Starting /dee2/code/volunteer_pipeline.sh SRR14458920 current disk space = 1552299470848 free memory = 1605399856 SRR14458920 SRAfilesize 49954b9ab80f5526dccf07d0d12a2eea SRR14458920.sra SRR14458920.sra file validated SRR14458920 is paired end SRR14458920 is conventional basespace SRR14458920 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458920_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4275 32.0 32.0 32.0 32.0 32.0 2 31.42725 32.0 32.0 32.0 32.0 32.0 3 31.54725 32.0 32.0 32.0 32.0 32.0 4 31.5575 32.0 32.0 32.0 32.0 32.0 5 31.57975 32.0 32.0 32.0 32.0 32.0 6 34.9095 36.0 36.0 36.0 36.0 36.0 7 35.105 36.0 36.0 36.0 36.0 36.0 8 35.108 36.0 36.0 36.0 36.0 36.0 9 35.158 36.0 36.0 36.0 36.0 36.0 10-14 35.10195 36.0 36.0 36.0 36.0 36.0 15-19 35.04215 36.0 36.0 36.0 35.2 36.0 20-24 35.027950000000004 36.0 36.0 36.0 36.0 36.0 25-29 34.96565 36.0 36.0 36.0 33.6 36.0 30-34 34.90265000000001 36.0 36.0 36.0 32.0 36.0 35-39 34.8639 36.0 36.0 36.0 33.6 36.0 40-44 34.8174 36.0 36.0 36.0 32.0 36.0 45-49 34.728449999999995 36.0 36.0 36.0 32.0 36.0 50-54 34.6918 36.0 36.0 36.0 32.0 36.0 55-59 34.67995 36.0 36.0 36.0 32.0 36.0 60-64 34.5092 36.0 36.0 36.0 32.0 36.0 65-69 34.57854999999999 36.0 36.0 36.0 32.0 36.0 70-74 34.4332 36.0 36.0 36.0 32.0 36.0 75-79 34.33895 36.0 36.0 36.0 32.0 36.0 80-84 34.2339 36.0 36.0 36.0 32.0 36.0 85-89 34.080450000000006 36.0 36.0 36.0 32.0 36.0 90-94 34.17275 36.0 36.0 36.0 32.0 36.0 95-99 33.9911 36.0 36.0 36.0 32.0 36.0 100-104 33.9346 36.0 36.0 36.0 30.0 36.0 105-109 33.87925 36.0 36.0 36.0 29.0 36.0 110-114 33.87625 36.0 36.0 36.0 30.0 36.0 115-119 33.74015 36.0 36.0 36.0 28.0 36.0 120-124 33.75305000000001 36.0 36.0 36.0 27.0 36.0 125-129 33.49435 36.0 36.0 36.0 27.0 36.0 130-134 33.494350000000004 36.0 36.0 36.0 27.0 36.0 135-139 33.537 36.0 35.2 36.0 27.0 36.0 140-144 33.3449 36.0 34.4 36.0 27.0 36.0 145-149 33.23515 36.0 33.6 36.0 27.0 36.0 150-151 31.59375 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 8.0 23 8.0 24 11.0 25 19.0 26 30.0 27 38.0 28 65.0 29 77.0 30 114.0 31 160.0 32 233.0 33 345.0 34 745.0 35 2142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.849999999999998 11.899999999999999 11.3 52.949999999999996 2 22.325 17.75 36.75 23.175 3 22.6 22.075 23.200000000000003 32.125 4 27.700000000000003 27.825 16.575 27.900000000000002 5 27.750000000000004 29.775000000000002 19.25 23.225 6 21.896162528216703 32.129420617005266 20.742412841735643 25.232004013042385 7 21.425 14.625 38.425 25.525 8 20.9 19.175 27.55 32.375 9 22.625 20.175 27.450000000000003 29.75 10-14 24.9 24.335 23.315 27.450000000000003 15-19 26.075 22.96 23.294999999999998 27.67 20-24 25.259999999999998 23.22 24.075 27.445000000000004 25-29 25.395 23.305 23.405 27.894999999999996 30-34 25.8 23.655 23.064999999999998 27.48 35-39 26.075 23.565 22.869999999999997 27.49 40-44 25.825 23.895 22.935 27.345000000000002 45-49 26.075 23.625 23.025000000000002 27.275 50-54 26.355 23.565 23.225 26.855 55-59 26.145000000000003 23.28 23.06 27.515 60-64 26.51 23.244999999999997 23.075000000000003 27.169999999999998 65-69 26.090000000000003 23.75 23.195 26.965 70-74 26.540000000000003 23.150000000000002 23.189999999999998 27.12 75-79 26.705000000000002 22.615 22.935 27.744999999999997 80-84 26.33 23.400000000000002 22.900000000000002 27.37 85-89 26.51 23.325000000000003 23.200000000000003 26.965 90-94 26.729999999999997 23.265 23.145 26.86 95-99 26.96 23.155 22.895 26.99 100-104 27.029999999999998 23.805 23.125 26.040000000000003 105-109 26.384999999999998 23.44 22.945 27.229999999999997 110-114 26.584999999999997 23.265 22.98 27.169999999999998 115-119 26.775 23.705000000000002 22.525000000000002 26.995 120-124 27.139999999999997 23.46 22.82 26.58 125-129 26.845000000000002 23.505000000000003 22.95 26.700000000000003 130-134 27.11 23.330000000000002 22.61 26.950000000000003 135-139 27.32 24.065 22.15 26.465 140-144 27.334999999999997 23.69 22.21 26.765 145-149 26.985 24.91 21.62 26.484999999999996 150-151 26.8125 25.2375 21.9375 26.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 2.5 29 2.0 30 4.0 31 8.0 32 11.5 33 16.5 34 18.5 35 25.5 36 38.0 37 48.0 38 52.5 39 65.5 40 86.0 41 105.5 42 130.0 43 140.0 44 138.0 45 151.5 46 165.0 47 153.0 48 137.0 49 130.5 50 116.5 51 119.5 52 114.0 53 99.0 54 103.0 55 104.5 56 105.5 57 101.0 58 109.0 59 113.5 60 101.5 61 91.5 62 91.5 63 87.5 64 87.0 65 88.5 66 80.5 67 86.0 68 83.0 69 74.0 70 76.0 71 64.5 72 49.5 73 40.0 74 38.5 75 36.0 76 27.0 77 21.0 78 21.0 79 14.5 80 6.0 81 6.0 82 2.5 83 0.5 84 1.5 85 2.0 86 0.5 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.325 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.9 0.0 0.0 0.0 0.025 134-135 6.525 0.0 0.0 0.0 0.025 136-137 7.2625 0.0 0.0 0.0 0.025 138-139 8.0125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGATCA 10 0.006585701 146.75949 3 >>END_MODULE SRR14458920 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458920_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.367 32.0 32.0 32.0 32.0 32.0 2 31.1915 32.0 32.0 32.0 32.0 32.0 3 31.2045 32.0 32.0 32.0 32.0 32.0 4 31.23225 32.0 32.0 32.0 32.0 32.0 5 31.235 32.0 32.0 32.0 32.0 32.0 6 34.84775 36.0 36.0 36.0 32.0 36.0 7 34.9335 36.0 36.0 36.0 32.0 36.0 8 34.8695 36.0 36.0 36.0 32.0 36.0 9 34.9235 36.0 36.0 36.0 32.0 36.0 10-14 34.78165 36.0 36.0 36.0 32.0 36.0 15-19 34.7195 36.0 36.0 36.0 32.0 36.0 20-24 34.71965 36.0 36.0 36.0 32.0 36.0 25-29 34.7389 36.0 36.0 36.0 32.0 36.0 30-34 34.69160000000001 36.0 36.0 36.0 32.0 36.0 35-39 34.67524999999999 36.0 36.0 36.0 32.0 36.0 40-44 34.646100000000004 36.0 36.0 36.0 32.0 36.0 45-49 34.5826 36.0 36.0 36.0 32.0 36.0 50-54 34.58965 36.0 36.0 36.0 32.0 36.0 55-59 34.4406 36.0 36.0 36.0 32.0 36.0 60-64 34.42185 36.0 36.0 36.0 32.0 36.0 65-69 34.19685 36.0 36.0 36.0 32.0 36.0 70-74 34.24685 36.0 36.0 36.0 32.0 36.0 75-79 34.08445 36.0 36.0 36.0 32.0 36.0 80-84 33.9903 36.0 36.0 36.0 32.0 36.0 85-89 33.7746 36.0 36.0 36.0 28.0 36.0 90-94 33.78575 36.0 36.0 36.0 27.0 36.0 95-99 33.7261 36.0 36.0 36.0 27.0 36.0 100-104 33.7954 36.0 36.0 36.0 28.0 36.0 105-109 33.63415 36.0 36.0 36.0 27.0 36.0 110-114 33.5011 36.0 36.0 36.0 27.0 36.0 115-119 33.432050000000004 36.0 35.2 36.0 27.0 36.0 120-124 33.3401 36.0 35.2 36.0 27.0 36.0 125-129 33.3677 36.0 36.0 36.0 27.0 36.0 130-134 33.283300000000004 36.0 35.2 36.0 27.0 36.0 135-139 32.9828 36.0 32.0 36.0 27.0 36.0 140-144 32.98865 36.0 32.0 36.0 27.0 36.0 145-149 32.48870000000001 36.0 32.0 36.0 24.6 36.0 150-151 30.217624999999998 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 5.0 19 3.0 20 2.0 21 3.0 22 7.0 23 14.0 24 21.0 25 39.0 26 38.0 27 46.0 28 73.0 29 94.0 30 140.0 31 174.0 32 204.0 33 391.0 34 845.0 35 1899.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.673673673673672 10.635635635635635 11.886886886886886 53.80380380380381 2 23.474999999999998 16.55 36.95 23.025000000000002 3 23.3 21.65 23.575 31.474999999999998 4 28.375 26.275 16.8 28.549999999999997 5 28.4 28.725 20.175 22.7 6 23.325000000000003 32.574999999999996 18.925 25.174999999999997 7 20.599999999999998 15.625 38.15 25.624999999999996 8 21.05 20.575 26.25 32.125 9 23.549999999999997 19.325 28.125 28.999999999999996 10-14 24.69 24.945 23.105 27.26 15-19 25.7 23.665 23.26 27.375 20-24 25.855 23.880000000000003 23.305 26.96 25-29 25.165 23.599999999999998 23.244999999999997 27.99 30-34 25.990000000000002 23.155 23.515 27.339999999999996 35-39 26.424999999999997 23.115 23.555 26.905 40-44 26.145000000000003 23.395 23.01 27.450000000000003 45-49 26.040000000000003 24.099999999999998 23.01 26.85 50-54 26.1 23.485 23.535 26.88 55-59 26.51 23.61 22.93 26.950000000000003 60-64 26.265 23.09 23.405 27.24 65-69 26.325 23.515 23.400000000000002 26.76 70-74 26.27 23.435 23.165 27.13 75-79 25.790000000000003 23.035 23.56 27.615000000000002 80-84 26.41 23.14 23.189999999999998 27.26 85-89 26.674999999999997 23.14 23.095 27.089999999999996 90-94 26.805 23.119999999999997 22.845 27.229999999999997 95-99 26.695 22.685 23.21 27.41 100-104 26.905 23.724999999999998 22.73 26.640000000000004 105-109 26.75 23.494999999999997 22.785 26.97 110-114 27.195000000000004 23.885 22.245 26.674999999999997 115-119 27.205000000000002 23.52 22.830000000000002 26.445 120-124 27.38 23.46 22.74 26.419999999999998 125-129 27.295 23.71 22.795 26.200000000000003 130-134 28.07 23.72 22.17 26.040000000000003 135-139 28.410000000000004 23.455000000000002 22.395 25.740000000000002 140-144 29.025000000000002 23.674999999999997 22.56 24.740000000000002 145-149 29.13 24.065 22.12 24.685000000000002 150-151 28.6375 23.849999999999998 21.8625 25.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 2.0 29 2.5 30 6.0 31 7.5 32 7.5 33 16.5 34 21.5 35 26.5 36 34.0 37 37.0 38 53.0 39 79.5 40 83.5 41 96.5 42 118.0 43 127.5 44 146.0 45 140.5 46 138.0 47 158.5 48 168.5 49 159.0 50 139.0 51 129.5 52 118.0 53 107.0 54 115.5 55 113.5 56 96.5 57 95.5 58 103.0 59 106.0 60 101.5 61 91.5 62 85.5 63 88.0 64 87.5 65 84.0 66 81.0 67 78.5 68 67.5 69 59.5 70 65.5 71 69.0 72 66.5 73 57.0 74 42.5 75 31.5 76 24.0 77 17.5 78 17.0 79 13.0 80 7.5 81 3.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0125 96-97 0.2875 0.0 0.0 0.0 0.025 98-99 0.35 0.0 0.0 0.0 0.025 100-101 0.42500000000000004 0.0 0.0 0.0 0.025 102-103 0.5375 0.0 0.0 0.0 0.025 104-105 0.75 0.0 0.0 0.0 0.025 106-107 0.9375 0.0 0.0 0.0 0.025 108-109 1.05 0.0 0.0 0.0 0.025 110-111 1.2 0.0 0.0 0.0 0.025 112-113 1.375 0.0 0.0 0.0 0.025 114-115 1.7125 0.0 0.0 0.0 0.025 116-117 2.0 0.0 0.0 0.0 0.025 118-119 2.2625 0.0 0.0 0.0 0.025 120-121 2.5999999999999996 0.0 0.0 0.0 0.025 122-123 2.9375 0.0 0.0 0.0 0.025 124-125 3.5250000000000004 0.0 0.0 0.0 0.025 126-127 4.225 0.0 0.0 0.0 0.025 128-129 4.85 0.0 0.0 0.0 0.025 130-131 5.375 0.0 0.0 0.0 0.025 132-133 5.9 0.0 0.0 0.0 0.025 134-135 6.525 0.0 0.0 0.0 0.025 136-137 7.2625 0.0 0.0 0.0 0.025 138-139 8.0625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATCT 10 0.006830828 145.0 7 >>END_MODULE Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra Read 889895 spots for SRR14458920.sra Written 889895 spots for SRR14458920.sra SRR ids: ['SRR14458920.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmzu2ml8 SRR14458920.sra spots: 17797900 blocks: [[1, 889895], [889896, 1779790], [1779791, 2669685], [2669686, 3559580], [3559581, 4449475], [4449476, 5339370], [5339371, 6229265], [6229266, 7119160], [7119161, 8009055], [8009056, 8898950], [8898951, 9788845], [9788846, 10678740], [10678741, 11568635], [11568636, 12458530], [12458531, 13348425], [13348426, 14238320], [14238321, 15128215], [15128216, 16018110], [16018111, 16908005], [16908006, 17797900]] SRR14458920 file size 6026804 SRR14458920 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458920 SRR14458920_1.fastq SRR14458920_2.fastq Input file: SRR14458920_1.fastq Paired file: SRR14458920_2.fastq trimmed: SRR14458920-trimmed-pair1.fastq, SRR14458920-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:51:40 2024 >> started Fri Dec 6 09:51:58 2024 >> done (18.924s) 17797900 read pairs processed; of these: 4091 ( 0.02%) short read pairs filtered out after trimming by size control 2313 ( 0.01%) empty read pairs filtered out after trimming by size control 17791496 (99.96%) read pairs available; of these: 2662580 (14.97%) trimmed read pairs available after processing 15128916 (85.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 191 0.00% 19 200 0.00% 20 180 0.00% 21 187 0.00% 22 166 0.00% 23 183 0.00% 24 210 0.00% 25 164 0.00% 26 176 0.00% 27 153 0.00% 28 144 0.00% 29 162 0.00% 30 145 0.00% 31 117 0.00% 32 160 0.00% 33 156 0.00% 34 348 0.00% 35 133 0.00% 36 112 0.00% 37 133 0.00% 38 125 0.00% 39 121 0.00% 40 113 0.00% 41 135 0.00% 42 141 0.00% 43 119 0.00% 44 101 0.00% 45 122 0.00% 46 118 0.00% 47 161 0.00% 48 160 0.00% 49 164 0.00% 50 159 0.00% 51 175 0.00% 52 158 0.00% 53 177 0.00% 54 162 0.00% 55 161 0.00% 56 172 0.00% 57 200 0.00% 58 235 0.00% 59 251 0.00% 60 263 0.00% 61 259 0.00% 62 254 0.00% 63 232 0.00% 64 298 0.00% 65 301 0.00% 66 310 0.00% 67 347 0.00% 68 386 0.00% 69 429 0.00% 70 460 0.00% 71 579 0.00% 72 543 0.00% 73 574 0.00% 74 612 0.00% 75 627 0.00% 76 675 0.00% 77 689 0.00% 78 851 0.00% 79 979 0.01% 80 1069 0.01% 81 1275 0.01% 82 1391 0.01% 83 1583 0.01% 84 1694 0.01% 85 1777 0.01% 86 1940 0.01% 87 2140 0.01% 88 2370 0.01% 89 2657 0.01% 90 3002 0.02% 91 3610 0.02% 92 4040 0.02% 93 4409 0.02% 94 4765 0.03% 95 5314 0.03% 96 5721 0.03% 97 6453 0.04% 98 6693 0.04% 99 7619 0.04% 100 8446 0.05% 101 9557 0.05% 102 10430 0.06% 103 11956 0.07% 104 12800 0.07% 105 13667 0.08% 106 14819 0.08% 107 15719 0.09% 108 16860 0.09% 109 18423 0.10% 110 19890 0.11% 111 21948 0.12% 112 24304 0.14% 113 26301 0.15% 114 28549 0.16% 115 30722 0.17% 116 31964 0.18% 117 33361 0.19% 118 34661 0.19% 119 36454 0.20% 120 38778 0.22% 121 41311 0.23% 122 44026 0.25% 123 46797 0.26% 124 50145 0.28% 125 52806 0.30% 126 53825 0.30% 127 55414 0.31% 128 57122 0.32% 129 58263 0.33% 130 60528 0.34% 131 62782 0.35% 132 65758 0.37% 133 68540 0.39% 134 71588 0.40% 135 73191 0.41% 136 75354 0.42% 137 76333 0.43% 138 76363 0.43% 139 78085 0.44% 140 79378 0.45% 141 79743 0.45% 142 83388 0.47% 143 85167 0.48% 144 86096 0.48% 145 88175 0.50% 146 88049 0.49% 147 88662 0.50% 148 90821 0.51% 149 88970 0.50% 150 90251 0.51% 151 15128916 85.03% 17791496 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=17 prefix-density=0.62 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=32.11 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=7 prefix-density=0.57 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=39.38 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458920 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:52:53 Started mapping on | Dec 06 09:52:53 Finished on | Dec 06 09:54:49 Mapping speed, Million of reads per hour | 552.15 Number of input reads | 17791496 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16815837 Uniquely mapped reads % | 94.52% Average mapped length | 293.92 Number of splices: Total | 17310875 Number of splices: Annotated (sjdb) | 16326145 Number of splices: GT/AG | 17075634 Number of splices: GC/AG | 200085 Number of splices: AT/AC | 6986 Number of splices: Non-canonical | 28170 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236586 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 32665 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 739073 739073 739073 N_multimapping 236586 236586 236586 N_noFeature 488862 8484181 8528555 N_ambiguous 370676 41575 40692 UnstrandedReadsAssigned:15956299 PositiveStrandReadsAssigned:8290081 NegativeStrandReadsAssigned:8246590 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458920 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458920-trimmed-pair1.fastq SRR14458920-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,791,496 reads, 16,634,959 reads pseudoaligned [quant] estimated average fragment length: 246.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR14458920.ke.tsv 35125 SRR14458920.se.tsv 88098 total ==> SRR14458920.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.023 0 0 PNS24247 1044 798.561 22.0418 2.20754 PNS24249 1928 1682.56 143.352 6.81402 PNS24246 1044 798.561 22.0418 2.20754 PNS24248 1044 798.561 22.0418 2.20754 PNS24244 1471 1225.56 24.5223 1.60028 PNS24243 293 102.544 5 3.89969 KQK14069 1603 1357.56 3281.24 193.307 KQK14071 474 245.833 105.71 34.391 ==> SRR14458920.se.tsv <== BRADI_1g14170v3 3666 BRADI_1g53295v3 42 BRADI_1g59795v3 252 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 2510 BRADI_1g74790v3 575 BRADI_1g09890v3 10 BRADI_1g77505v3 364 BRADI_1g48960v3 0 SRR14458920 completed mapping pipeline successfully