Starting /dee2/code/volunteer_pipeline.sh SRR14458916 current disk space = 1552300150784 free memory = 1607265120 SRR14458916 SRAfilesize d42b221e103ff6d0517eaff49c2a586f SRR14458916.sra SRR14458916.sra file validated SRR14458916 is paired end SRR14458916 is conventional basespace SRR14458916 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458916_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09625 32.0 32.0 32.0 32.0 32.0 2 31.04625 32.0 32.0 32.0 32.0 32.0 3 31.24925 32.0 32.0 32.0 32.0 32.0 4 31.35525 32.0 32.0 32.0 32.0 32.0 5 31.31725 32.0 32.0 32.0 32.0 32.0 6 34.2915 36.0 36.0 36.0 32.0 36.0 7 34.56225 36.0 36.0 36.0 32.0 36.0 8 34.424 36.0 36.0 36.0 32.0 36.0 9 34.52575 36.0 36.0 36.0 32.0 36.0 10-14 34.47395 36.0 36.0 36.0 32.0 36.0 15-19 34.53255 36.0 36.0 36.0 32.0 36.0 20-24 34.44155 36.0 36.0 36.0 32.0 36.0 25-29 34.29655 36.0 36.0 36.0 32.0 36.0 30-34 34.10475 36.0 36.0 36.0 32.0 36.0 35-39 34.0085 36.0 36.0 36.0 32.0 36.0 40-44 33.91715000000001 36.0 36.0 36.0 32.0 36.0 45-49 33.8648 36.0 36.0 36.0 32.0 36.0 50-54 33.7353 36.0 36.0 36.0 29.0 36.0 55-59 33.553250000000006 36.0 36.0 36.0 26.8 36.0 60-64 33.4158 36.0 36.0 36.0 25.8 36.0 65-69 33.29765 36.0 36.0 36.0 22.2 36.0 70-74 33.081900000000005 36.0 34.4 36.0 22.2 36.0 75-79 32.95440000000001 36.0 32.8 36.0 22.2 36.0 80-84 32.91695 36.0 32.0 36.0 22.2 36.0 85-89 32.858050000000006 36.0 32.0 36.0 18.2 36.0 90-94 32.8807 36.0 32.0 36.0 21.0 36.0 95-99 32.62795 36.0 32.0 36.0 16.8 36.0 100-104 32.56034999999999 36.0 32.0 36.0 15.4 36.0 105-109 32.54905 36.0 32.0 36.0 14.0 36.0 110-114 32.542649999999995 36.0 32.0 36.0 14.0 36.0 115-119 32.37255 36.0 32.0 36.0 14.0 36.0 120-124 32.2673 36.0 32.0 36.0 14.0 36.0 125-129 32.0743 36.0 32.0 36.0 14.0 36.0 130-134 31.918 36.0 32.0 36.0 14.0 36.0 135-139 31.8542 36.0 32.0 36.0 14.0 36.0 140-144 31.32975 36.0 29.0 36.0 14.0 36.0 145-149 31.0077 36.0 27.0 36.0 14.0 36.0 150-151 28.791125 34.0 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 2.0 22 18.0 23 17.0 24 30.0 25 51.0 26 78.0 27 94.0 28 135.0 29 169.0 30 180.0 31 290.0 32 369.0 33 568.0 34 980.0 35 1014.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.150000000000002 12.2 11.75 52.900000000000006 2 21.9 18.4 36.725 22.975 3 21.625 23.3 24.55 30.525000000000002 4 24.75 29.599999999999998 17.775 27.875 5 27.175 30.9 20.825 21.099999999999998 6 23.865630483830532 31.937829029832038 20.230634244171473 23.965906242165957 7 20.75 15.950000000000001 38.1 25.2 8 21.099999999999998 20.575 26.375 31.95 9 22.0 19.625 27.725 30.65 10-14 24.245 24.97 23.169999999999998 27.615000000000002 15-19 25.324999999999996 23.535 23.485 27.655 20-24 25.624999999999996 24.03 23.29 27.055 25-29 25.556277813890695 23.941197059852993 22.911145557277866 27.591379568978446 30-34 25.171292823205803 24.01100275068767 23.905976494123532 26.911727931983 35-39 25.71671586531245 23.72041827187672 23.25011257317256 27.312753289638263 40-44 26.092397016867714 23.704890134641374 23.039191150708245 27.163521697782674 45-49 26.07432635480317 23.184413502955024 23.56005208855054 27.181208053691275 50-54 26.02012717168177 23.286436689530866 23.701997696890803 26.99143844189656 55-59 26.15716363271651 23.333834812697457 23.5193821774234 26.989619377162633 60-64 25.918132170950447 23.55829450373265 23.372914474673077 27.150658850643822 65-69 26.533480574239533 23.63216544523642 23.15530569219958 26.679048288324463 70-74 26.519475317913287 23.340342445178734 22.989886852908782 27.1502953839992 75-79 26.214321482223333 23.10465698547822 23.069604406609916 27.611417125688533 80-84 26.043230261182828 23.89672770939658 23.001100770539377 27.05894125888122 85-89 26.577973392017608 23.507052115634693 23.31699509852956 26.597979393818143 90-94 26.715343068613723 22.939587917583516 22.739547909581916 27.60552110422084 95-99 26.930386077215445 23.194638927785558 23.43468693738748 26.44028805761152 100-104 26.786696674168542 23.52588147036759 22.765691422855713 26.921730432608154 105-109 27.025405081016203 23.214642928585715 23.244648929785956 26.515303060612123 110-114 26.87671917979495 24.046011502875718 22.325581395348838 26.751687921980494 115-119 27.62690672668167 22.820705176294073 22.690672668167043 26.861715428857213 120-124 27.262726272627262 23.187318731873187 22.812281228122814 26.737673767376734 125-129 26.74534906981396 23.549709941988397 22.814562912582517 26.890378075615125 130-134 27.09270927092709 23.757375737573756 22.572257225722574 26.57765776577658 135-139 26.806340317015852 23.43617180859043 22.4261213060653 27.33136656832842 140-144 27.325 23.794999999999998 22.5 26.38 145-149 27.565 23.9 22.345000000000002 26.19 150-151 27.037499999999998 24.7875 22.1375 26.0375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 1.5 28 2.0 29 4.0 30 3.0 31 4.5 32 10.5 33 13.5 34 16.0 35 26.5 36 35.0 37 43.0 38 63.0 39 86.0 40 107.0 41 116.0 42 127.0 43 144.0 44 151.0 45 146.0 46 140.0 47 143.5 48 140.5 49 137.5 50 134.5 51 137.0 52 136.5 53 113.5 54 101.0 55 98.0 56 101.5 57 104.0 58 106.0 59 103.0 60 90.5 61 92.5 62 89.5 63 86.0 64 83.5 65 80.5 66 76.0 67 67.0 68 65.5 69 69.5 70 63.0 71 56.0 72 52.5 73 40.0 74 33.5 75 32.0 76 29.0 77 26.0 78 19.5 79 16.5 80 12.0 81 5.5 82 3.5 83 1.0 84 1.0 85 2.5 86 2.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.025 35-39 0.065 40-44 0.105 45-49 0.16999999999999998 50-54 0.135 55-59 0.295 60-64 0.20500000000000002 65-69 0.38999999999999996 70-74 0.13 75-79 0.15 80-84 0.06999999999999999 85-89 0.03 90-94 0.02 95-99 0.02 100-104 0.025 105-109 0.02 110-114 0.025 115-119 0.025 120-124 0.01 125-129 0.02 130-134 0.01 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4024144869215292 0.8 3 0.1006036217303823 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.8499999999999996 0.0 0.0 0.0 0.0 124-125 3.2874999999999996 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.225 0.0 0.0 0.0 0.0 136-137 5.675 0.0 0.0 0.0 0.0 138-139 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATATCC 10 0.006830828 145.0 3 >>END_MODULE SRR14458916 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458916_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.84075 32.0 32.0 32.0 32.0 32.0 2 30.457 32.0 32.0 32.0 32.0 32.0 3 30.55 32.0 32.0 32.0 32.0 32.0 4 30.52825 32.0 32.0 32.0 32.0 32.0 5 30.459 32.0 32.0 32.0 32.0 32.0 6 33.905 36.0 36.0 36.0 32.0 36.0 7 33.922 36.0 36.0 36.0 32.0 36.0 8 34.013 36.0 36.0 36.0 32.0 36.0 9 34.01975 36.0 36.0 36.0 32.0 36.0 10-14 33.861149999999995 36.0 36.0 36.0 32.0 36.0 15-19 33.815749999999994 36.0 36.0 36.0 31.0 36.0 20-24 33.713550000000005 36.0 36.0 36.0 29.0 36.0 25-29 33.63975 36.0 36.0 36.0 26.8 36.0 30-34 33.5817 36.0 36.0 36.0 26.8 36.0 35-39 33.484300000000005 36.0 36.0 36.0 24.4 36.0 40-44 33.5139 36.0 36.0 36.0 24.6 36.0 45-49 33.43485 36.0 36.0 36.0 25.8 36.0 50-54 33.1777 36.0 36.0 36.0 18.2 36.0 55-59 32.95385 36.0 36.0 36.0 18.2 36.0 60-64 32.78795 36.0 36.0 36.0 15.4 36.0 65-69 32.4826 36.0 32.0 36.0 14.0 36.0 70-74 31.99495 36.0 32.8 36.0 14.0 36.0 75-79 31.7053 36.0 32.0 36.0 14.0 36.0 80-84 31.642000000000003 36.0 32.0 36.0 14.0 36.0 85-89 31.63515 36.0 32.0 36.0 14.0 36.0 90-94 31.278100000000002 36.0 32.0 36.0 14.0 36.0 95-99 31.34465 36.0 32.0 36.0 14.0 36.0 100-104 31.3176 36.0 32.0 36.0 14.0 36.0 105-109 31.138300000000005 36.0 32.0 36.0 14.0 36.0 110-114 30.78775 36.0 31.0 36.0 14.0 36.0 115-119 30.616699999999998 36.0 29.0 36.0 14.0 36.0 120-124 30.53345 36.0 29.0 36.0 14.0 36.0 125-129 30.17085 36.0 27.0 36.0 14.0 36.0 130-134 29.652500000000003 34.4 27.0 36.0 14.0 36.0 135-139 29.0106 32.0 27.0 36.0 14.0 36.0 140-144 28.9304 32.0 27.0 36.0 14.0 36.0 145-149 29.093350000000004 32.0 27.0 36.0 14.0 36.0 150-151 26.175625 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 1.0 10 9.0 11 6.0 12 6.0 13 8.0 14 10.0 15 14.0 16 9.0 17 16.0 18 12.0 19 8.0 20 15.0 21 17.0 22 25.0 23 40.0 24 57.0 25 81.0 26 102.0 27 129.0 28 152.0 29 223.0 30 236.0 31 304.0 32 422.0 33 577.0 34 896.0 35 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.311155577788895 12.406203101550775 10.830415207603803 54.452226113056525 2 23.65 18.45 36.5 21.4 3 24.125 21.975 22.45 31.45 4 26.724999999999998 26.900000000000002 16.525000000000002 29.849999999999998 5 27.474999999999998 31.05 20.775 20.7 6 24.05 32.15 18.875 24.925 7 22.400000000000002 15.1 37.724999999999994 24.775 8 21.7 20.150000000000002 25.85 32.300000000000004 9 22.675 18.975 28.15 30.2 10-14 25.095 24.884999999999998 22.85 27.169999999999998 15-19 25.900000000000002 23.77 22.85 27.48 20-24 25.785000000000004 23.65 23.35 27.215 25-29 25.84629231461573 24.14620731036552 22.98614930746537 27.02135106755338 30-34 25.407703851925962 24.032016008004 23.07153576788394 27.48874437218609 35-39 26.210526315789473 24.44110275689223 22.581453634085214 26.766917293233085 40-44 25.86862921798338 23.480524682086713 23.540602783618706 27.110243316311205 45-49 25.687612929130697 23.95603292511544 23.007428227263603 27.348925918490263 50-54 25.760475423045932 23.992747784045125 23.197018533440776 27.04975825946817 55-59 25.899280575539567 23.746038134527343 23.071892136640336 27.282789153292754 60-64 26.539781906300487 23.68739903069467 23.041195476575123 26.731623586429727 65-69 26.104783599088837 24.085041761579348 22.809415337889142 27.000759301442674 70-74 26.132723112128147 23.915586066615816 22.537503178235443 27.414187643020593 75-79 25.774561761108846 23.83815735833673 23.017733387688544 27.36954749286588 80-84 26.479463966037542 23.517978620019438 23.021840315073398 26.980717098869622 85-89 26.980235943005976 22.89464276594658 23.160206322455444 26.964914968592 90-94 27.001690487167668 23.15455150863173 22.929153219609653 26.91460478459095 95-99 27.06893904498695 23.394237166692257 22.65724960335739 26.879574184963406 100-104 26.660521329441288 23.331796999026988 22.963076765504173 27.04460490602755 105-109 26.668031109291856 23.23986901350798 23.183585755218992 26.90851412198117 110-114 27.06728299948639 24.05752439650745 22.110939907550076 26.764252696456087 115-119 27.208153180975913 23.661725344863086 22.09182623018324 27.03829524397776 120-124 27.104489922160933 24.006392082066085 22.511469663384712 26.377648332388265 125-129 27.53151477578012 23.57408555486671 22.638974994833642 26.255424674519528 130-134 27.971702984612207 23.51027574098936 22.549829598265 25.96819167613343 135-139 27.943379655938422 23.603864235160408 22.844449036524257 25.608307072376917 140-144 27.545651501083256 24.007015371917877 22.42855669039513 26.018776436603737 145-149 28.614162669554904 23.807313425137966 22.327092681417298 25.251431223889835 150-151 28.30967741935484 24.283870967741937 21.44516129032258 25.961290322580645 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.5 15 2.5 16 1.0 17 1.5 18 2.0 19 2.0 20 2.0 21 1.5 22 1.0 23 1.0 24 2.5 25 3.5 26 4.5 27 5.0 28 3.5 29 7.5 30 14.0 31 10.0 32 8.0 33 13.0 34 19.0 35 23.5 36 32.0 37 47.5 38 65.0 39 77.0 40 88.5 41 104.5 42 129.0 43 147.0 44 146.5 45 149.5 46 150.0 47 152.0 48 155.5 49 145.5 50 136.5 51 121.0 52 105.0 53 101.0 54 97.5 55 88.5 56 83.5 57 94.5 58 114.5 59 115.5 60 98.5 61 98.5 62 101.0 63 88.5 64 84.5 65 77.5 66 73.0 67 78.0 68 66.5 69 60.0 70 64.5 71 58.0 72 46.0 73 42.0 74 39.0 75 31.5 76 26.0 77 23.5 78 17.5 79 13.5 80 10.0 81 8.5 82 6.0 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.05 35-39 0.25 40-44 0.13 45-49 0.38 50-54 0.72 55-59 0.615 60-64 0.96 65-69 1.225 70-74 1.675 75-79 1.8800000000000001 80-84 2.245 85-89 2.095 90-94 2.395 95-99 2.305 100-104 2.365 105-109 2.2800000000000002 110-114 2.65 115-119 2.86 120-124 3.005 125-129 3.2199999999999998 130-134 3.17 135-139 3.215 140-144 3.0700000000000003 145-149 3.055 150-151 3.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.2125000000000004 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.699999999999999 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.45 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGGTG 10 0.007053894 143.45 7 >>END_MODULE Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092922 spots for SRR14458916.sra Written 1092922 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra Read 1092905 spots for SRR14458916.sra Written 1092905 spots for SRR14458916.sra SRR ids: ['SRR14458916.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wg_9gswb SRR14458916.sra spots: 21858117 blocks: [[1, 1092905], [1092906, 2185810], [2185811, 3278715], [3278716, 4371620], [4371621, 5464525], [5464526, 6557430], [6557431, 7650335], [7650336, 8743240], [8743241, 9836145], [9836146, 10929050], [10929051, 12021955], [12021956, 13114860], [13114861, 14207765], [14207766, 15300670], [15300671, 16393575], [16393576, 17486480], [17486481, 18579385], [18579386, 19672290], [19672291, 20765195], [20765196, 21858117]] SRR14458916 file size 7406644 SRR14458916 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458916 SRR14458916_1.fastq SRR14458916_2.fastq Input file: SRR14458916_1.fastq Paired file: SRR14458916_2.fastq trimmed: SRR14458916-trimmed-pair1.fastq, SRR14458916-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:56:36 2024 >> started Fri Dec 6 09:57:01 2024 >> done (25.361s) 21858117 read pairs processed; of these: 4898 ( 0.02%) short read pairs filtered out after trimming by size control 1384 ( 0.01%) empty read pairs filtered out after trimming by size control 21851835 (99.97%) read pairs available; of these: 2722212 (12.46%) trimmed read pairs available after processing 19129623 (87.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 214 0.00% 19 199 0.00% 20 180 0.00% 21 177 0.00% 22 200 0.00% 23 172 0.00% 24 171 0.00% 25 165 0.00% 26 157 0.00% 27 178 0.00% 28 134 0.00% 29 155 0.00% 30 149 0.00% 31 121 0.00% 32 173 0.00% 33 140 0.00% 34 333 0.00% 35 122 0.00% 36 149 0.00% 37 128 0.00% 38 138 0.00% 39 152 0.00% 40 115 0.00% 41 150 0.00% 42 116 0.00% 43 116 0.00% 44 151 0.00% 45 145 0.00% 46 133 0.00% 47 156 0.00% 48 176 0.00% 49 172 0.00% 50 200 0.00% 51 170 0.00% 52 196 0.00% 53 207 0.00% 54 193 0.00% 55 182 0.00% 56 242 0.00% 57 243 0.00% 58 299 0.00% 59 340 0.00% 60 366 0.00% 61 380 0.00% 62 413 0.00% 63 370 0.00% 64 386 0.00% 65 489 0.00% 66 441 0.00% 67 556 0.00% 68 658 0.00% 69 747 0.00% 70 896 0.00% 71 994 0.00% 72 984 0.00% 73 1118 0.01% 74 1199 0.01% 75 1162 0.01% 76 1273 0.01% 77 1452 0.01% 78 1629 0.01% 79 1712 0.01% 80 1978 0.01% 81 2240 0.01% 82 2594 0.01% 83 2869 0.01% 84 3072 0.01% 85 3281 0.02% 86 3562 0.02% 87 4032 0.02% 88 4979 0.02% 89 6848 0.03% 90 7764 0.04% 91 7222 0.03% 92 7102 0.03% 93 7463 0.03% 94 8090 0.04% 95 9273 0.04% 96 9785 0.04% 97 10030 0.05% 98 10723 0.05% 99 12792 0.06% 100 14175 0.06% 101 14262 0.07% 102 14113 0.06% 103 15851 0.07% 104 16817 0.08% 105 17444 0.08% 106 18790 0.09% 107 19135 0.09% 108 19703 0.09% 109 21560 0.10% 110 23621 0.11% 111 24060 0.11% 112 26044 0.12% 113 27623 0.13% 114 30213 0.14% 115 31967 0.15% 116 33135 0.15% 117 33127 0.15% 118 34003 0.16% 119 35706 0.16% 120 37414 0.17% 121 39413 0.18% 122 42769 0.20% 123 45088 0.21% 124 47528 0.22% 125 49734 0.23% 126 51190 0.23% 127 52447 0.24% 128 53939 0.25% 129 54891 0.25% 130 58114 0.27% 131 58792 0.27% 132 61491 0.28% 133 65112 0.30% 134 68812 0.31% 135 69674 0.32% 136 71350 0.33% 137 71822 0.33% 138 72984 0.33% 139 75147 0.34% 140 76287 0.35% 141 76799 0.35% 142 81667 0.37% 143 83264 0.38% 144 83644 0.38% 145 87152 0.40% 146 86216 0.39% 147 90758 0.42% 148 96123 0.44% 149 93990 0.43% 150 96919 0.44% 151 19129623 87.54% 21851835 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=9 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=18.80 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=10 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=22.14 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458916 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:57:58 Started mapping on | Dec 06 09:57:59 Finished on | Dec 06 10:01:52 Mapping speed, Million of reads per hour | 337.62 Number of input reads | 21851835 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19974068 Uniquely mapped reads % | 91.41% Average mapped length | 292.83 Number of splices: Total | 20142092 Number of splices: Annotated (sjdb) | 19060234 Number of splices: GT/AG | 19871468 Number of splices: GC/AG | 231576 Number of splices: AT/AC | 8047 Number of splices: Non-canonical | 31001 Mismatch rate per base, % | 0.73% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326623 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 28980 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.47% % of reads unmapped: other | 1.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1551554 1551554 1551554 N_multimapping 326623 326623 326623 N_noFeature 580312 10051473 10148407 N_ambiguous 450856 51461 49869 UnstrandedReadsAssigned:18942900 PositiveStrandReadsAssigned:9871134 NegativeStrandReadsAssigned:9775792 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458916 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458916-trimmed-pair1.fastq SRR14458916-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,851,835 reads, 20,295,363 reads pseudoaligned [quant] estimated average fragment length: 246.024 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR14458916.ke.tsv 35125 SRR14458916.se.tsv 88098 total ==> SRR14458916.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.352 0 0 PNS24247 1044 798.976 30.7328 2.44601 PNS24249 1928 1682.98 157.007 5.93242 PNS24246 1044 798.976 30.7328 2.44601 PNS24248 1044 798.976 30.7328 2.44601 PNS24244 1471 1225.98 41.7943 2.16782 PNS24243 293 98.1727 5 3.23869 KQK14069 1603 1357.98 7836.33 366.953 KQK14071 474 243.323 199.155 52.0471 ==> SRR14458916.se.tsv <== BRADI_1g14170v3 8504 BRADI_1g53295v3 55 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 3069 BRADI_1g74790v3 555 BRADI_1g09890v3 5 BRADI_1g77505v3 394 BRADI_1g48960v3 0 SRR14458916 completed mapping pipeline successfully