Starting /dee2/code/volunteer_pipeline.sh SRR14458919 current disk space = 1552300044288 free memory = 1607248152 SRR14458919 SRAfilesize d8e0f78375ec2d659b47bbc6a341cd24 SRR14458919.sra SRR14458919.sra file validated SRR14458919 is paired end SRR14458919 is conventional basespace SRR14458919 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458919_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05875 32.0 32.0 32.0 32.0 32.0 2 31.20975 32.0 32.0 32.0 32.0 32.0 3 31.24875 32.0 32.0 32.0 32.0 32.0 4 31.4435 32.0 32.0 32.0 32.0 32.0 5 31.3035 32.0 32.0 32.0 32.0 32.0 6 34.246 36.0 36.0 36.0 32.0 36.0 7 34.62125 36.0 36.0 36.0 32.0 36.0 8 34.3955 36.0 36.0 36.0 32.0 36.0 9 34.605 36.0 36.0 36.0 32.0 36.0 10-14 34.495850000000004 36.0 36.0 36.0 32.0 36.0 15-19 34.493550000000006 36.0 36.0 36.0 32.0 36.0 20-24 34.4814 36.0 36.0 36.0 32.0 36.0 25-29 34.20119999999999 36.0 36.0 36.0 32.0 36.0 30-34 34.1352 36.0 36.0 36.0 32.0 36.0 35-39 34.0373 36.0 36.0 36.0 32.0 36.0 40-44 33.8712 36.0 36.0 36.0 32.0 36.0 45-49 33.892500000000005 36.0 36.0 36.0 32.0 36.0 50-54 33.76475 36.0 36.0 36.0 30.0 36.0 55-59 33.56985 36.0 36.0 36.0 28.0 36.0 60-64 33.3988 36.0 36.0 36.0 24.6 36.0 65-69 33.24355 36.0 36.0 36.0 22.2 36.0 70-74 33.1223 36.0 33.6 36.0 24.6 36.0 75-79 32.88055 36.0 32.0 36.0 21.0 36.0 80-84 32.92985 36.0 32.0 36.0 22.2 36.0 85-89 32.8482 36.0 32.0 36.0 18.2 36.0 90-94 32.87835 36.0 32.0 36.0 19.6 36.0 95-99 32.75505 36.0 32.0 36.0 19.6 36.0 100-104 32.67315 36.0 32.0 36.0 18.2 36.0 105-109 32.53725000000001 36.0 32.0 36.0 16.8 36.0 110-114 32.56035000000001 36.0 32.0 36.0 15.4 36.0 115-119 32.33555 36.0 32.0 36.0 14.0 36.0 120-124 32.2898 36.0 32.0 36.0 14.0 36.0 125-129 32.06425 36.0 32.0 36.0 14.0 36.0 130-134 32.0031 36.0 32.0 36.0 14.0 36.0 135-139 31.771449999999998 36.0 32.0 36.0 14.0 36.0 140-144 31.340750000000003 36.0 29.0 36.0 14.0 36.0 145-149 31.036250000000003 36.0 27.0 36.0 14.0 36.0 150-151 28.833875 29.5 20.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 3.0 20 2.0 21 4.0 22 14.0 23 14.0 24 42.0 25 57.0 26 57.0 27 99.0 28 121.0 29 171.0 30 216.0 31 259.0 32 377.0 33 531.0 34 968.0 35 1063.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.325000000000003 12.1 13.25 51.324999999999996 2 23.625 18.375 35.925000000000004 22.075 3 21.925 23.974999999999998 25.2 28.9 4 25.775 29.15 17.474999999999998 27.6 5 28.025 30.525000000000002 19.8 21.65 6 22.545819733868942 32.412754205372835 21.616871704745165 23.424554356013054 7 21.25 16.25 38.3 24.2 8 21.525 19.950000000000003 26.85 31.674999999999997 9 23.1 20.325 28.975 27.6 10-14 24.125 25.535000000000004 23.77 26.57 15-19 25.235000000000003 24.4 23.65 26.715 20-24 24.73 24.62 23.52 27.13 25-29 25.5251050210042 24.379875975195038 23.43468693738748 26.660332066413282 30-34 25.058782330281655 24.678573215268397 23.487918355095303 26.774726099354645 35-39 25.69211514392991 24.055068836045056 23.64956195244055 26.60325406758448 40-44 25.95136625720732 24.19654048633743 22.77262471797443 27.07946853848082 45-49 25.698660378305156 24.103155887812953 23.440871004967136 26.757312728914755 50-54 25.68848758465011 23.832455480311012 23.611738148984198 26.86731878605468 55-59 25.641669596664823 24.451253202069413 23.170425435732582 26.736651765533175 60-64 26.08521102022382 23.350228333416972 23.550961007678026 27.013599638681185 65-69 25.959072854341596 23.244004223440093 23.968022525013826 26.828900397204485 70-74 26.643928374379293 23.579274715353364 23.32346892712043 26.453327983146913 75-79 25.973309251454946 23.836042544651818 23.605257876781057 26.58539032711218 80-84 25.846523742736927 23.95812462432378 23.477259066319377 26.718092566619916 85-89 26.42170604725671 23.207849419303166 23.953744493392072 26.416700040048056 90-94 26.382914874462337 23.25697709312794 23.542062618785636 26.818045413624088 95-99 26.527958387516254 23.622086625987794 23.34700410123037 26.50295088526558 100-104 26.448224112056028 24.087043521760883 23.516758379189596 25.947973986993496 105-109 26.901725431357836 24.216054013503378 23.055763940985248 25.826456614153535 110-114 26.47058823529412 24.034613845538217 22.86914765906363 26.625650260104038 115-119 26.63932376331716 23.928374931225928 23.288150852798477 26.144150452658433 120-124 26.486621655413856 23.53088272068017 23.110777694423607 26.87171792948237 125-129 27.353205961788536 23.807142142642792 22.856857057117136 25.982794838451532 130-134 26.955391078215644 23.88477695539108 22.654530906181236 26.505301060212044 135-139 26.738021406421925 24.46734020206062 22.68680604181254 26.107832349704914 140-144 26.912691269126913 24.722472247224722 22.50725072507251 25.85758575857586 145-149 27.552755275527552 23.75237523752375 22.487248724872487 26.207620762076207 150-151 25.974999999999998 24.1625 23.1125 26.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 3.0 28 3.5 29 6.0 30 6.5 31 6.5 32 15.0 33 16.5 34 13.5 35 24.0 36 44.0 37 54.5 38 66.0 39 82.0 40 97.5 41 125.0 42 140.0 43 135.5 44 154.0 45 174.0 46 152.5 47 141.5 48 142.5 49 134.5 50 141.5 51 134.0 52 117.0 53 119.0 54 116.5 55 110.0 56 103.0 57 106.5 58 96.5 59 94.0 60 99.5 61 90.0 62 93.0 63 85.5 64 82.5 65 81.0 66 68.0 67 75.0 68 69.0 69 53.0 70 58.0 71 55.0 72 46.5 73 38.0 74 28.5 75 24.0 76 19.0 77 16.0 78 15.5 79 9.0 80 4.0 81 3.0 82 2.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.42500000000000004 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.055 35-39 0.125 40-44 0.27499999999999997 45-49 0.345 50-54 0.325 55-59 0.455 60-64 0.365 65-69 0.555 70-74 0.315 75-79 0.33999999999999997 80-84 0.18 85-89 0.12 90-94 0.03 95-99 0.03 100-104 0.05 105-109 0.025 110-114 0.04 115-119 0.034999999999999996 120-124 0.025 125-129 0.03 130-134 0.02 135-139 0.03 140-144 0.01 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19151086407277 98.15 2 0.5811015664477008 1.15 3 0.202122283981809 0.6 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.275 0.025 0.0 0.0 0.0 118-119 1.475 0.025 0.0 0.0 0.0 120-121 1.775 0.025 0.0 0.0 0.0 122-123 1.9375 0.025 0.0 0.0 0.0 124-125 2.2 0.025 0.0 0.0 0.0 126-127 2.4000000000000004 0.025 0.0 0.0 0.0 128-129 2.7 0.025 0.0 0.0 0.0 130-131 3.0875 0.025 0.0 0.0 0.0 132-133 3.4749999999999996 0.025 0.0 0.0 0.0 134-135 3.8375000000000004 0.025 0.0 0.0 0.0 136-137 4.55 0.025 0.0 0.0 0.0 138-139 4.9625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458919 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458919_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9995 32.0 32.0 32.0 32.0 32.0 2 30.6805 32.0 32.0 32.0 32.0 32.0 3 30.613 32.0 32.0 32.0 32.0 32.0 4 30.6115 32.0 32.0 32.0 32.0 32.0 5 30.6255 32.0 32.0 32.0 32.0 32.0 6 33.84375 36.0 36.0 36.0 32.0 36.0 7 33.95775 36.0 36.0 36.0 32.0 36.0 8 33.94425 36.0 36.0 36.0 32.0 36.0 9 33.944 36.0 36.0 36.0 32.0 36.0 10-14 33.91689999999999 36.0 36.0 36.0 32.0 36.0 15-19 33.86095 36.0 36.0 36.0 32.0 36.0 20-24 33.8095 36.0 36.0 36.0 31.0 36.0 25-29 33.7599 36.0 36.0 36.0 30.0 36.0 30-34 33.739850000000004 36.0 36.0 36.0 31.0 36.0 35-39 33.5469 36.0 36.0 36.0 27.0 36.0 40-44 33.55575 36.0 36.0 36.0 27.0 36.0 45-49 33.4265 36.0 36.0 36.0 22.0 36.0 50-54 33.2104 36.0 36.0 36.0 21.0 36.0 55-59 33.007749999999994 36.0 36.0 36.0 15.4 36.0 60-64 32.781499999999994 36.0 36.0 36.0 14.0 36.0 65-69 32.48815 36.0 32.0 36.0 14.0 36.0 70-74 32.178399999999996 36.0 32.8 36.0 14.0 36.0 75-79 31.92085 36.0 32.0 36.0 14.0 36.0 80-84 31.683600000000002 36.0 32.0 36.0 14.0 36.0 85-89 31.809649999999998 36.0 32.0 36.0 14.0 36.0 90-94 31.517450000000004 36.0 32.0 36.0 14.0 36.0 95-99 31.401250000000005 36.0 32.0 36.0 14.0 36.0 100-104 31.402049999999996 36.0 32.0 36.0 14.0 36.0 105-109 31.3308 36.0 32.0 36.0 14.0 36.0 110-114 31.134000000000004 36.0 32.0 36.0 14.0 36.0 115-119 30.666000000000004 36.0 28.0 36.0 14.0 36.0 120-124 30.80955 36.0 31.0 36.0 14.0 36.0 125-129 30.395249999999997 35.2 27.0 36.0 14.0 36.0 130-134 29.810250000000003 33.6 27.0 36.0 14.0 36.0 135-139 29.256549999999997 32.0 27.0 36.0 14.0 36.0 140-144 29.2305 32.0 27.0 36.0 14.0 36.0 145-149 29.30885 32.0 27.0 36.0 14.0 36.0 150-151 26.43075 29.5 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 4.0 9 3.0 10 9.0 11 9.0 12 5.0 13 5.0 14 5.0 15 12.0 16 12.0 17 14.0 18 6.0 19 10.0 20 11.0 21 17.0 22 27.0 23 37.0 24 55.0 25 81.0 26 87.0 27 128.0 28 141.0 29 205.0 30 261.0 31 284.0 32 399.0 33 593.0 34 909.0 35 668.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.386693346673336 10.78039019509755 11.230615307653826 54.602301150575286 2 23.525 16.025 38.324999999999996 22.125 3 22.15 21.3 25.95 30.599999999999998 4 26.924999999999997 27.025 17.549999999999997 28.499999999999996 5 28.375 29.75 20.150000000000002 21.725 6 21.475 33.725 20.5 24.3 7 21.75 15.725 38.224999999999994 24.3 8 20.825 20.7 25.75 32.725 9 21.6 20.125 30.725 27.55 10-14 24.404999999999998 24.775 23.630000000000003 27.189999999999998 15-19 25.46 24.02 23.355 27.165 20-24 25.290000000000003 24.035 23.59 27.084999999999997 25-29 25.551277563878195 23.821191059552977 23.556177808890443 27.071353567678386 30-34 25.068856727928292 24.402824377785567 23.66167559717562 26.86664329711052 35-39 25.376657292085174 23.995580554439535 23.55363599839293 27.07412615508236 40-44 26.023758207608644 24.424840860107263 22.51014986717458 27.041251065109517 45-49 25.821690622173083 24.359232083626495 23.017388682279627 26.8016886119208 50-54 25.254613290309567 24.039528083089646 23.782393869113644 26.923464757487142 55-59 25.765820233776704 24.511285771866184 23.115679161628375 26.607214832728737 60-64 25.950421568132477 23.930933508355633 23.471499974756398 26.647144948755493 65-69 25.48276210696593 24.54251339601658 22.9804873116975 26.994237185319985 70-74 25.893401015228427 24.01522842639594 23.502538071065988 26.588832487309645 75-79 25.733909946578482 23.8616128211651 23.37827524802849 27.02620198422793 80-84 25.97681189029062 23.90316155064099 22.876551407119873 27.243475151948516 85-89 25.759044751747716 23.993468388018574 23.65668214522631 26.590804715007398 90-94 26.020251610923594 24.122941597627083 22.90068528178378 26.956121509665543 95-99 25.937276534886095 23.94013688834406 23.19950965369292 26.923076923076923 100-104 26.428790512217564 23.913710254575197 23.157141396585214 26.500357836622022 105-109 26.558030241111563 23.81487535758071 23.56967715570086 26.057417245606867 110-114 26.155973168108964 23.68784884018639 23.324286957857545 26.8318910338471 115-119 26.825266611977028 24.230926989335522 22.17493847415915 26.7688679245283 120-124 26.088740702744296 24.113875352654528 22.80584765324442 26.99153629135676 125-129 26.91893002002362 24.36206808029984 22.929609282743748 25.789392616932794 130-134 27.060876706703624 24.07350374704856 22.554152551072786 26.31146699517503 135-139 27.014948374171677 23.948220064724918 23.100631838495918 25.93619972260749 140-144 27.526561617820665 24.118462249140276 22.871221064517787 25.483755068521276 145-149 28.036759420885097 24.181127425813738 22.646062224047643 25.136050929253518 150-151 27.692900243933753 24.637309025548852 23.00680446783926 24.662986262678135 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 2.5 18 3.0 19 2.0 20 2.5 21 3.5 22 4.5 23 5.0 24 4.0 25 4.0 26 4.0 27 5.0 28 6.5 29 7.5 30 8.5 31 7.5 32 12.5 33 17.5 34 17.5 35 24.5 36 37.0 37 43.0 38 51.5 39 75.0 40 91.0 41 112.5 42 148.5 43 152.5 44 151.0 45 159.5 46 165.0 47 159.5 48 139.0 49 142.0 50 141.5 51 132.5 52 119.5 53 101.0 54 98.5 55 101.0 56 100.5 57 95.0 58 95.5 59 102.0 60 100.0 61 82.5 62 90.0 63 103.0 64 93.5 65 76.0 66 73.5 67 86.5 68 76.5 69 59.5 70 52.0 71 47.0 72 40.0 73 39.5 74 37.0 75 24.5 76 17.5 77 16.0 78 10.0 79 4.5 80 3.5 81 2.5 82 1.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.155 35-39 0.44 40-44 0.245 45-49 0.51 50-54 0.83 55-59 0.76 60-64 0.9650000000000001 65-69 1.09 70-74 1.5 75-79 1.725 80-84 2.105 85-89 2.015 90-94 2.23 95-99 2.11 100-104 2.19 105-109 2.12 110-114 2.355 115-119 2.48 120-124 2.5250000000000004 125-129 2.6149999999999998 130-134 2.59 135-139 2.665 140-144 2.585 145-149 2.6100000000000003 150-151 2.6374999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.6806150743634989 1.35 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.0875 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0125 92-93 0.25 0.0 0.0 0.0 0.025 94-95 0.3 0.0 0.0 0.0 0.025 96-97 0.35 0.0 0.0 0.0 0.025 98-99 0.35 0.0 0.0 0.0 0.025 100-101 0.4625 0.0 0.0 0.0 0.025 102-103 0.55 0.0 0.0 0.0 0.025 104-105 0.65 0.0 0.0 0.0 0.025 106-107 0.675 0.0 0.0 0.0 0.025 108-109 0.75 0.0 0.0 0.0 0.025 110-111 0.9 0.0 0.0 0.0 0.025 112-113 0.975 0.0 0.0 0.0 0.025 114-115 1.0750000000000002 0.0 0.0 0.0 0.025 116-117 1.2000000000000002 0.0 0.0 0.0 0.025 118-119 1.4125 0.0 0.0 0.0 0.025 120-121 1.725 0.0 0.0 0.0 0.025 122-123 1.875 0.0 0.0 0.0 0.025 124-125 2.1125 0.0 0.0 0.0 0.025 126-127 2.3125 0.0 0.0 0.0 0.025 128-129 2.5875 0.0 0.0 0.0 0.025 130-131 2.95 0.0 0.0 0.0 0.025 132-133 3.275 0.0 0.0 0.0 0.025 134-135 3.575 0.0 0.0 0.0 0.025 136-137 4.2625 0.0 0.0 0.0 0.025 138-139 4.625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGACC 15 1.2132272E-4 142.7875 2 >>END_MODULE Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra Read 1087095 spots for SRR14458919.sra Written 1087095 spots for SRR14458919.sra SRR ids: ['SRR14458919.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ax8wwbbq SRR14458919.sra spots: 21741900 blocks: [[1, 1087095], [1087096, 2174190], [2174191, 3261285], [3261286, 4348380], [4348381, 5435475], [5435476, 6522570], [6522571, 7609665], [7609666, 8696760], [8696761, 9783855], [9783856, 10870950], [10870951, 11958045], [11958046, 13045140], [13045141, 14132235], [14132236, 15219330], [15219331, 16306425], [16306426, 17393520], [17393521, 18480615], [18480616, 19567710], [19567711, 20654805], [20654806, 21741900]] SRR14458919 file size 7367148 SRR14458919 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458919 SRR14458919_1.fastq SRR14458919_2.fastq Input file: SRR14458919_1.fastq Paired file: SRR14458919_2.fastq trimmed: SRR14458919-trimmed-pair1.fastq, SRR14458919-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:21:34 2024 >> started Fri Dec 6 10:22:08 2024 >> done (34.423s) 21741900 read pairs processed; of these: 5646 ( 0.03%) short read pairs filtered out after trimming by size control 918 ( 0.00%) empty read pairs filtered out after trimming by size control 21735336 (99.97%) read pairs available; of these: 2315387 (10.65%) trimmed read pairs available after processing 19419949 (89.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 247 0.00% 19 262 0.00% 20 231 0.00% 21 228 0.00% 22 238 0.00% 23 224 0.00% 24 251 0.00% 25 171 0.00% 26 184 0.00% 27 168 0.00% 28 174 0.00% 29 190 0.00% 30 186 0.00% 31 153 0.00% 32 205 0.00% 33 165 0.00% 34 426 0.00% 35 167 0.00% 36 155 0.00% 37 128 0.00% 38 151 0.00% 39 146 0.00% 40 144 0.00% 41 195 0.00% 42 151 0.00% 43 155 0.00% 44 143 0.00% 45 139 0.00% 46 154 0.00% 47 160 0.00% 48 179 0.00% 49 187 0.00% 50 184 0.00% 51 203 0.00% 52 194 0.00% 53 219 0.00% 54 196 0.00% 55 192 0.00% 56 245 0.00% 57 234 0.00% 58 288 0.00% 59 307 0.00% 60 337 0.00% 61 329 0.00% 62 363 0.00% 63 327 0.00% 64 350 0.00% 65 377 0.00% 66 358 0.00% 67 521 0.00% 68 580 0.00% 69 566 0.00% 70 675 0.00% 71 768 0.00% 72 748 0.00% 73 834 0.00% 74 880 0.00% 75 959 0.00% 76 939 0.00% 77 1123 0.01% 78 1197 0.01% 79 1392 0.01% 80 1562 0.01% 81 1755 0.01% 82 2006 0.01% 83 2117 0.01% 84 2371 0.01% 85 2638 0.01% 86 2705 0.01% 87 3068 0.01% 88 3915 0.02% 89 5672 0.03% 90 6844 0.03% 91 6000 0.03% 92 5642 0.03% 93 5722 0.03% 94 6402 0.03% 95 7670 0.04% 96 7892 0.04% 97 8119 0.04% 98 8524 0.04% 99 10484 0.05% 100 11836 0.05% 101 11578 0.05% 102 11250 0.05% 103 12575 0.06% 104 13472 0.06% 105 13846 0.06% 106 15140 0.07% 107 15303 0.07% 108 15690 0.07% 109 16793 0.08% 110 18553 0.09% 111 18995 0.09% 112 20488 0.09% 113 22303 0.10% 114 24171 0.11% 115 25741 0.12% 116 26144 0.12% 117 26653 0.12% 118 27121 0.12% 119 28870 0.13% 120 29788 0.14% 121 31584 0.15% 122 34680 0.16% 123 36883 0.17% 124 38884 0.18% 125 40996 0.19% 126 42677 0.20% 127 43565 0.20% 128 45237 0.21% 129 46227 0.21% 130 48865 0.22% 131 49017 0.23% 132 50979 0.23% 133 55095 0.25% 134 58769 0.27% 135 59578 0.27% 136 61528 0.28% 137 62472 0.29% 138 63627 0.29% 139 64810 0.30% 140 66714 0.31% 141 68086 0.31% 142 70902 0.33% 143 73044 0.34% 144 74898 0.34% 145 77307 0.36% 146 77832 0.36% 147 81520 0.38% 148 87208 0.40% 149 84921 0.39% 150 88122 0.41% 151 19419949 89.35% 21735336 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=8 prefix-density=0.52 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=17.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=6 prefix-density=0.55 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=20.66 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458919 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:23:19 Started mapping on | Dec 06 10:23:19 Finished on | Dec 06 10:27:31 Mapping speed, Million of reads per hour | 310.50 Number of input reads | 21735336 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19656306 Uniquely mapped reads % | 90.43% Average mapped length | 293.91 Number of splices: Total | 20408759 Number of splices: Annotated (sjdb) | 19284120 Number of splices: GT/AG | 20138276 Number of splices: GC/AG | 231884 Number of splices: AT/AC | 7537 Number of splices: Non-canonical | 31062 Mismatch rate per base, % | 0.71% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392144 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 44780 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.21% % of reads unmapped: other | 2.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1687285 1687285 1687285 N_multimapping 392144 392144 392144 N_noFeature 664178 9933760 10028701 N_ambiguous 438507 42932 42789 UnstrandedReadsAssigned:18553621 PositiveStrandReadsAssigned:9679614 NegativeStrandReadsAssigned:9584816 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458919 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458919-trimmed-pair1.fastq SRR14458919-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,735,336 reads, 19,927,325 reads pseudoaligned [quant] estimated average fragment length: 249.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR14458919.ke.tsv 35125 SRR14458919.se.tsv 88098 total ==> SRR14458919.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.408 0 0 PNS24247 1044 795.095 25.9583 2.12049 PNS24249 1928 1679.1 131.226 5.07601 PNS24246 1044 795.095 25.9583 2.12049 PNS24248 1044 795.095 25.9583 2.12049 PNS24244 1471 1222.1 35.899 1.9079 PNS24243 293 94.6974 5 3.42933 KQK14069 1603 1354.1 6612.63 317.178 KQK14071 474 239.313 169.823 46.0902 ==> SRR14458919.se.tsv <== BRADI_1g14170v3 7298 BRADI_1g53295v3 59 BRADI_1g59795v3 319 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 2525 BRADI_1g74790v3 642 BRADI_1g09890v3 11 BRADI_1g77505v3 399 BRADI_1g48960v3 0 SRR14458919 completed mapping pipeline successfully