Starting /dee2/code/volunteer_pipeline.sh SRR14458914 current disk space = 1552303566848 free memory = 1607277852 SRR14458914 SRAfilesize 0620e7b827549a01f03a09fda60af6b0 SRR14458914.sra SRR14458914.sra file validated SRR14458914 is paired end SRR14458914 is conventional basespace SRR14458914 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458914_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.263 32.0 32.0 32.0 32.0 32.0 2 31.239 32.0 32.0 32.0 32.0 32.0 3 31.249 32.0 32.0 32.0 32.0 32.0 4 31.348 32.0 32.0 32.0 32.0 32.0 5 31.34225 32.0 32.0 32.0 32.0 32.0 6 34.16725 36.0 36.0 36.0 32.0 36.0 7 34.6305 36.0 36.0 36.0 32.0 36.0 8 34.38075 36.0 36.0 36.0 32.0 36.0 9 34.41475 36.0 36.0 36.0 32.0 36.0 10-14 34.46955 36.0 36.0 36.0 32.0 36.0 15-19 34.47735 36.0 36.0 36.0 32.0 36.0 20-24 34.445 36.0 36.0 36.0 32.0 36.0 25-29 34.1846 36.0 36.0 36.0 32.0 36.0 30-34 34.033849999999994 36.0 36.0 36.0 32.0 36.0 35-39 33.87395 36.0 36.0 36.0 32.0 36.0 40-44 33.876250000000006 36.0 36.0 36.0 32.0 36.0 45-49 33.79015 36.0 36.0 36.0 31.0 36.0 50-54 33.6132 36.0 36.0 36.0 28.8 36.0 55-59 33.448249999999994 36.0 36.0 36.0 23.4 36.0 60-64 33.33004999999999 36.0 36.0 36.0 22.2 36.0 65-69 33.19635 36.0 36.0 36.0 21.0 36.0 70-74 33.04935 36.0 32.8 36.0 22.2 36.0 75-79 32.820550000000004 36.0 32.0 36.0 20.8 36.0 80-84 32.883050000000004 36.0 32.0 36.0 21.0 36.0 85-89 32.8166 36.0 32.0 36.0 19.6 36.0 90-94 32.81895 36.0 32.0 36.0 18.2 36.0 95-99 32.5706 36.0 32.0 36.0 14.0 36.0 100-104 32.510000000000005 36.0 32.0 36.0 14.0 36.0 105-109 32.51755 36.0 32.0 36.0 14.0 36.0 110-114 32.376250000000006 36.0 32.0 36.0 14.0 36.0 115-119 32.281699999999994 36.0 32.0 36.0 14.0 36.0 120-124 32.1437 36.0 32.0 36.0 14.0 36.0 125-129 32.08469999999999 36.0 32.0 36.0 14.0 36.0 130-134 31.87975 36.0 32.0 36.0 14.0 36.0 135-139 31.8043 36.0 32.0 36.0 14.0 36.0 140-144 31.164849999999994 36.0 29.0 36.0 14.0 36.0 145-149 30.82895 36.0 27.0 36.0 14.0 36.0 150-151 28.5395 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 2.0 21 2.0 22 21.0 23 16.0 24 34.0 25 67.0 26 69.0 27 116.0 28 122.0 29 173.0 30 191.0 31 271.0 32 394.0 33 566.0 34 942.0 35 1011.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.025 11.975 13.875000000000002 52.125 2 23.275000000000002 18.2 35.325 23.200000000000003 3 23.275000000000002 21.3 24.825 30.599999999999998 4 27.125 27.1 18.099999999999998 27.675 5 27.925 31.05 18.625 22.400000000000002 6 23.371069182389938 31.39622641509434 19.622641509433965 25.610062893081757 7 21.25 15.825 37.574999999999996 25.35 8 21.4 20.849999999999998 25.424999999999997 32.324999999999996 9 24.175 19.45 29.075 27.3 10-14 24.73 25.314999999999998 22.705000000000002 27.250000000000004 15-19 24.95 23.64 23.9 27.51 20-24 25.230000000000004 23.525 23.595 27.650000000000002 25-29 26.171777299784903 23.420539242659196 23.240458206192788 27.167225251363114 30-34 25.597798899449725 24.392196098049023 22.671335667833915 27.33866933466733 35-39 25.97727613994694 23.729916412232843 23.109264727964362 27.183542719855847 40-44 25.25065169440545 23.937236815720876 23.360737918588327 27.45137357128534 45-49 26.224162151314466 23.28918322295806 22.97812562713225 27.50852899859522 50-54 26.249310811488147 23.818354969675706 22.825923512605883 27.106410706230267 55-59 26.231155778894472 23.959798994974875 23.231155778894472 26.57788944723618 60-64 26.220215701028344 23.5966892400301 22.969651366942564 27.213443691998997 65-69 26.75085530287784 23.173676796136043 23.576172268061985 26.49929563292413 70-74 26.189163450453613 24.154177735451857 22.51516214726079 27.141496666833742 75-79 26.943524927274552 23.17183268131207 22.895977530344066 26.988664861069317 80-84 26.619605487133274 23.64073295283869 22.789626514468807 26.95003504555923 85-89 27.07812343703111 22.476743022906874 23.357007102130638 27.088126437931383 90-94 27.185 23.380000000000003 23.11 26.325 95-99 26.745 22.994999999999997 23.31 26.950000000000003 100-104 26.43 23.615 22.905 27.05 105-109 27.29 23.150000000000002 23.225 26.334999999999997 110-114 26.877687768776877 23.24732473247325 23.047304730473048 26.82768276827683 115-119 27.175 23.865 22.49 26.47 120-124 27.169999999999998 23.7 22.345000000000002 26.784999999999997 125-129 27.075 23.695 22.384999999999998 26.845000000000002 130-134 27.91 24.05 21.86 26.179999999999996 135-139 27.49 23.765 22.28 26.465 140-144 27.250000000000004 23.56 22.11 27.08 145-149 27.785 24.245 21.61 26.36 150-151 26.650000000000002 24.762500000000003 22.0875 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 1.0 29 2.0 30 3.5 31 9.0 32 14.5 33 16.5 34 16.5 35 26.0 36 33.0 37 50.5 38 64.5 39 67.0 40 76.5 41 98.5 42 134.0 43 135.5 44 129.5 45 143.0 46 145.0 47 149.5 48 149.5 49 151.0 50 154.0 51 136.5 52 120.0 53 117.0 54 113.5 55 107.5 56 118.5 57 110.5 58 96.5 59 104.0 60 99.5 61 99.5 62 104.0 63 92.5 64 80.0 65 71.5 66 76.0 67 73.5 68 61.0 69 65.5 70 65.5 71 55.0 72 52.5 73 45.5 74 34.0 75 29.0 76 22.0 77 17.0 78 17.5 79 14.5 80 9.5 81 4.0 82 2.5 83 5.0 84 3.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.625 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.045 30-34 0.05 35-39 0.105 40-44 0.26 45-49 0.33999999999999997 50-54 0.245 55-59 0.5 60-64 0.325 65-69 0.62 70-74 0.245 75-79 0.31 80-84 0.13 85-89 0.03 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.35211267605633806 0.7000000000000001 3 0.12575452716297786 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0125 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.025 0.0 0.0 0.0 0.025 20-21 0.025 0.0 0.0 0.0 0.025 22-23 0.025 0.0 0.0 0.0 0.025 24-25 0.025 0.0 0.0 0.0 0.025 26-27 0.025 0.0 0.0 0.0 0.025 28-29 0.025 0.0 0.0 0.0 0.025 30-31 0.025 0.0 0.0 0.0 0.025 32-33 0.025 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.025 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.037500000000000006 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.075 0.0 0.0 0.0 0.025 80-81 0.1 0.0 0.0 0.0 0.025 82-83 0.125 0.0 0.0 0.0 0.025 84-85 0.125 0.0 0.0 0.0 0.025 86-87 0.125 0.0 0.0 0.0 0.025 88-89 0.175 0.0 0.0 0.0 0.025 90-91 0.2 0.0 0.0 0.0 0.025 92-93 0.225 0.0 0.0 0.0 0.025 94-95 0.30000000000000004 0.0 0.0 0.0 0.025 96-97 0.3625 0.0 0.0 0.0 0.025 98-99 0.4 0.0 0.0 0.0 0.025 100-101 0.4375 0.0 0.0 0.0 0.025 102-103 0.5125 0.0 0.0 0.0 0.025 104-105 0.6125 0.0 0.0 0.0 0.025 106-107 0.7625 0.0 0.0 0.0 0.025 108-109 0.95 0.0 0.0 0.0 0.025 110-111 1.15 0.0 0.0 0.0 0.025 112-113 1.4 0.0 0.0 0.0 0.025 114-115 1.6625 0.0 0.0 0.0 0.025 116-117 2.0625 0.0 0.0 0.0 0.025 118-119 2.575 0.0 0.0 0.0 0.025 120-121 3.0875 0.0 0.0 0.0 0.025 122-123 3.5 0.0 0.0 0.0 0.025 124-125 4.1 0.0 0.0 0.0 0.025 126-127 4.625 0.0 0.0 0.0 0.025 128-129 5.262499999999999 0.0 0.0 0.0 0.025 130-131 5.9875 0.0 0.0 0.0 0.025 132-133 6.6125 0.0 0.0 0.0 0.025 134-135 7.3625 0.0 0.0 0.0 0.025 136-137 8.0125 0.0 0.0 0.0 0.025 138-139 8.725 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458914 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458914_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.94575 32.0 32.0 32.0 32.0 32.0 2 30.73675 32.0 32.0 32.0 32.0 32.0 3 30.5835 32.0 32.0 32.0 32.0 32.0 4 30.777 32.0 32.0 32.0 32.0 32.0 5 30.7625 32.0 32.0 32.0 32.0 32.0 6 33.8685 36.0 36.0 36.0 32.0 36.0 7 33.928 36.0 36.0 36.0 32.0 36.0 8 34.0875 36.0 36.0 36.0 32.0 36.0 9 33.845 36.0 36.0 36.0 32.0 36.0 10-14 33.91515 36.0 36.0 36.0 32.0 36.0 15-19 33.8163 36.0 36.0 36.0 31.0 36.0 20-24 33.7883 36.0 36.0 36.0 29.0 36.0 25-29 33.6314 36.0 36.0 36.0 25.8 36.0 30-34 33.5903 36.0 36.0 36.0 25.6 36.0 35-39 33.44895 36.0 36.0 36.0 25.4 36.0 40-44 33.54325000000001 36.0 36.0 36.0 28.0 36.0 45-49 33.328950000000006 36.0 36.0 36.0 22.0 36.0 50-54 33.10295000000001 36.0 36.0 36.0 18.2 36.0 55-59 32.91175 36.0 36.0 36.0 15.4 36.0 60-64 32.64165 36.0 36.0 36.0 14.0 36.0 65-69 32.32465 36.0 32.0 36.0 14.0 36.0 70-74 31.981099999999998 36.0 32.8 36.0 14.0 36.0 75-79 31.7262 36.0 32.0 36.0 14.0 36.0 80-84 31.545500000000004 36.0 32.0 36.0 14.0 36.0 85-89 31.54985 36.0 32.0 36.0 14.0 36.0 90-94 31.241200000000003 36.0 32.0 36.0 14.0 36.0 95-99 31.160149999999998 36.0 32.0 36.0 14.0 36.0 100-104 31.17255 36.0 32.0 36.0 14.0 36.0 105-109 31.06035 36.0 32.0 36.0 14.0 36.0 110-114 30.84495 36.0 32.0 36.0 14.0 36.0 115-119 30.518700000000003 36.0 28.0 36.0 14.0 36.0 120-124 30.338900000000002 36.0 27.0 36.0 14.0 36.0 125-129 30.09805 36.0 27.0 36.0 14.0 36.0 130-134 29.54735 33.6 27.0 36.0 14.0 36.0 135-139 28.90395 32.0 27.0 36.0 14.0 36.0 140-144 28.85765 32.0 27.0 36.0 14.0 36.0 145-149 28.903399999999998 32.0 25.8 36.0 14.0 36.0 150-151 25.930999999999997 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 7.0 10 7.0 11 17.0 12 12.0 13 5.0 14 6.0 15 11.0 16 9.0 17 16.0 18 19.0 19 12.0 20 14.0 21 9.0 22 36.0 23 40.0 24 57.0 25 76.0 26 100.0 27 133.0 28 152.0 29 186.0 30 257.0 31 300.0 32 429.0 33 557.0 34 858.0 35 673.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.922922922922922 10.635635635635635 12.087087087087086 54.35435435435435 2 22.55563890972743 19.004751187796952 34.78369592398099 23.655913978494624 3 23.775 21.925 22.7 31.6 4 28.125 26.650000000000002 17.2 28.025 5 29.925 28.349999999999998 19.55 22.175 6 24.125 32.95 20.150000000000002 22.775000000000002 7 21.95 15.55 36.6 25.900000000000002 8 20.3 20.625 26.575 32.5 9 23.05 19.175 27.775 30.0 10-14 25.215 24.83 22.615 27.339999999999996 15-19 25.245 23.89 22.98 27.884999999999998 20-24 25.915 23.630000000000003 23.175 27.279999999999998 25-29 25.52 24.065 23.064999999999998 27.35 30-34 25.611647570921097 24.671036173512782 22.424575974383348 27.29274028118277 35-39 26.187368209659606 24.35987548950698 22.361682899889548 27.09107340094387 40-44 25.663761146177738 23.875363190061115 23.38943993587817 27.071435727882974 45-49 26.016996027555688 24.41796148237542 22.195404032785238 27.369638457283653 50-54 25.836280949974732 24.219302678120265 22.76402223345124 27.180394138453767 55-59 26.067211625794734 24.058936320516704 22.348370168533656 27.52548188515491 60-64 26.338177951081178 23.37063857801185 23.117435559831872 27.173747911075104 65-69 26.48163182463974 23.706109194235843 22.670996549624515 27.141262431499896 70-74 26.022929936305733 23.704458598726113 22.81783439490446 27.454777070063695 75-79 26.911877394636015 23.126436781609193 23.05491698595147 26.90676883780332 80-84 26.73231779248089 23.685695235164385 22.464994614556087 27.116992357798637 85-89 26.564580559254324 23.61466762265697 22.805490115743112 27.01526170234559 90-94 26.49476063283337 23.607972056708444 22.98643928498048 26.910828025477706 95-99 26.649563878912264 23.247819394561315 23.242688558234992 26.85992816829143 100-104 26.49278636340299 23.48924372336602 23.309544591056117 26.70842532217487 105-109 26.521292970754235 23.31452026680349 23.237557721908672 26.926629040533605 110-114 27.021189055749844 24.012548858259617 22.82452170335322 26.14174038263732 115-119 27.30458082135312 23.939815530478693 22.285773174627714 26.469830473540473 120-124 27.049899375612778 23.814438309510294 22.29217193869653 26.8434903761804 125-129 27.27460711331679 24.105665839536808 21.991315136476427 26.628411910669975 130-134 27.8047520661157 23.93595041322314 22.262396694214875 25.99690082644628 135-139 28.27593339538732 24.26310890474713 21.853345744130728 25.60761195573482 140-144 29.11483870967742 24.113548387096774 22.08516129032258 24.686451612903227 145-149 29.033923684618163 24.26292146434657 21.95487168895544 24.748283162079826 150-151 28.650742414460943 24.88056810845707 22.182052937378955 24.286636539703036 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.5 15 2.0 16 2.0 17 1.5 18 1.0 19 2.0 20 1.5 21 1.0 22 4.0 23 4.0 24 5.5 25 7.5 26 5.0 27 4.0 28 4.0 29 8.0 30 10.0 31 8.5 32 11.5 33 16.5 34 21.5 35 31.0 36 38.5 37 45.5 38 55.5 39 69.0 40 90.0 41 110.5 42 120.0 43 122.5 44 130.5 45 141.5 46 147.5 47 146.0 48 145.5 49 138.5 50 132.5 51 135.5 52 125.5 53 107.0 54 98.5 55 99.0 56 107.5 57 110.5 58 104.5 59 106.0 60 103.0 61 93.5 62 89.0 63 88.0 64 89.0 65 87.0 66 85.0 67 76.0 68 61.5 69 63.0 70 62.0 71 56.5 72 50.5 73 41.0 74 38.5 75 33.5 76 25.0 77 18.0 78 14.0 79 12.5 80 9.5 81 5.0 82 4.0 83 3.5 84 2.5 85 1.5 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.065 35-39 0.41000000000000003 40-44 0.19 45-49 0.565 50-54 1.05 55-59 0.91 60-64 1.265 65-69 1.46 70-74 1.875 75-79 2.125 80-84 2.5149999999999997 85-89 2.37 90-94 2.6599999999999997 95-99 2.55 100-104 2.6149999999999998 105-109 2.55 110-114 2.78 115-119 2.965 120-124 3.105 125-129 3.2800000000000002 130-134 3.2 135-139 3.3099999999999996 140-144 3.125 145-149 3.1649999999999996 150-151 3.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09159727479182 98.175 2 0.8831693161746152 1.7500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1375000000000002 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 5.0125 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.225 0.0 0.0 0.0 0.0 134-135 6.925 0.0 0.0 0.0 0.0 136-137 7.525 0.0 0.0 0.0 0.0 138-139 8.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGAT 10 0.0071372455 142.88751 8 TCACCAT 10 0.0071372455 142.88751 7 ACAATCA 10 0.0071372455 142.88751 4 CCCCCCC 30 0.0013557628 24.425213 135-139 >>END_MODULE Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra Read 1360137 spots for SRR14458914.sra Written 1360137 spots for SRR14458914.sra Read 1360126 spots for SRR14458914.sra Written 1360126 spots for SRR14458914.sra SRR ids: ['SRR14458914.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9_hrken1 SRR14458914.sra spots: 27202531 blocks: [[1, 1360126], [1360127, 2720252], [2720253, 4080378], [4080379, 5440504], [5440505, 6800630], [6800631, 8160756], [8160757, 9520882], [9520883, 10881008], [10881009, 12241134], [12241135, 13601260], [13601261, 14961386], [14961387, 16321512], [16321513, 17681638], [17681639, 19041764], [19041765, 20401890], [20401891, 21762016], [21762017, 23122142], [23122143, 24482268], [24482269, 25842394], [25842395, 27202531]] SRR14458914 file size 9222909 SRR14458914 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458914 SRR14458914_1.fastq SRR14458914_2.fastq Input file: SRR14458914_1.fastq Paired file: SRR14458914_2.fastq trimmed: SRR14458914-trimmed-pair1.fastq, SRR14458914-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:56:44 2024 >> started Fri Dec 6 09:57:19 2024 >> done (35.538s) 27202531 read pairs processed; of these: 4558 ( 0.02%) short read pairs filtered out after trimming by size control 1224 ( 0.00%) empty read pairs filtered out after trimming by size control 27196749 (99.98%) read pairs available; of these: 4593017 (16.89%) trimmed read pairs available after processing 22603732 (83.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 227 0.00% 19 214 0.00% 20 184 0.00% 21 169 0.00% 22 193 0.00% 23 198 0.00% 24 193 0.00% 25 142 0.00% 26 176 0.00% 27 145 0.00% 28 184 0.00% 29 162 0.00% 30 172 0.00% 31 148 0.00% 32 153 0.00% 33 139 0.00% 34 353 0.00% 35 167 0.00% 36 151 0.00% 37 126 0.00% 38 170 0.00% 39 135 0.00% 40 128 0.00% 41 168 0.00% 42 158 0.00% 43 142 0.00% 44 134 0.00% 45 172 0.00% 46 148 0.00% 47 190 0.00% 48 183 0.00% 49 197 0.00% 50 160 0.00% 51 185 0.00% 52 213 0.00% 53 218 0.00% 54 211 0.00% 55 218 0.00% 56 205 0.00% 57 249 0.00% 58 298 0.00% 59 286 0.00% 60 363 0.00% 61 368 0.00% 62 365 0.00% 63 387 0.00% 64 382 0.00% 65 461 0.00% 66 434 0.00% 67 492 0.00% 68 566 0.00% 69 654 0.00% 70 751 0.00% 71 838 0.00% 72 963 0.00% 73 923 0.00% 74 1008 0.00% 75 1073 0.00% 76 1207 0.00% 77 1351 0.00% 78 1512 0.01% 79 1723 0.01% 80 1909 0.01% 81 2217 0.01% 82 2517 0.01% 83 2975 0.01% 84 3185 0.01% 85 3485 0.01% 86 3645 0.01% 87 4360 0.02% 88 5655 0.02% 89 7755 0.03% 90 9229 0.03% 91 8687 0.03% 92 8331 0.03% 93 9168 0.03% 94 9871 0.04% 95 11937 0.04% 96 12519 0.05% 97 13160 0.05% 98 14136 0.05% 99 16932 0.06% 100 19116 0.07% 101 19815 0.07% 102 20370 0.07% 103 22982 0.08% 104 25114 0.09% 105 26160 0.10% 106 28612 0.11% 107 29661 0.11% 108 31310 0.12% 109 34439 0.13% 110 37675 0.14% 111 39550 0.15% 112 43940 0.16% 113 46626 0.17% 114 51558 0.19% 115 55455 0.20% 116 57033 0.21% 117 58045 0.21% 118 60208 0.22% 119 63660 0.23% 120 66861 0.25% 121 71512 0.26% 122 77243 0.28% 123 81264 0.30% 124 86614 0.32% 125 91044 0.33% 126 92850 0.34% 127 95332 0.35% 128 98235 0.36% 129 99717 0.37% 130 104342 0.38% 131 106656 0.39% 132 110730 0.41% 133 117676 0.43% 134 122720 0.45% 135 125069 0.46% 136 126706 0.47% 137 127607 0.47% 138 129054 0.47% 139 130804 0.48% 140 132389 0.49% 141 133213 0.49% 142 138868 0.51% 143 141173 0.52% 144 142965 0.53% 145 146068 0.54% 146 143565 0.53% 147 148142 0.54% 148 155075 0.57% 149 149341 0.55% 150 153595 0.56% 151 22603732 83.11% 27196749 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=10 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=22.38 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.4 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=11 prefix-density=0.48 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=26.67 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCA SRR14458914 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:58:07 Started mapping on | Dec 06 09:58:07 Finished on | Dec 06 10:02:35 Mapping speed, Million of reads per hour | 365.33 Number of input reads | 27196749 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 23999874 Uniquely mapped reads % | 88.25% Average mapped length | 291.36 Number of splices: Total | 23515211 Number of splices: Annotated (sjdb) | 22216590 Number of splices: GT/AG | 23196632 Number of splices: GC/AG | 267584 Number of splices: AT/AC | 8928 Number of splices: Non-canonical | 42067 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 606914 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 103150 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.12% % of reads unmapped: other | 4.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2590412 2590412 2590412 N_multimapping 606914 606914 606914 N_noFeature 816844 12125982 12256405 N_ambiguous 552100 63105 60530 UnstrandedReadsAssigned:22630930 PositiveStrandReadsAssigned:11810787 NegativeStrandReadsAssigned:11682939 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458914 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458914-trimmed-pair1.fastq SRR14458914-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,196,749 reads, 24,451,554 reads pseudoaligned [quant] estimated average fragment length: 233.772 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR14458914.ke.tsv 35125 SRR14458914.se.tsv 88098 total ==> SRR14458914.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.558 0 0 PNS24247 1044 811.228 34.3789 2.1853 PNS24249 1928 1695.23 134.246 4.08352 PNS24246 1044 811.228 34.3789 2.1853 PNS24248 1044 811.228 34.3789 2.1853 PNS24244 1471 1238.23 49.6174 2.06631 PNS24243 293 104.543 9 4.43926 KQK14069 1603 1370.23 9531.63 358.704 KQK14071 474 253.595 293.139 59.6065 ==> SRR14458914.se.tsv <== BRADI_1g14170v3 10265 BRADI_1g53295v3 58 BRADI_1g59795v3 395 BRADI_1g07683v3 0 BRADI_1g00485v3 56 BRADI_1g20270v3 2804 BRADI_1g74790v3 823 BRADI_1g09890v3 6 BRADI_1g77505v3 533 BRADI_1g48960v3 0 SRR14458914 completed mapping pipeline successfully