Starting /dee2/code/volunteer_pipeline.sh SRR14458918 current disk space = 1552299479040 free memory = 1607256416 SRR14458918 SRAfilesize 9e6a369062b1405cc1e0c95f870582a4 SRR14458918.sra SRR14458918.sra file validated SRR14458918 is paired end SRR14458918 is conventional basespace SRR14458918 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458918_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.19975 32.0 32.0 32.0 32.0 32.0 2 31.33325 32.0 32.0 32.0 32.0 32.0 3 31.30525 32.0 32.0 32.0 32.0 32.0 4 31.28375 32.0 32.0 32.0 32.0 32.0 5 31.34125 32.0 32.0 32.0 32.0 32.0 6 34.46075 36.0 36.0 36.0 32.0 36.0 7 34.66175 36.0 36.0 36.0 32.0 36.0 8 34.52375 36.0 36.0 36.0 32.0 36.0 9 34.49625 36.0 36.0 36.0 32.0 36.0 10-14 34.582350000000005 36.0 36.0 36.0 32.0 36.0 15-19 34.5824 36.0 36.0 36.0 32.0 36.0 20-24 34.5695 36.0 36.0 36.0 32.0 36.0 25-29 34.38135 36.0 36.0 36.0 32.0 36.0 30-34 34.222049999999996 36.0 36.0 36.0 32.0 36.0 35-39 34.23965 36.0 36.0 36.0 32.0 36.0 40-44 34.0479 36.0 36.0 36.0 32.0 36.0 45-49 33.9754 36.0 36.0 36.0 32.0 36.0 50-54 33.88745 36.0 36.0 36.0 30.0 36.0 55-59 33.725699999999996 36.0 36.0 36.0 28.0 36.0 60-64 33.55005 36.0 36.0 36.0 27.0 36.0 65-69 33.5034 36.0 36.0 36.0 27.0 36.0 70-74 33.22325 36.0 33.6 36.0 24.6 36.0 75-79 33.06955 36.0 33.6 36.0 24.6 36.0 80-84 32.979749999999996 36.0 32.0 36.0 23.4 36.0 85-89 33.03595 36.0 32.0 36.0 25.8 36.0 90-94 33.117599999999996 36.0 32.0 36.0 25.8 36.0 95-99 32.8531 36.0 32.0 36.0 19.6 36.0 100-104 32.821000000000005 36.0 32.0 36.0 19.6 36.0 105-109 32.62995 36.0 32.0 36.0 16.8 36.0 110-114 32.66485 36.0 32.0 36.0 18.2 36.0 115-119 32.5851 36.0 32.0 36.0 16.8 36.0 120-124 32.464349999999996 36.0 32.0 36.0 15.4 36.0 125-129 32.231 36.0 32.0 36.0 14.0 36.0 130-134 32.313900000000004 36.0 32.0 36.0 15.4 36.0 135-139 31.982550000000003 36.0 32.0 36.0 14.0 36.0 140-144 31.59015 36.0 30.0 36.0 14.0 36.0 145-149 31.222700000000003 36.0 27.0 36.0 14.0 36.0 150-151 29.032125 34.0 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 7.0 22 16.0 23 15.0 24 22.0 25 24.0 26 65.0 27 85.0 28 112.0 29 155.0 30 221.0 31 269.0 32 346.0 33 569.0 34 982.0 35 1106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.225 13.675 14.299999999999999 48.8 2 22.225 18.175 35.875 23.724999999999998 3 23.575 21.775 23.65 31.0 4 25.2 30.525000000000002 17.474999999999998 26.8 5 27.750000000000004 30.475 19.675 22.1 6 22.67368949084525 33.96037120642087 20.36619011788312 22.999749184850764 7 21.375 15.7 38.425 24.5 8 22.025 22.05 26.1 29.825000000000003 9 22.95 19.0 29.7 28.349999999999998 10-14 24.66 24.955 23.695 26.69 15-19 25.629999999999995 24.29 24.12 25.96 20-24 26.009999999999998 23.815 23.91 26.265 25-29 25.946486621655414 24.186046511627907 23.415853963490875 26.451612903225808 30-34 24.98624380971437 24.58106147766495 24.155870141563703 26.276824571056977 35-39 25.33033033033033 24.084084084084083 23.65865865865866 26.926926926926924 40-44 25.750363281054266 24.68807937064689 23.50553690434434 26.056020443954502 45-49 25.25318359570841 24.74180286774291 23.443296901634415 26.56171663491427 50-54 25.38839330460058 24.150546256389696 24.07537335872507 26.385687080284654 55-59 25.421517462866316 24.126856684062624 23.931152147731837 26.52047370533922 60-64 25.41743970315399 23.797823797823796 24.364438650152938 26.42029784886928 65-69 25.592607472880673 24.467657693852953 23.443149859381275 26.496584973885096 70-74 25.75924626641275 23.980154355016538 23.6644281848251 26.596171193745615 75-79 26.487543235249888 23.3495413303925 23.941049676675522 26.22186575768209 80-84 25.449356631452464 24.122565463375555 24.1075451860011 26.32053271917088 85-89 26.116116116116117 23.983983983983983 23.60860860860861 26.29129129129129 90-94 26.30420647226529 24.373530735757516 23.24313509728405 26.079127694693145 95-99 26.15546218487395 23.85954381752701 23.809523809523807 26.175470188075227 100-104 26.479563760068036 23.968182500375207 23.18275051278203 26.369503226774725 105-109 26.55062024809924 24.129651860744296 23.369347739095637 25.950380152060827 110-114 26.551948376769545 23.58561352608674 23.675654044319945 26.186784052823768 115-119 26.02040816326531 23.994597839135654 23.169267707082835 26.815726290516206 120-124 26.38923623268144 24.013404691642073 23.238133346671336 26.359225729005153 125-129 26.779372780473164 24.988746061121393 22.732956534787174 25.49892462361827 130-134 26.495299059811963 24.82996599319864 23.25465093018604 25.42008401680336 135-139 26.477943383014907 24.562368710613182 22.80184055216565 26.15784735420626 140-144 27.095419083816765 24.70994198839768 22.514502900580116 25.680136027205442 145-149 26.512651265126514 25.492549254925496 22.297229722972297 25.697569756975696 150-151 26.325 25.324999999999996 21.712500000000002 26.637499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 1.5 28 3.0 29 3.5 30 6.5 31 9.0 32 14.0 33 18.5 34 20.0 35 27.0 36 43.5 37 55.5 38 65.5 39 83.5 40 98.5 41 119.5 42 135.0 43 151.5 44 162.0 45 159.0 46 165.5 47 160.0 48 149.5 49 161.5 50 155.0 51 131.0 52 117.0 53 103.0 54 109.0 55 111.0 56 104.0 57 95.5 58 91.0 59 91.0 60 87.0 61 86.5 62 92.5 63 86.5 64 75.0 65 87.5 66 80.5 67 58.0 68 59.5 69 62.5 70 55.0 71 52.5 72 43.5 73 37.5 74 36.0 75 22.0 76 15.5 77 15.0 78 9.0 79 4.5 80 3.0 81 1.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.325 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.025 30-34 0.045 35-39 0.1 40-44 0.215 45-49 0.27 50-54 0.22999999999999998 55-59 0.36 60-64 0.28500000000000003 65-69 0.44 70-74 0.22999999999999998 75-79 0.255 80-84 0.135 85-89 0.1 90-94 0.034999999999999996 95-99 0.04 100-104 0.055 105-109 0.04 110-114 0.045 115-119 0.04 120-124 0.034999999999999996 125-129 0.034999999999999996 130-134 0.02 135-139 0.03 140-144 0.02 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.32679738562091504 0.65 3 0.07541478129713425 0.22499999999999998 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 5.887499999999999 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 8.15 0.0 0.0 0.0 0.0 136-137 8.9875 0.0 0.0 0.0 0.0 138-139 9.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458918 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458918_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07475 32.0 32.0 32.0 32.0 32.0 2 30.697 32.0 32.0 32.0 32.0 32.0 3 30.8745 32.0 32.0 32.0 32.0 32.0 4 30.7965 32.0 32.0 32.0 32.0 32.0 5 30.78875 32.0 32.0 32.0 32.0 32.0 6 33.999 36.0 36.0 36.0 32.0 36.0 7 34.16575 36.0 36.0 36.0 32.0 36.0 8 34.0715 36.0 36.0 36.0 32.0 36.0 9 34.09375 36.0 36.0 36.0 32.0 36.0 10-14 34.01315 36.0 36.0 36.0 32.0 36.0 15-19 34.026349999999994 36.0 36.0 36.0 32.0 36.0 20-24 33.99635 36.0 36.0 36.0 32.0 36.0 25-29 33.847699999999996 36.0 36.0 36.0 31.0 36.0 30-34 33.8476 36.0 36.0 36.0 31.0 36.0 35-39 33.7205 36.0 36.0 36.0 31.0 36.0 40-44 33.73195 36.0 36.0 36.0 31.0 36.0 45-49 33.6176 36.0 36.0 36.0 29.0 36.0 50-54 33.422450000000005 36.0 36.0 36.0 24.4 36.0 55-59 33.26245 36.0 36.0 36.0 22.2 36.0 60-64 33.147749999999995 36.0 36.0 36.0 21.0 36.0 65-69 32.81145 36.0 33.6 36.0 19.6 36.0 70-74 32.431349999999995 36.0 32.8 36.0 14.0 36.0 75-79 32.35625 36.0 32.0 36.0 14.0 36.0 80-84 32.054899999999996 36.0 32.0 36.0 14.0 36.0 85-89 32.161500000000004 36.0 32.0 36.0 14.0 36.0 90-94 31.779150000000005 36.0 32.0 36.0 14.0 36.0 95-99 31.83235 36.0 32.0 36.0 14.0 36.0 100-104 31.723249999999997 36.0 32.0 36.0 14.0 36.0 105-109 31.684500000000003 36.0 32.0 36.0 14.0 36.0 110-114 31.421950000000002 36.0 32.0 36.0 14.0 36.0 115-119 31.05725 36.0 32.0 36.0 14.0 36.0 120-124 31.0385 36.0 32.0 36.0 14.0 36.0 125-129 30.659249999999997 36.0 30.0 36.0 14.0 36.0 130-134 30.089250000000003 34.4 27.0 36.0 14.0 36.0 135-139 29.44565 32.0 27.0 36.0 14.0 36.0 140-144 29.36325 32.0 27.0 36.0 14.0 36.0 145-149 29.51515 32.0 27.0 36.0 14.0 36.0 150-151 26.490499999999997 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 3.0 9 2.0 10 8.0 11 6.0 12 4.0 13 5.0 14 4.0 15 8.0 16 7.0 17 13.0 18 9.0 19 13.0 20 9.0 21 21.0 22 26.0 23 25.0 24 55.0 25 59.0 26 83.0 27 105.0 28 156.0 29 188.0 30 218.0 31 289.0 32 395.0 33 603.0 34 993.0 35 691.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.25 12.325 12.8 51.625 2 25.124999999999996 17.075000000000003 34.25 23.549999999999997 3 24.325 22.625 24.0 29.049999999999997 4 26.075 26.075 19.575 28.275 5 29.099999999999998 29.75 19.75 21.4 6 21.525 34.849999999999994 19.5 24.125 7 21.5 16.25 39.074999999999996 23.175 8 22.0 20.275000000000002 26.5 31.225 9 22.175 20.275000000000002 29.325000000000003 28.225 10-14 24.58 25.195 23.57 26.655 15-19 24.69 24.485 23.96 26.865 20-24 25.14 24.43 23.625 26.805 25-29 25.288793318997847 24.113617042556385 23.778566785017752 26.819022853428017 30-34 24.882370607668435 24.7672439683652 24.1165281809991 26.23385724296726 35-39 25.58687800963082 24.61376404494382 23.374799357945424 26.424558587479936 40-44 25.176576666833643 24.289936382307268 23.633722386414867 26.899764564444222 45-49 25.174474067379627 24.300848521363662 23.77868152834262 26.74599588291409 50-54 24.942112151414477 24.67029094936072 23.588039867109632 26.799557032115175 55-59 25.913069725324476 24.167421269745446 23.56876949391287 26.350739511017206 60-64 25.539205805281195 24.511187260632937 23.337028824833702 26.612578109252166 65-69 25.64412847274744 23.92981394645288 24.121413805274038 26.304643775525637 70-74 25.551396195872115 24.028733306353704 24.008498583569406 26.41137191420477 75-79 25.428281804358843 24.303091738469337 23.09680689305626 27.171819564115562 80-84 25.838294407978424 23.930188775250596 23.52312624026866 26.708390576502318 85-89 26.2580054894785 23.523431940632307 23.92497712717292 26.293585442716278 90-94 26.028722754125077 24.597677734772866 23.059686290486862 26.3139132206152 95-99 26.22308201394899 24.151097082930306 23.21437662271547 26.411444280405235 100-104 26.743060860707917 24.283167812579578 23.422459893048128 25.551311433664374 105-109 25.941571661237784 24.328175895765472 23.4375 26.292752442996743 110-114 26.661226987607733 24.009383446376663 23.290325870773625 26.039063695241982 115-119 27.013079910075614 24.192724300020437 23.191293684855914 25.602902105048024 120-124 26.463664278403275 24.733879222108495 22.932446264073693 25.870010235414536 125-129 26.988359571304038 24.439772319368238 23.32188092918312 25.249987180144608 130-134 27.61465539328721 24.79631053036126 22.254675890340764 25.334358186010764 135-139 28.005128205128205 24.78974358974359 22.671794871794873 24.53333333333333 140-144 28.59337395667981 24.8502227456603 22.41794254698141 24.13846075067848 145-149 28.076371826371826 24.738943488943487 22.885954135954137 24.29873054873055 150-151 27.122550902804456 25.73953131002689 23.10154949417339 24.03636829299526 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.5 16 1.5 17 1.5 18 2.5 19 1.5 20 2.5 21 4.0 22 4.0 23 3.5 24 3.0 25 4.5 26 6.0 27 5.0 28 3.0 29 4.5 30 7.0 31 15.0 32 15.5 33 14.0 34 21.0 35 35.5 36 50.0 37 50.0 38 63.0 39 86.5 40 104.0 41 118.5 42 126.0 43 135.0 44 146.5 45 157.0 46 163.5 47 167.0 48 152.0 49 132.0 50 130.0 51 127.0 52 121.5 53 119.5 54 105.5 55 113.0 56 114.0 57 98.5 58 101.0 59 101.0 60 97.5 61 88.0 62 82.5 63 76.5 64 74.5 65 70.5 66 69.0 67 68.0 68 68.5 69 58.0 70 50.5 71 54.5 72 46.0 73 34.0 74 27.0 75 26.5 76 23.0 77 19.5 78 13.0 79 5.5 80 2.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.11 35-39 0.32 40-44 0.185 45-49 0.415 50-54 0.67 55-59 0.61 60-64 0.7799999999999999 65-69 0.835 70-74 1.16 75-79 1.35 80-84 1.735 85-89 1.63 90-94 1.82 95-99 1.7850000000000001 100-104 1.825 105-109 1.76 110-114 1.955 115-119 2.1399999999999997 120-124 2.3 125-129 2.495 130-134 2.4250000000000003 135-139 2.5 140-144 2.355 145-149 2.32 150-151 2.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0125 0.0 0.0 0.0 38-39 0.025 0.025 0.0 0.0 0.0 40-41 0.025 0.025 0.0 0.0 0.0 42-43 0.025 0.025 0.0 0.0 0.0 44-45 0.025 0.025 0.0 0.0 0.0 46-47 0.025 0.025 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.05 0.025 0.0 0.0 0.0 62-63 0.05 0.025 0.0 0.0 0.0 64-65 0.05 0.025 0.0 0.0 0.0 66-67 0.05 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.075 0.025 0.0 0.0 0.0 82-83 0.1 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.125 0.025 0.0 0.0 0.0 88-89 0.1625 0.025 0.0 0.0 0.0 90-91 0.2 0.025 0.0 0.0 0.0 92-93 0.23750000000000002 0.025 0.0 0.0 0.0 94-95 0.425 0.025 0.0 0.0 0.0 96-97 0.6125 0.025 0.0 0.0 0.0 98-99 0.7124999999999999 0.025 0.0 0.0 0.0 100-101 0.7375 0.025 0.0 0.0 0.0 102-103 0.8374999999999999 0.025 0.0 0.0 0.0 104-105 0.9125 0.025 0.0 0.0 0.0 106-107 1.15 0.025 0.0 0.0 0.0 108-109 1.3125 0.025 0.0 0.0 0.0 110-111 1.5 0.025 0.0 0.0 0.0 112-113 1.7 0.025 0.0 0.0 0.0 114-115 2.125 0.025 0.0 0.0 0.0 116-117 2.4 0.025 0.0 0.0 0.0 118-119 2.8 0.025 0.0 0.0 0.0 120-121 3.1624999999999996 0.025 0.0 0.0 0.0 122-123 3.6875 0.025 0.0 0.0 0.0 124-125 4.2125 0.025 0.0 0.0 0.0 126-127 5.025 0.025 0.0 0.0 0.0 128-129 5.4875 0.025 0.0 0.0 0.0 130-131 6.0 0.025 0.0 0.0 0.0 132-133 6.825 0.025 0.0 0.0 0.0 134-135 7.550000000000001 0.025 0.0 0.0 0.0 136-137 8.3375 0.025 0.0 0.0 0.0 138-139 9.037500000000001 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTCC 10 0.0069827023 143.9375 6 AAAATCA 10 0.0069827023 143.9375 3 >>END_MODULE Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143884 spots for SRR14458918.sra Written 1143884 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra Read 1143880 spots for SRR14458918.sra Written 1143880 spots for SRR14458918.sra SRR ids: ['SRR14458918.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ar2941ot SRR14458918.sra spots: 22877604 blocks: [[1, 1143880], [1143881, 2287760], [2287761, 3431640], [3431641, 4575520], [4575521, 5719400], [5719401, 6863280], [6863281, 8007160], [8007161, 9151040], [9151041, 10294920], [10294921, 11438800], [11438801, 12582680], [12582681, 13726560], [13726561, 14870440], [14870441, 16014320], [16014321, 17158200], [17158201, 18302080], [18302081, 19445960], [19445961, 20589840], [20589841, 21733720], [21733721, 22877604]] SRR14458918 file size 7753110 SRR14458918 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458918 SRR14458918_1.fastq SRR14458918_2.fastq Input file: SRR14458918_1.fastq Paired file: SRR14458918_2.fastq trimmed: SRR14458918-trimmed-pair1.fastq, SRR14458918-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:54:57 2024 >> started Fri Dec 6 09:55:25 2024 >> done (27.845s) 22877604 read pairs processed; of these: 3812 ( 0.02%) short read pairs filtered out after trimming by size control 1249 ( 0.01%) empty read pairs filtered out after trimming by size control 22872543 (99.98%) read pairs available; of these: 3882279 (16.97%) trimmed read pairs available after processing 18990264 (83.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 172 0.00% 19 175 0.00% 20 142 0.00% 21 168 0.00% 22 182 0.00% 23 150 0.00% 24 174 0.00% 25 152 0.00% 26 133 0.00% 27 136 0.00% 28 129 0.00% 29 114 0.00% 30 141 0.00% 31 102 0.00% 32 158 0.00% 33 147 0.00% 34 316 0.00% 35 150 0.00% 36 143 0.00% 37 121 0.00% 38 139 0.00% 39 120 0.00% 40 113 0.00% 41 152 0.00% 42 131 0.00% 43 132 0.00% 44 134 0.00% 45 130 0.00% 46 160 0.00% 47 161 0.00% 48 162 0.00% 49 188 0.00% 50 168 0.00% 51 166 0.00% 52 168 0.00% 53 198 0.00% 54 179 0.00% 55 188 0.00% 56 233 0.00% 57 240 0.00% 58 255 0.00% 59 294 0.00% 60 352 0.00% 61 343 0.00% 62 379 0.00% 63 376 0.00% 64 375 0.00% 65 413 0.00% 66 430 0.00% 67 518 0.00% 68 612 0.00% 69 684 0.00% 70 781 0.00% 71 909 0.00% 72 957 0.00% 73 1052 0.00% 74 1125 0.00% 75 1210 0.01% 76 1207 0.01% 77 1379 0.01% 78 1616 0.01% 79 1930 0.01% 80 2176 0.01% 81 2510 0.01% 82 2787 0.01% 83 3126 0.01% 84 3596 0.02% 85 3804 0.02% 86 4131 0.02% 87 4708 0.02% 88 5666 0.02% 89 7688 0.03% 90 9188 0.04% 91 8751 0.04% 92 8791 0.04% 93 9275 0.04% 94 10507 0.05% 95 12164 0.05% 96 12909 0.06% 97 13263 0.06% 98 14117 0.06% 99 16668 0.07% 100 18530 0.08% 101 19257 0.08% 102 19913 0.09% 103 22258 0.10% 104 23987 0.10% 105 24675 0.11% 106 27050 0.12% 107 28158 0.12% 108 29283 0.13% 109 31316 0.14% 110 34425 0.15% 111 35944 0.16% 112 38986 0.17% 113 41625 0.18% 114 45394 0.20% 115 48577 0.21% 116 49923 0.22% 117 50493 0.22% 118 52146 0.23% 119 54665 0.24% 120 56875 0.25% 121 60117 0.26% 122 64616 0.28% 123 67998 0.30% 124 72688 0.32% 125 75782 0.33% 126 77854 0.34% 127 79425 0.35% 128 81242 0.36% 129 82798 0.36% 130 86182 0.38% 131 87806 0.38% 132 90373 0.40% 133 96240 0.42% 134 99981 0.44% 135 101917 0.45% 136 104075 0.46% 137 104480 0.46% 138 105296 0.46% 139 106951 0.47% 140 108447 0.47% 141 108934 0.48% 142 113390 0.50% 143 115707 0.51% 144 117703 0.51% 145 119879 0.52% 146 118718 0.52% 147 122014 0.53% 148 128614 0.56% 149 123341 0.54% 150 126842 0.55% 151 18990264 83.03% 22872543 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=7 prefix-density=0.51 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=20.13 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=8 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=24.25 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458918 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:56:43 Started mapping on | Dec 06 09:56:44 Finished on | Dec 06 10:01:03 Mapping speed, Million of reads per hour | 317.92 Number of input reads | 22872543 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21043092 Uniquely mapped reads % | 92.00% Average mapped length | 291.44 Number of splices: Total | 21604627 Number of splices: Annotated (sjdb) | 20425196 Number of splices: GT/AG | 21316666 Number of splices: GC/AG | 245160 Number of splices: AT/AC | 8756 Number of splices: Non-canonical | 34045 Mismatch rate per base, % | 0.65% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320845 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 34404 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.95% % of reads unmapped: other | 1.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1509017 1509017 1509017 N_multimapping 320845 320845 320845 N_noFeature 666840 10582624 10746655 N_ambiguous 456390 40730 40399 UnstrandedReadsAssigned:19919862 PositiveStrandReadsAssigned:10419738 NegativeStrandReadsAssigned:10256038 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458918 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458918-trimmed-pair1.fastq SRR14458918-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,872,543 reads, 21,249,875 reads pseudoaligned [quant] estimated average fragment length: 229.448 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR14458918.ke.tsv 35125 SRR14458918.se.tsv 88098 total ==> SRR14458918.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.872 0 0 PNS24247 1044 815.552 36.7911 2.86585 PNS24249 1928 1699.55 101.566 3.79644 PNS24246 1044 815.552 36.7911 2.86585 PNS24248 1044 815.552 36.7911 2.86585 PNS24244 1471 1242.55 52.0608 2.6617 PNS24243 293 104.15 2 1.21992 KQK14069 1603 1374.55 9949.38 459.83 KQK14071 474 256.051 272.469 67.6012 ==> SRR14458918.se.tsv <== BRADI_1g14170v3 10951 BRADI_1g53295v3 75 BRADI_1g59795v3 378 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 2867 BRADI_1g74790v3 697 BRADI_1g09890v3 18 BRADI_1g77505v3 384 BRADI_1g48960v3 0 SRR14458918 completed mapping pipeline successfully