Starting /dee2/code/volunteer_pipeline.sh SRR14458915 current disk space = 1552298889216 free memory = 1607260096 SRR14458915 SRAfilesize 3e13911a081e8f6b708f5eac3e64b0f6 SRR14458915.sra SRR14458915.sra file validated SRR14458915 is paired end SRR14458915 is conventional basespace SRR14458915 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.18 32.0 32.0 32.0 32.0 32.0 2 31.15175 32.0 32.0 32.0 32.0 32.0 3 31.1905 32.0 32.0 32.0 32.0 32.0 4 31.30225 32.0 32.0 32.0 32.0 32.0 5 31.36025 32.0 32.0 32.0 32.0 32.0 6 34.30625 36.0 36.0 36.0 32.0 36.0 7 34.586 36.0 36.0 36.0 32.0 36.0 8 34.41775 36.0 36.0 36.0 32.0 36.0 9 34.39225 36.0 36.0 36.0 32.0 36.0 10-14 34.52975 36.0 36.0 36.0 32.0 36.0 15-19 34.49895 36.0 36.0 36.0 32.0 36.0 20-24 34.443850000000005 36.0 36.0 36.0 32.0 36.0 25-29 34.2889 36.0 36.0 36.0 32.0 36.0 30-34 34.1255 36.0 36.0 36.0 32.0 36.0 35-39 34.027 36.0 36.0 36.0 32.0 36.0 40-44 33.9244 36.0 36.0 36.0 32.0 36.0 45-49 33.879650000000005 36.0 36.0 36.0 32.0 36.0 50-54 33.798500000000004 36.0 36.0 36.0 30.0 36.0 55-59 33.5504 36.0 36.0 36.0 27.0 36.0 60-64 33.4097 36.0 36.0 36.0 27.0 36.0 65-69 33.33305 36.0 36.0 36.0 22.2 36.0 70-74 33.182249999999996 36.0 33.6 36.0 25.8 36.0 75-79 33.0068 36.0 32.0 36.0 23.4 36.0 80-84 32.987049999999996 36.0 32.0 36.0 22.2 36.0 85-89 32.91415 36.0 32.0 36.0 21.0 36.0 90-94 32.89645 36.0 32.0 36.0 19.6 36.0 95-99 32.69735 36.0 32.0 36.0 19.6 36.0 100-104 32.6853 36.0 32.0 36.0 16.8 36.0 105-109 32.5083 36.0 32.0 36.0 15.4 36.0 110-114 32.4816 36.0 32.0 36.0 14.0 36.0 115-119 32.3929 36.0 32.0 36.0 14.0 36.0 120-124 32.2571 36.0 32.0 36.0 14.0 36.0 125-129 32.07195 36.0 32.0 36.0 14.0 36.0 130-134 31.9497 36.0 32.0 36.0 14.0 36.0 135-139 31.78705 36.0 32.0 36.0 14.0 36.0 140-144 31.289949999999997 36.0 29.0 36.0 14.0 36.0 145-149 30.87805 36.0 27.0 36.0 14.0 36.0 150-151 28.513125000000002 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 1.0 20 3.0 21 6.0 22 18.0 23 16.0 24 33.0 25 41.0 26 62.0 27 96.0 28 134.0 29 158.0 30 223.0 31 275.0 32 368.0 33 578.0 34 955.0 35 1031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.925 11.85 13.425 51.800000000000004 2 23.150000000000002 18.175 34.949999999999996 23.724999999999998 3 22.7 22.7 24.349999999999998 30.25 4 26.8 27.075 17.325 28.799999999999997 5 28.325 30.55 19.6 21.525 6 22.986198243412797 35.03136762860728 18.54454203262233 23.43789209535759 7 21.55 16.650000000000002 36.75 25.05 8 21.05 19.45 25.525 33.975 9 23.25 20.275000000000002 28.425 28.050000000000004 10-14 25.115 24.15 22.465 28.27 15-19 25.77 23.195 23.575 27.46 20-24 25.775 23.94 22.965 27.32 25-29 26.046511627906977 23.48087021755439 22.705676419104776 27.76694173543386 30-34 25.931669251163026 23.970786854084338 23.035365914661597 27.06217798009104 35-39 25.828245420878794 23.406065458913023 23.045741167050345 27.719947953157842 40-44 26.000901939169214 23.64583855288871 23.315127524176983 27.038131983765094 45-49 25.969206078539546 23.185716435127137 23.120517578614773 27.724559907718543 50-54 26.0289767884895 23.381962199829548 22.735248408281947 27.853812603399007 55-59 26.646917051616793 23.08696525406708 23.00160674834304 27.264510945973086 60-64 26.423233184531274 23.6846065105081 22.721572954807645 27.17058735015298 65-69 26.383235338459222 23.644404241419167 23.001155836976732 26.971204583144882 70-74 26.42975289459175 23.377274322089118 23.0113778757957 27.181594907523433 75-79 26.719125902165196 23.200681635926223 22.684442662389735 27.395749799518843 80-84 26.759787724041256 23.510563732852706 22.544307599879843 27.185340943226194 85-89 26.898449224612307 22.64632316158079 23.026513256628313 27.428714357178592 90-94 26.671333566678335 23.086154307715386 23.086154307715386 27.156357817890896 95-99 27.02135106755338 22.851142557127858 22.97114855742787 27.156357817890896 100-104 27.114067110066507 22.93844076611492 22.863429514427164 27.084062609391406 105-109 27.395000000000003 23.22 22.49 26.895000000000003 110-114 26.826706676669165 23.640910227556887 22.115528882220556 27.41685421355339 115-119 26.842684268426844 23.347334733473346 22.96229622962296 26.84768476847685 120-124 27.255000000000003 23.46 22.3 26.985 125-129 27.38136906845342 23.721186059302966 22.32111605580279 26.57632881644082 130-134 27.96 24.195 21.83 26.015 135-139 27.976398819940997 24.046202310115504 21.266063303165158 26.711335566778338 140-144 27.339999999999996 23.945 21.905 26.810000000000002 145-149 27.015 24.525 21.81 26.650000000000002 150-151 26.375 24.212500000000002 21.875 27.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.0 27 1.5 28 2.5 29 3.5 30 5.0 31 8.5 32 9.5 33 12.5 34 19.0 35 26.5 36 35.0 37 46.0 38 61.5 39 75.0 40 78.5 41 95.0 42 114.5 43 125.0 44 129.5 45 141.5 46 153.5 47 158.0 48 157.5 49 141.0 50 121.5 51 108.0 52 111.0 53 107.0 54 105.0 55 109.0 56 105.0 57 110.0 58 118.5 59 111.0 60 104.0 61 111.5 62 111.0 63 95.0 64 81.5 65 78.0 66 78.0 67 83.5 68 86.0 69 81.5 70 70.5 71 59.0 72 55.0 73 44.0 74 31.0 75 28.5 76 22.0 77 17.0 78 15.0 79 11.5 80 8.5 81 4.5 82 4.5 83 2.5 84 1.0 85 1.5 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.375 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.025 30-34 0.045 35-39 0.09 40-44 0.215 45-49 0.305 50-54 0.265 55-59 0.42 60-64 0.315 65-69 0.505 70-74 0.245 75-79 0.24 80-84 0.13 85-89 0.05 90-94 0.005 95-99 0.005 100-104 0.015 105-109 0.0 110-114 0.025 115-119 0.01 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0909090909091 98.1 2 0.8333333333333334 1.6500000000000001 3 0.050505050505050504 0.15 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 7.175 0.0 0.0 0.0 0.0 134-135 7.8625 0.0 0.0 0.0 0.0 136-137 8.524999999999999 0.0 0.0 0.0 0.0 138-139 9.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458915 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458915_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.84275 32.0 32.0 32.0 32.0 32.0 2 30.36125 32.0 32.0 32.0 21.0 32.0 3 30.517 32.0 32.0 32.0 32.0 32.0 4 30.675 32.0 32.0 32.0 32.0 32.0 5 30.41575 32.0 32.0 32.0 21.0 32.0 6 33.61075 36.0 36.0 36.0 21.0 36.0 7 33.6825 36.0 36.0 36.0 32.0 36.0 8 33.7195 36.0 36.0 36.0 32.0 36.0 9 33.71125 36.0 36.0 36.0 32.0 36.0 10-14 33.590199999999996 36.0 36.0 36.0 27.6 36.0 15-19 33.5552 36.0 36.0 36.0 24.4 36.0 20-24 33.44575 36.0 36.0 36.0 22.2 36.0 25-29 33.428700000000006 36.0 36.0 36.0 21.0 36.0 30-34 33.331900000000005 36.0 36.0 36.0 21.0 36.0 35-39 33.15925 36.0 36.0 36.0 15.4 36.0 40-44 33.17465 36.0 36.0 36.0 15.4 36.0 45-49 32.97375 36.0 36.0 36.0 14.0 36.0 50-54 32.9325 36.0 36.0 36.0 14.0 36.0 55-59 32.7668 36.0 36.0 36.0 14.0 36.0 60-64 32.5746 36.0 36.0 36.0 14.0 36.0 65-69 32.21725 36.0 32.0 36.0 14.0 36.0 70-74 31.842599999999997 36.0 32.8 36.0 14.0 36.0 75-79 31.58345 36.0 32.0 36.0 14.0 36.0 80-84 31.492900000000002 36.0 32.0 36.0 14.0 36.0 85-89 31.48815 36.0 32.0 36.0 14.0 36.0 90-94 31.1501 36.0 32.0 36.0 14.0 36.0 95-99 31.06665 36.0 32.0 36.0 14.0 36.0 100-104 31.1281 36.0 32.0 36.0 14.0 36.0 105-109 31.0177 36.0 32.0 36.0 14.0 36.0 110-114 30.841949999999997 36.0 31.0 36.0 14.0 36.0 115-119 30.527800000000003 36.0 27.0 36.0 14.0 36.0 120-124 30.428800000000003 36.0 27.0 36.0 14.0 36.0 125-129 30.12355 36.0 27.0 36.0 14.0 36.0 130-134 29.64365 34.4 27.0 36.0 14.0 36.0 135-139 28.978949999999998 32.0 27.0 36.0 14.0 36.0 140-144 28.964499999999997 32.0 27.0 36.0 14.0 36.0 145-149 28.956799999999998 32.0 27.0 36.0 14.0 36.0 150-151 26.185875000000003 29.5 17.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 4.0 9 7.0 10 4.0 11 5.0 12 8.0 13 3.0 14 7.0 15 7.0 16 10.0 17 9.0 18 12.0 19 9.0 20 11.0 21 16.0 22 29.0 23 54.0 24 60.0 25 73.0 26 142.0 27 123.0 28 182.0 29 207.0 30 292.0 31 364.0 32 423.0 33 569.0 34 854.0 35 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.25 10.674999999999999 10.875 55.2 2 24.95 16.675 35.25 23.125 3 23.075000000000003 21.325 24.275 31.324999999999996 4 28.075 27.400000000000002 16.675 27.85 5 27.325 30.45 18.975 23.25 6 22.775000000000002 34.300000000000004 19.1 23.825 7 21.625 15.5 38.0 24.875 8 21.85 19.875 26.6 31.674999999999997 9 22.125 19.1 28.675 30.099999999999998 10-14 25.19 24.44 23.41 26.96 15-19 24.8 23.669999999999998 23.305 28.225 20-24 25.669999999999998 24.015 23.64 26.674999999999997 25-29 25.965 24.335 22.925 26.775 30-34 25.681966064367582 23.44962210320837 23.629811301866958 27.238600530557083 35-39 26.069941297476294 23.912498118508854 23.20004013847775 26.817520445537102 40-44 26.709754997745378 23.633448569567612 22.425973245152562 27.230823187534448 45-49 26.26211885266489 23.30838398553273 22.856281709951272 27.57321545185111 50-54 26.189876605389074 23.54066985645933 23.17300428103752 27.096449257114074 55-59 27.163413161601934 23.249144697122155 22.821493258200846 26.765948883075062 60-64 26.48171500630517 22.960907944514503 23.293820933165197 27.26355611601513 65-69 26.60471693348821 22.958436442603908 23.10994394222514 27.32690268168274 70-74 27.053336037314946 23.28635165280876 22.764145203812614 26.89616710606368 75-79 26.861350939563227 23.412899949212797 22.788217369222956 26.937531742001013 80-84 27.009417154492237 23.013489437515908 23.130567574446424 26.84652583354543 85-89 26.81177846717184 23.287392564715457 22.946651070538575 26.954177897574123 90-94 26.44691257387406 23.461381699612797 22.804157326268594 27.28754840024455 95-99 26.85100315714431 22.975863122517566 22.83837457989612 27.334759140442 100-104 27.345421208108384 23.47967810940206 22.450850565345828 26.724050117143733 105-109 27.3555612115042 22.916772715703743 22.957495545940443 26.770170526851615 110-114 27.319088173797745 23.560609924014482 22.13269417104391 26.987607731143864 115-119 27.421332243563544 23.1661217817736 22.70126685737638 26.711279117286473 120-124 27.474044903595356 23.16780033754411 22.87117066434818 26.48698409451235 125-129 28.295029943184723 23.355684086604903 22.035112862773197 26.31417310743717 130-134 28.224815724815727 24.165642915642916 22.08742833742834 25.522113022113025 135-139 28.49459611739999 23.561952568765047 22.542642011985865 25.400809301849105 140-144 29.263674973136162 23.43550120247659 21.946476999437138 25.35434682495011 145-149 29.433440810686317 24.028865346230617 21.536414350785606 25.001279492297456 150-151 29.701702726923568 23.88938676225835 22.148252464473178 24.2606580463449 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 3.0 20 3.0 21 2.5 22 2.5 23 3.0 24 5.0 25 4.5 26 3.5 27 3.0 28 4.0 29 4.5 30 6.0 31 9.5 32 10.0 33 15.5 34 20.5 35 26.0 36 39.0 37 56.5 38 69.5 39 77.0 40 84.5 41 84.0 42 105.0 43 131.0 44 129.0 45 138.5 46 152.0 47 152.5 48 140.5 49 129.5 50 127.0 51 125.5 52 124.5 53 116.0 54 106.0 55 101.5 56 100.0 57 107.5 58 114.5 59 119.0 60 110.5 61 91.5 62 97.5 63 99.5 64 89.5 65 78.0 66 75.5 67 71.5 68 66.5 69 69.0 70 62.5 71 56.5 72 49.0 73 41.5 74 39.0 75 32.5 76 22.5 77 19.5 78 16.5 79 12.0 80 11.0 81 10.0 82 5.5 83 1.0 84 1.5 85 3.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.105 35-39 0.345 40-44 0.20500000000000002 45-49 0.46499999999999997 50-54 0.7250000000000001 55-59 0.62 60-64 0.8750000000000001 65-69 0.9950000000000001 70-74 1.38 75-79 1.55 80-84 1.775 85-89 1.685 90-94 1.8599999999999999 95-99 1.81 100-104 1.83 105-109 1.775 110-114 1.955 115-119 2.12 120-124 2.235 125-129 2.315 130-134 2.32 135-139 2.385 140-144 2.2849999999999997 145-149 2.305 150-151 2.3625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47089947089947 98.7 2 0.3527336860670194 0.7000000000000001 3 0.15117157974300832 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.02519526329050139 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.675 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.8625 0.0 0.0 0.0 0.0 132-133 6.5125 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.887499999999999 0.0 0.0 0.0 0.0 138-139 8.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049249 spots for SRR14458915.sra Written 1049249 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra Read 1049248 spots for SRR14458915.sra Written 1049248 spots for SRR14458915.sra SRR ids: ['SRR14458915.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x1g8jwlu SRR14458915.sra spots: 20984961 blocks: [[1, 1049248], [1049249, 2098496], [2098497, 3147744], [3147745, 4196992], [4196993, 5246240], [5246241, 6295488], [6295489, 7344736], [7344737, 8393984], [8393985, 9443232], [9443233, 10492480], [10492481, 11541728], [11541729, 12590976], [12590977, 13640224], [13640225, 14689472], [14689473, 15738720], [15738721, 16787968], [16787969, 17837216], [17837217, 18886464], [18886465, 19935712], [19935713, 20984961]] SRR14458915 file size 7109907 SRR14458915 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458915 SRR14458915_1.fastq SRR14458915_2.fastq Input file: SRR14458915_1.fastq Paired file: SRR14458915_2.fastq trimmed: SRR14458915-trimmed-pair1.fastq, SRR14458915-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:56:39 2024 >> started Fri Dec 6 09:57:03 2024 >> done (23.938s) 20984961 read pairs processed; of these: 4788 ( 0.02%) short read pairs filtered out after trimming by size control 837 ( 0.00%) empty read pairs filtered out after trimming by size control 20979336 (99.97%) read pairs available; of these: 3431963 (16.36%) trimmed read pairs available after processing 17547373 (83.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 223 0.00% 19 205 0.00% 20 201 0.00% 21 190 0.00% 22 198 0.00% 23 185 0.00% 24 209 0.00% 25 162 0.00% 26 143 0.00% 27 146 0.00% 28 129 0.00% 29 167 0.00% 30 137 0.00% 31 138 0.00% 32 159 0.00% 33 150 0.00% 34 334 0.00% 35 175 0.00% 36 163 0.00% 37 127 0.00% 38 151 0.00% 39 139 0.00% 40 130 0.00% 41 164 0.00% 42 135 0.00% 43 147 0.00% 44 147 0.00% 45 143 0.00% 46 124 0.00% 47 146 0.00% 48 172 0.00% 49 192 0.00% 50 213 0.00% 51 165 0.00% 52 210 0.00% 53 174 0.00% 54 185 0.00% 55 178 0.00% 56 193 0.00% 57 226 0.00% 58 246 0.00% 59 271 0.00% 60 308 0.00% 61 300 0.00% 62 321 0.00% 63 312 0.00% 64 316 0.00% 65 371 0.00% 66 375 0.00% 67 409 0.00% 68 493 0.00% 69 524 0.00% 70 608 0.00% 71 745 0.00% 72 762 0.00% 73 793 0.00% 74 867 0.00% 75 986 0.00% 76 969 0.00% 77 1104 0.01% 78 1266 0.01% 79 1488 0.01% 80 1680 0.01% 81 1892 0.01% 82 2167 0.01% 83 2430 0.01% 84 2635 0.01% 85 2969 0.01% 86 3244 0.02% 87 3631 0.02% 88 4599 0.02% 89 6406 0.03% 90 7415 0.04% 91 7143 0.03% 92 7081 0.03% 93 7609 0.04% 94 8518 0.04% 95 9816 0.05% 96 10425 0.05% 97 10710 0.05% 98 11752 0.06% 99 13836 0.07% 100 15524 0.07% 101 15979 0.08% 102 16376 0.08% 103 18725 0.09% 104 20459 0.10% 105 20997 0.10% 106 22879 0.11% 107 23795 0.11% 108 24691 0.12% 109 26946 0.13% 110 29788 0.14% 111 30726 0.15% 112 33827 0.16% 113 36191 0.17% 114 39674 0.19% 115 42513 0.20% 116 43109 0.21% 117 43966 0.21% 118 45553 0.22% 119 48500 0.23% 120 49935 0.24% 121 53470 0.25% 122 57639 0.27% 123 60895 0.29% 124 64548 0.31% 125 67191 0.32% 126 69405 0.33% 127 70462 0.34% 128 72394 0.35% 129 73225 0.35% 130 76502 0.36% 131 77580 0.37% 132 81015 0.39% 133 85810 0.41% 134 89878 0.43% 135 91384 0.44% 136 92511 0.44% 137 94207 0.45% 138 94102 0.45% 139 95763 0.46% 140 96475 0.46% 141 97758 0.47% 142 101909 0.49% 143 103614 0.49% 144 105180 0.50% 145 107440 0.51% 146 106186 0.51% 147 109344 0.52% 148 114445 0.55% 149 111156 0.53% 150 113655 0.54% 151 17547373 83.64% 20979336 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=8 prefix-density=0.55 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.14 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=9 prefix-density=0.53 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=18.97 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC SRR14458915 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:58:01 Started mapping on | Dec 06 09:58:01 Finished on | Dec 06 10:01:45 Mapping speed, Million of reads per hour | 337.17 Number of input reads | 20979336 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18813947 Uniquely mapped reads % | 89.68% Average mapped length | 291.25 Number of splices: Total | 18547836 Number of splices: Annotated (sjdb) | 17550547 Number of splices: GT/AG | 18300949 Number of splices: GC/AG | 208764 Number of splices: AT/AC | 6953 Number of splices: Non-canonical | 31170 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412558 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 53083 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.53% % of reads unmapped: other | 2.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1753202 1753202 1753202 N_multimapping 412558 412558 412558 N_noFeature 588333 9487692 9578141 N_ambiguous 428798 49607 47528 UnstrandedReadsAssigned:17796816 PositiveStrandReadsAssigned:9276648 NegativeStrandReadsAssigned:9188278 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458915 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458915-trimmed-pair1.fastq SRR14458915-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,979,336 reads, 19,204,313 reads pseudoaligned [quant] estimated average fragment length: 235.15 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR14458915.ke.tsv 35125 SRR14458915.se.tsv 88098 total ==> SRR14458915.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.095 0 0 PNS24247 1044 809.85 26.6229 2.19431 PNS24249 1928 1693.85 108.758 4.28581 PNS24246 1044 809.85 26.6229 2.19431 PNS24248 1044 809.85 26.6229 2.19431 PNS24244 1471 1236.85 33.3734 1.80107 PNS24243 293 104.095 5 3.20618 KQK14069 1603 1368.85 6575.47 320.64 KQK14071 474 252.344 200.396 53.0082 ==> SRR14458915.se.tsv <== BRADI_1g14170v3 7157 BRADI_1g53295v3 42 BRADI_1g59795v3 291 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 2110 BRADI_1g74790v3 633 BRADI_1g09890v3 8 BRADI_1g77505v3 352 BRADI_1g48960v3 0 SRR14458915 completed mapping pipeline successfully