Starting /dee2/code/volunteer_pipeline.sh SRR14458917 current disk space = 1552299479040 free memory = 1607254000 SRR14458917 SRAfilesize 8b1816c53d05449fde9c4902994cf7fe SRR14458917.sra SRR14458917.sra file validated SRR14458917 is paired end SRR14458917 is conventional basespace SRR14458917 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458917_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.188 32.0 32.0 32.0 32.0 32.0 2 31.229 32.0 32.0 32.0 32.0 32.0 3 31.244 32.0 32.0 32.0 32.0 32.0 4 31.33475 32.0 32.0 32.0 32.0 32.0 5 31.36825 32.0 32.0 32.0 32.0 32.0 6 34.2455 36.0 36.0 36.0 32.0 36.0 7 34.60925 36.0 36.0 36.0 32.0 36.0 8 34.5175 36.0 36.0 36.0 32.0 36.0 9 34.571 36.0 36.0 36.0 32.0 36.0 10-14 34.51434999999999 36.0 36.0 36.0 32.0 36.0 15-19 34.5007 36.0 36.0 36.0 32.0 36.0 20-24 34.471199999999996 36.0 36.0 36.0 32.0 36.0 25-29 34.314299999999996 36.0 36.0 36.0 32.0 36.0 30-34 34.13225 36.0 36.0 36.0 32.0 36.0 35-39 34.0785 36.0 36.0 36.0 32.0 36.0 40-44 33.933 36.0 36.0 36.0 32.0 36.0 45-49 33.86450000000001 36.0 36.0 36.0 32.0 36.0 50-54 33.784200000000006 36.0 36.0 36.0 30.0 36.0 55-59 33.54915 36.0 36.0 36.0 25.8 36.0 60-64 33.419 36.0 36.0 36.0 25.8 36.0 65-69 33.2901 36.0 36.0 36.0 23.4 36.0 70-74 33.15575 36.0 34.4 36.0 24.6 36.0 75-79 32.98945 36.0 32.8 36.0 24.6 36.0 80-84 32.93845 36.0 32.0 36.0 23.4 36.0 85-89 32.85845 36.0 32.0 36.0 20.8 36.0 90-94 32.86205 36.0 32.0 36.0 19.4 36.0 95-99 32.651650000000004 36.0 32.0 36.0 15.4 36.0 100-104 32.693799999999996 36.0 32.0 36.0 18.2 36.0 105-109 32.559900000000006 36.0 32.0 36.0 15.4 36.0 110-114 32.5654 36.0 32.0 36.0 15.4 36.0 115-119 32.360699999999994 36.0 32.0 36.0 14.0 36.0 120-124 32.3639 36.0 32.0 36.0 14.0 36.0 125-129 32.09585 36.0 32.0 36.0 14.0 36.0 130-134 31.9851 36.0 32.0 36.0 14.0 36.0 135-139 31.8872 36.0 32.0 36.0 14.0 36.0 140-144 31.376750000000005 36.0 29.0 36.0 14.0 36.0 145-149 31.016700000000004 36.0 27.0 36.0 14.0 36.0 150-151 28.844875000000002 31.5 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 5.0 22 10.0 23 19.0 24 27.0 25 52.0 26 60.0 27 100.0 28 142.0 29 168.0 30 214.0 31 286.0 32 372.0 33 527.0 34 906.0 35 1108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.525 12.35 14.575 49.55 2 23.200000000000003 17.95 33.85 25.0 3 24.075 22.375 24.0 29.549999999999997 4 28.199999999999996 27.075 17.349999999999998 27.375 5 28.625 29.575000000000003 19.85 21.95 6 24.761665830406425 31.359759157049673 20.19568489713999 23.68289011540391 7 21.975 16.55 37.574999999999996 23.9 8 22.275 20.575 25.45 31.7 9 23.325000000000003 20.474999999999998 28.525 27.675 10-14 24.66 25.385 22.86 27.095000000000002 15-19 25.435000000000002 24.275 23.23 27.060000000000002 20-24 25.775 23.84 23.365 27.02 25-29 25.82258225822582 24.382438243824385 23.362336233623363 26.432643264326433 30-34 25.70385557833675 24.638695804370656 23.443516527479122 26.213932089813476 35-39 25.97168725926667 23.78070131559202 23.465559501775797 26.782051923365515 40-44 26.068889556423354 24.101331731250625 23.160108140582757 26.669670571743264 45-49 25.997393744987974 23.787089013632716 23.711908580593423 26.503608660785886 50-54 25.610061632509897 23.84626947938067 23.149772009821117 27.39389687828832 55-59 25.572059413890003 23.87093536732236 23.670212765957448 26.88679245283019 60-64 26.051642015542743 23.344196540486337 23.494610177989472 27.109551265981445 65-69 26.03345220754433 23.57727660856899 23.4918880908132 26.897383093073486 70-74 26.297855281619565 24.087993585888956 23.42653838444578 26.1876127480457 75-79 26.19870735006764 24.269752993636956 22.561250563655495 26.97028909263991 80-84 26.020816653322658 24.24439551641313 23.2986389111289 26.43614891913531 85-89 26.25656414103526 23.66591647911978 23.460865216304075 26.616654163540886 90-94 26.19 23.385 23.735 26.69 95-99 26.71 23.630000000000003 23.46 26.200000000000003 100-104 26.72633631681584 23.346167308365416 23.726186309315466 26.201310065503275 105-109 26.56 23.62 23.445 26.375 110-114 26.905 23.66 23.155 26.279999999999998 115-119 26.97 23.54 23.345 26.145000000000003 120-124 26.945000000000004 23.835 22.68 26.540000000000003 125-129 26.715 24.275 22.95 26.06 130-134 26.765 24.735 22.03 26.47 135-139 26.84134206710336 24.321216060803042 23.021151057552878 25.816290814540725 140-144 27.11 24.45 22.705000000000002 25.735000000000003 145-149 27.48 24.740000000000002 22.005 25.775 150-151 26.8125 25.2625 21.45 26.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.0 27 1.0 28 1.5 29 4.0 30 7.0 31 10.0 32 11.0 33 13.0 34 21.0 35 27.5 36 28.0 37 43.5 38 68.0 39 82.5 40 91.0 41 100.5 42 124.5 43 144.5 44 155.0 45 162.5 46 173.5 47 179.5 48 163.5 49 145.5 50 117.0 51 102.5 52 113.5 53 107.0 54 109.0 55 107.0 56 106.0 57 103.5 58 98.5 59 104.0 60 97.0 61 93.5 62 90.0 63 87.5 64 92.0 65 88.0 66 75.5 67 70.0 68 72.5 69 71.5 70 60.0 71 50.0 72 46.0 73 47.0 74 36.0 75 23.0 76 20.0 77 15.5 78 11.0 79 6.5 80 4.0 81 2.5 82 2.5 83 2.0 84 0.5 85 0.5 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.35000000000000003 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.015 35-39 0.045 40-44 0.13 45-49 0.24 50-54 0.215 55-59 0.36 60-64 0.27499999999999997 65-69 0.455 70-74 0.22 75-79 0.20500000000000002 80-84 0.08 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.5875000000000004 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.7 0.0 0.0 0.0 0.0 132-133 6.1875 0.0 0.0 0.0 0.0 134-135 7.0875 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGTTG 10 0.006830828 145.0 6 >>END_MODULE SRR14458917 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458917_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9485 32.0 32.0 32.0 32.0 32.0 2 30.622 32.0 32.0 32.0 32.0 32.0 3 30.54175 32.0 32.0 32.0 32.0 32.0 4 30.72 32.0 32.0 32.0 32.0 32.0 5 30.71 32.0 32.0 32.0 32.0 32.0 6 33.94175 36.0 36.0 36.0 32.0 36.0 7 33.94425 36.0 36.0 36.0 32.0 36.0 8 33.8925 36.0 36.0 36.0 32.0 36.0 9 33.9275 36.0 36.0 36.0 32.0 36.0 10-14 33.96395 36.0 36.0 36.0 32.0 36.0 15-19 33.8852 36.0 36.0 36.0 31.0 36.0 20-24 33.8318 36.0 36.0 36.0 31.0 36.0 25-29 33.799350000000004 36.0 36.0 36.0 32.0 36.0 30-34 33.653200000000005 36.0 36.0 36.0 27.0 36.0 35-39 33.56055 36.0 36.0 36.0 25.6 36.0 40-44 33.4765 36.0 36.0 36.0 25.8 36.0 45-49 33.41074999999999 36.0 36.0 36.0 24.6 36.0 50-54 33.29185 36.0 36.0 36.0 20.8 36.0 55-59 33.20765 36.0 36.0 36.0 22.2 36.0 60-64 32.9033 36.0 36.0 36.0 15.4 36.0 65-69 32.6402 36.0 34.4 36.0 16.8 36.0 70-74 32.16564999999999 36.0 32.0 36.0 14.0 36.0 75-79 32.08155 36.0 32.0 36.0 14.0 36.0 80-84 31.8867 36.0 32.0 36.0 14.0 36.0 85-89 31.906650000000003 36.0 32.0 36.0 14.0 36.0 90-94 31.57215 36.0 32.0 36.0 14.0 36.0 95-99 31.4909 36.0 32.0 36.0 14.0 36.0 100-104 31.479000000000003 36.0 32.0 36.0 14.0 36.0 105-109 31.331499999999995 36.0 32.0 36.0 14.0 36.0 110-114 31.0473 36.0 31.0 36.0 14.0 36.0 115-119 30.7913 36.0 29.0 36.0 14.0 36.0 120-124 30.7132 36.0 30.0 36.0 14.0 36.0 125-129 30.284450000000003 35.2 27.0 36.0 14.0 36.0 130-134 29.91875 34.4 27.0 36.0 14.0 36.0 135-139 29.201 32.0 27.0 36.0 14.0 36.0 140-144 29.259450000000005 32.0 27.0 36.0 14.0 36.0 145-149 29.291650000000004 32.0 27.0 36.0 14.0 36.0 150-151 26.3555 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 4.0 9 4.0 10 9.0 11 4.0 12 7.0 13 7.0 14 4.0 15 5.0 16 8.0 17 14.0 18 17.0 19 13.0 20 8.0 21 21.0 22 27.0 23 31.0 24 49.0 25 86.0 26 95.0 27 135.0 28 161.0 29 185.0 30 233.0 31 302.0 32 385.0 33 558.0 34 891.0 35 736.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.056014003500874 11.502875718929733 13.603400850212552 50.837709427356835 2 25.0 17.150000000000002 33.45 24.4 3 24.25 20.8 23.474999999999998 31.474999999999998 4 27.275 26.450000000000003 16.225 30.049999999999997 5 29.875 29.525000000000002 18.625 21.975 6 23.35 33.7 20.05 22.900000000000002 7 20.275000000000002 17.299999999999997 38.3 24.125 8 21.975 20.5 26.150000000000002 31.374999999999996 9 23.474999999999998 21.05 28.000000000000004 27.474999999999998 10-14 25.195 25.240000000000002 22.75 26.815 15-19 25.25 23.445 23.905 27.400000000000002 20-24 25.21 23.724999999999998 23.400000000000002 27.665 25-29 25.09 23.724999999999998 23.849999999999998 27.334999999999997 30-34 25.322725908135695 23.8416891824277 23.78665065545882 27.048934253977784 35-39 25.526791089704997 24.07184427051977 23.67047963074453 26.730885009030704 40-44 25.613665965334135 24.391343552750225 22.963630898707542 27.031359583208097 45-49 25.71299457722434 23.94055031130749 23.38823056838723 26.958224543080938 50-54 25.800765511684126 24.214343271555197 23.015713134568898 26.96917808219178 55-59 26.363727858293075 23.787238325281805 23.27898550724638 26.570048309178745 60-64 25.8913712239649 23.26894951838217 23.82369257148621 27.015986686166727 65-69 26.419478682562136 24.282683370377853 23.00464740351586 26.29319054354415 70-74 25.572789943227896 23.7124898621249 23.925385239253853 26.78933495539335 75-79 25.534399593805535 23.81822797664382 23.853769992383853 26.79360243716679 80-84 25.61659192825112 23.97064818589482 23.593558907460253 26.819200978393802 85-89 25.955713922117585 23.731229320437773 23.385085263425808 26.92797149401883 90-94 26.189868897617714 23.674947712084883 23.62903637198388 26.506147018313523 95-99 26.19775739041794 23.43527013251784 23.893985728848115 26.472986748216105 100-104 26.020199959192002 24.04611303815548 23.382983064680676 26.550703937971843 105-109 26.16717635066259 23.934760448521917 23.343527013251784 26.55453618756371 110-114 26.456161863887186 23.79930512977723 23.46719803801349 26.27733496832209 115-119 27.395577395577398 23.84316134316134 22.926904176904177 25.834357084357084 120-124 26.67829119442023 24.314067388071184 22.71911380070773 26.28852761680086 125-129 26.71116816431322 24.14377406931964 23.306803594351734 25.838254172015407 130-134 27.370258200297727 24.51619526718341 22.462912581489658 25.650633951029207 135-139 27.881651941647835 23.55146907746045 22.616601602629956 25.95027737826176 140-144 28.264437378192635 24.351215509283 22.27407939275823 25.110267719766128 145-149 28.51354123922856 24.794829708658188 22.21481329503488 24.476815757078374 150-151 28.186368887177508 25.016044153510457 22.346297009369785 24.45128994994224 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 2.0 17 2.5 18 1.0 19 1.5 20 3.0 21 1.5 22 0.5 23 3.0 24 4.0 25 2.5 26 2.5 27 3.5 28 5.0 29 7.5 30 10.5 31 10.5 32 14.5 33 23.5 34 23.5 35 23.5 36 38.5 37 49.0 38 56.5 39 87.0 40 109.0 41 110.5 42 127.0 43 146.5 44 159.5 45 154.5 46 151.0 47 160.0 48 141.5 49 129.5 50 127.0 51 122.0 52 113.0 53 104.0 54 107.5 55 107.0 56 99.0 57 99.5 58 102.5 59 101.5 60 98.0 61 87.0 62 88.0 63 87.0 64 77.0 65 70.0 66 76.5 67 77.0 68 73.5 69 71.5 70 57.5 71 54.5 72 49.0 73 37.0 74 31.5 75 29.5 76 25.5 77 18.0 78 13.5 79 10.5 80 6.0 81 2.0 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.06999999999999999 35-39 0.33999999999999997 40-44 0.19 45-49 0.42 50-54 0.72 55-59 0.64 60-64 0.855 65-69 1.02 70-74 1.3599999999999999 75-79 1.525 80-84 1.8800000000000001 85-89 1.775 90-94 1.9849999999999999 95-99 1.9 100-104 1.9800000000000002 105-109 1.9 110-114 2.1399999999999997 115-119 2.32 120-124 2.505 125-129 2.625 130-134 2.595 135-139 2.6599999999999997 140-144 2.5100000000000002 145-149 2.52 150-151 2.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.225 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.3 0.0 0.0 0.0 0.0 138-139 8.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078260 spots for SRR14458917.sra Written 1078260 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra Read 1078244 spots for SRR14458917.sra Written 1078244 spots for SRR14458917.sra SRR ids: ['SRR14458917.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_91bmg985 SRR14458917.sra spots: 21564896 blocks: [[1, 1078244], [1078245, 2156488], [2156489, 3234732], [3234733, 4312976], [4312977, 5391220], [5391221, 6469464], [6469465, 7547708], [7547709, 8625952], [8625953, 9704196], [9704197, 10782440], [10782441, 11860684], [11860685, 12938928], [12938929, 14017172], [14017173, 15095416], [15095417, 16173660], [16173661, 17251904], [17251905, 18330148], [18330149, 19408392], [19408393, 20486636], [20486637, 21564896]] SRR14458917 file size 7306994 SRR14458917 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458917 SRR14458917_1.fastq SRR14458917_2.fastq Input file: SRR14458917_1.fastq Paired file: SRR14458917_2.fastq trimmed: SRR14458917-trimmed-pair1.fastq, SRR14458917-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:53:07 2024 >> started Fri Dec 6 09:53:41 2024 >> done (33.341s) 21564896 read pairs processed; of these: 3412 ( 0.02%) short read pairs filtered out after trimming by size control 2719 ( 0.01%) empty read pairs filtered out after trimming by size control 21558765 (99.97%) read pairs available; of these: 3452666 (16.02%) trimmed read pairs available after processing 18106099 (83.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 162 0.00% 19 171 0.00% 20 144 0.00% 21 133 0.00% 22 151 0.00% 23 131 0.00% 24 156 0.00% 25 135 0.00% 26 128 0.00% 27 139 0.00% 28 113 0.00% 29 148 0.00% 30 123 0.00% 31 110 0.00% 32 145 0.00% 33 132 0.00% 34 261 0.00% 35 109 0.00% 36 140 0.00% 37 119 0.00% 38 122 0.00% 39 128 0.00% 40 131 0.00% 41 154 0.00% 42 134 0.00% 43 128 0.00% 44 112 0.00% 45 148 0.00% 46 119 0.00% 47 162 0.00% 48 180 0.00% 49 195 0.00% 50 172 0.00% 51 207 0.00% 52 198 0.00% 53 202 0.00% 54 195 0.00% 55 247 0.00% 56 240 0.00% 57 259 0.00% 58 345 0.00% 59 387 0.00% 60 438 0.00% 61 427 0.00% 62 452 0.00% 63 433 0.00% 64 443 0.00% 65 466 0.00% 66 515 0.00% 67 618 0.00% 68 722 0.00% 69 904 0.00% 70 968 0.00% 71 1099 0.01% 72 1216 0.01% 73 1276 0.01% 74 1328 0.01% 75 1415 0.01% 76 1452 0.01% 77 1612 0.01% 78 1804 0.01% 79 2097 0.01% 80 2453 0.01% 81 2742 0.01% 82 3165 0.01% 83 3568 0.02% 84 3857 0.02% 85 4137 0.02% 86 4501 0.02% 87 5075 0.02% 88 6092 0.03% 89 7885 0.04% 90 9323 0.04% 91 8936 0.04% 92 9079 0.04% 93 9826 0.05% 94 10808 0.05% 95 12251 0.06% 96 12956 0.06% 97 13261 0.06% 98 14299 0.07% 99 16718 0.08% 100 18114 0.08% 101 19074 0.09% 102 19443 0.09% 103 21619 0.10% 104 23356 0.11% 105 23969 0.11% 106 25969 0.12% 107 26685 0.12% 108 27475 0.13% 109 29600 0.14% 110 31975 0.15% 111 33112 0.15% 112 36069 0.17% 113 38796 0.18% 114 41820 0.19% 115 43739 0.20% 116 44873 0.21% 117 45512 0.21% 118 47105 0.22% 119 48839 0.23% 120 50829 0.24% 121 53185 0.25% 122 57314 0.27% 123 60487 0.28% 124 63514 0.29% 125 66154 0.31% 126 67683 0.31% 127 69130 0.32% 128 70547 0.33% 129 72069 0.33% 130 74691 0.35% 131 76219 0.35% 132 78492 0.36% 133 83316 0.39% 134 86842 0.40% 135 88283 0.41% 136 89171 0.41% 137 90490 0.42% 138 91472 0.42% 139 92898 0.43% 140 93323 0.43% 141 93766 0.43% 142 98375 0.46% 143 100306 0.47% 144 101808 0.47% 145 104214 0.48% 146 103824 0.48% 147 106806 0.50% 148 112282 0.52% 149 108466 0.50% 150 111934 0.52% 151 18106099 83.98% 21558765 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=8 prefix-density=0.51 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=21.96 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=9 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=21.11 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458917 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:56:54 Started mapping on | Dec 06 09:56:55 Finished on | Dec 06 10:00:01 Mapping speed, Million of reads per hour | 417.27 Number of input reads | 21558765 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 17330189 Uniquely mapped reads % | 80.39% Average mapped length | 284.94 Number of splices: Total | 17627227 Number of splices: Annotated (sjdb) | 16701239 Number of splices: GT/AG | 17386789 Number of splices: GC/AG | 201977 Number of splices: AT/AC | 7075 Number of splices: Non-canonical | 31386 Mismatch rate per base, % | 0.73% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251316 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 37393 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.91% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3981279 3981279 3981279 N_multimapping 251316 251316 251316 N_noFeature 515574 8715366 8816235 N_ambiguous 436853 63757 64227 UnstrandedReadsAssigned:16377762 PositiveStrandReadsAssigned:8551066 NegativeStrandReadsAssigned:8449727 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458917 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458917-trimmed-pair1.fastq SRR14458917-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,558,765 reads, 20,098,051 reads pseudoaligned [quant] estimated average fragment length: 223.936 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR14458917.ke.tsv 35125 SRR14458917.se.tsv 88098 total ==> SRR14458917.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.373 0 0 PNS24247 1044 821.064 33.5073 2.70921 PNS24249 1928 1705.06 142.953 5.56588 PNS24246 1044 821.064 33.5073 2.70921 PNS24248 1044 821.064 33.5073 2.70921 PNS24244 1471 1248.06 42.525 2.26198 PNS24243 293 108.823 6 3.66027 KQK14069 1603 1380.06 10406.2 500.581 KQK14071 474 261.201 394.342 100.226 ==> SRR14458917.se.tsv <== BRADI_1g14170v3 9908 BRADI_1g53295v3 62 BRADI_1g59795v3 295 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 1945 BRADI_1g74790v3 576 BRADI_1g09890v3 11 BRADI_1g77505v3 364 BRADI_1g48960v3 0 SRR14458917 completed mapping pipeline successfully