305444067099 120-124 26.88598979013046 23.523951941422165 22.67312947970917 26.916928788738204 125-129 27.5377299979326 23.521811039900765 22.209013851560886 26.731445110605744 130-134 27.609010126059104 24.271543707377557 22.044843976028105 26.074602190535234 135-139 28.045311126053896 23.659028603941447 21.85382506594941 26.44183520405524 140-144 28.70786226833927 24.077228847245884 22.17748180269475 25.037427081720097 145-149 28.542677262875426 23.991123955000514 22.30364330684281 25.162555475281245 150-151 28.17265443266994 23.84337037994314 21.853192039286636 26.130783148100285 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 3.0 17 2.5 18 2.0 19 2.0 20 3.0 21 4.0 22 2.5 23 3.5 24 2.5 25 2.5 26 4.5 27 4.0 28 5.5 29 7.5 30 8.0 31 10.5 32 13.5 33 13.5 34 16.0 35 25.5 36 38.0 37 39.5 38 47.5 39 71.5 40 91.5 41 103.5 42 102.0 43 119.5 44 145.0 45 144.5 46 148.5 47 162.5 48 159.0 49 149.5 50 139.5 51 136.0 52 128.5 53 118.5 54 108.5 55 104.5 56 112.0 57 111.5 58 104.5 59 96.0 60 92.5 61 90.5 62 96.5 63 92.0 64 85.0 65 78.0 66 76.0 67 79.5 68 78.5 69 72.0 70 62.5 71 59.5 72 47.5 73 31.0 74 28.5 75 26.0 76 22.0 77 18.0 78 12.0 79 8.5 80 6.0 81 5.5 82 4.5 83 3.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.055 35-39 0.36 40-44 0.145 45-49 0.565 50-54 0.9900000000000001 55-59 0.865 60-64 1.145 65-69 1.31 70-74 1.695 75-79 1.8599999999999999 80-84 2.1950000000000003 85-89 2.085 90-94 2.315 95-99 2.23 100-104 2.315 105-109 2.215 110-114 2.565 115-119 2.83 120-124 3.0349999999999997 125-129 3.26 130-134 3.2199999999999998 135-139 3.335 140-144 3.145 145-149 3.11 150-151 3.2750000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.655241935483871 1.3 3 0.0 0.0 4 0.05040322580645161 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 6.237500000000001 0.0 0.0 0.0 0.0 136-137 7.012499999999999 0.0 0.0 0.0 0.0 138-139 7.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 20 0.0055473526 29.4 135-139 GATCGGA 20 0.0055473526 29.4 120-124 >>END_MODULE Read 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468157 spots for SRR14458913.sra Written 1468157 spots for SRR14458913.sra Read 1468170 spots for SRR14458913.sra Written 1468170 spots for SRR14458913.sra SRR ids: ['SRR14458913.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lm79047o SRR14458913.sra spots: 29363153 blocks: [[1, 1468157], [1468158, 2936314], [2936315, 4404471], [4404472, 5872628], [5872629, 7340785], [7340786, 8808942], [8808943, 10277099], [10277100, 11745256], [11745257, 13213413], [13213414, 14681570], [14681571, 16149727], [16149728, 17617884], [17617885, 19086041], [19086042, 20554198], [20554199, 22022355], [22022356, 23490512], [23490513, 24958669], [24958670, 26426826], [26426827, 27894983], [27894984, 29363153]] SRR14458913 file size 9957183 SRR14458913 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458913 SRR14458913_1.fastq SRR14458913_2.fastq Input file: SRR14458913_1.fastq Paired file: SRR14458913_2.fastq trimmed: SRR14458913-trimmed-pair1.fastq, SRR14458913-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 20:09:15 2024 >> started Sat Dec 7 20:11:20 2024 >> done (125.110s) 29363153 read pairs processed; of these: 6467 ( 0.02%) short read pairs filtered out after trimming by size control 1717 ( 0.01%) empty read pairs filtered out after trimming by size control 29354969 (99.97%) read pairs available; of these: 4383242 (14.93%) trimmed read pairs available after processing 24971727 (85.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 314 0.00% 19 295 0.00% 20 249 0.00% 21 276 0.00% 22 242 0.00% 23 250 0.00% 24 272 0.00% 25 226 0.00% 26 248 0.00% 27 195 0.00% 28 220 0.00% 29 209 0.00% 30 188 0.00% 31 178 0.00% 32 233 0.00% 33 193 0.00% 34 465 0.00% 35 176 0.00% 36 207 0.00% 37 176 0.00% 38 215 0.00% 39 195 0.00% 40 172 0.00% 41 229 0.00% 42 174 0.00% 43 174 0.00% 44 175 0.00% 45 188 0.00% 46 184 0.00% 47 225 0.00% 48 235 0.00% 49 285 0.00% 50 250 0.00% 51 259 0.00% 52 247 0.00% 53 247 0.00% 54 237 0.00% 55 258 0.00% 56 287 0.00% 57 332 0.00% 58 471 0.00% 59 478 0.00% 60 500 0.00% 61 603 0.00% 62 564 0.00% 63 583 0.00% 64 571 0.00% 65 638 0.00% 66 690 0.00% 67 796 0.00% 68 932 0.00% 69 1091 0.00% 70 1241 0.00% 71 1373 0.00% 72 1608 0.01% 73 1640 0.01% 74 1654 0.01% 75 1707 0.01% 76 1895 0.01% 77 2109 0.01% 78 2452 0.01% 79 2723 0.01% 80 3087 0.01% 81 3437 0.01% 82 3949 0.01% 83 4486 0.02% 84 4633 0.02% 85 5181 0.02% 86 5550 0.02% 87 6171 0.02% 88 7471 0.03% 89 9865 0.03% 90 11575 0.04% 91 11027 0.04% 92 10916 0.04% 93 11534 0.04% 94 12691 0.04% 95 14507 0.05% 96 15111 0.05% 97 15481 0.05% 98 16458 0.06% 99 19767 0.07% 100 21891 0.07% 101 22673 0.08% 102 22750 0.08% 103 25371 0.09% 104 27346 0.09% 105 27865 0.09% 106 30189 0.10% 107 31131 0.11% 108 32132 0.11% 109 35017 0.12% 110 38232 0.13% 111 39354 0.13% 112 43403 0.15% 113 45934 0.16% 114 49860 0.17% 115 52452 0.18% 116 54136 0.18% 117 54679 0.19% 118 56469 0.19% 119 59332 0.20% 120 61670 0.21% 121 65484 0.22% 122 70755 0.24% 123 74528 0.25% 124 79257 0.27% 125 83327 0.28% 126 84581 0.29% 127 86794 0.30% 128 88745 0.30% 129 90897 0.31% 130 95194 0.32% 131 98118 0.33% 132 100545 0.34% 133 106529 0.36% 134 111871 0.38% 135 113586 0.39% 136 116185 0.40% 137 117184 0.40% 138 118894 0.41% 139 120760 0.41% 140 122515 0.42% 141 123680 0.42% 142 129409 0.44% 143 132910 0.45% 144 134272 0.46% 145 137401 0.47% 146 136645 0.47% 147 141008 0.48% 148 149350 0.51% 149 144463 0.49% 150 147873 0.50% 151 24971727 85.07% 29354969 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=9 prefix-density=0.55 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=23.96 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=7 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=19.52 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458913 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 20:17:46 Started mapping on | Dec 07 20:17:46 Finished on | Dec 07 20:25:07 Mapping speed, Million of reads per hour | 239.63 Number of input reads | 29354969 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 26697565 Uniquely mapped reads % | 90.95% Average mapped length | 291.79 Number of splices: Total | 26640812 Number of splices: Annotated (sjdb) | 25200629 Number of splices: GT/AG | 26280724 Number of splices: GC/AG | 304624 Number of splices: AT/AC | 9948 Number of splices: Non-canonical | 45516 Mismatch rate per base, % | 0.71% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460777 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 49689 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.63% % of reads unmapped: other | 1.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2197184 2197184 2197184 N_multimapping 460777 460777 460777 N_noFeature 793318 13453634 13563404 N_ambiguous 607932 71777 68918 UnstrandedReadsAssigned:25296315 PositiveStrandReadsAssigned:13172154 NegativeStrandReadsAssigned:13065243 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458913 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458913-trimmed-pair1.fastq SRR14458913-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,354,969 reads, 27,141,029 reads pseudoaligned [quant] estimated average fragment length: 240.208 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR14458913.ke.tsv 35125 SRR14458913.se.tsv 88098 total ==> SRR14458913.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.047 0 0 PNS24247 1044 804.792 41.0038 2.42542 PNS24249 1928 1688.79 151.088 4.25893 PNS24246 1044 804.792 41.0038 2.42542 PNS24248 1044 804.792 41.0038 2.42542 PNS24244 1471 1231.79 56.9007 2.19901 PNS24243 293 101.929 9 4.20332 KQK14069 1603 1363.79 11206.9 391.187 KQK14071 474 248.499 346.861 66.4473 ==> SRR14458913.se.tsv <== BRADI_1g14170v3 12192 BRADI_1g53295v3 73 BRADI_1g59795v3 470 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 3038 BRADI_1g74790v3 1035 BRADI_1g09890v3 7 BRADI_1g77505v3 516 BRADI_1g48960v3 0 SRR14458913 completed mapping pipeline successfully