Starting /dee2/code/volunteer_pipeline.sh SRR14458921 current disk space = 1552299470848 free memory = 1605395444 SRR14458921 SRAfilesize fdfced0af52417702e421f6bd1085fce SRR14458921.sra SRR14458921.sra file validated SRR14458921 is paired end SRR14458921 is conventional basespace SRR14458921 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458921_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.42425 32.0 32.0 32.0 32.0 32.0 2 31.4125 32.0 32.0 32.0 32.0 32.0 3 31.4725 32.0 32.0 32.0 32.0 32.0 4 31.676 32.0 32.0 32.0 32.0 32.0 5 31.61325 32.0 32.0 32.0 32.0 32.0 6 34.90125 36.0 36.0 36.0 36.0 36.0 7 35.06325 36.0 36.0 36.0 36.0 36.0 8 35.1085 36.0 36.0 36.0 36.0 36.0 9 35.0595 36.0 36.0 36.0 36.0 36.0 10-14 35.1269 36.0 36.0 36.0 36.0 36.0 15-19 35.12735 36.0 36.0 36.0 36.0 36.0 20-24 35.03875 36.0 36.0 36.0 36.0 36.0 25-29 34.959799999999994 36.0 36.0 36.0 34.4 36.0 30-34 34.87735 36.0 36.0 36.0 32.8 36.0 35-39 34.8142 36.0 36.0 36.0 32.0 36.0 40-44 34.77205 36.0 36.0 36.0 32.0 36.0 45-49 34.7582 36.0 36.0 36.0 32.0 36.0 50-54 34.69595 36.0 36.0 36.0 32.0 36.0 55-59 34.630900000000004 36.0 36.0 36.0 32.0 36.0 60-64 34.5081 36.0 36.0 36.0 32.0 36.0 65-69 34.58195 36.0 36.0 36.0 32.0 36.0 70-74 34.4832 36.0 36.0 36.0 32.0 36.0 75-79 34.295750000000005 36.0 36.0 36.0 32.0 36.0 80-84 34.226299999999995 36.0 36.0 36.0 32.0 36.0 85-89 34.13285 36.0 36.0 36.0 32.0 36.0 90-94 34.0373 36.0 36.0 36.0 32.0 36.0 95-99 33.94095 36.0 36.0 36.0 31.0 36.0 100-104 33.875099999999996 36.0 36.0 36.0 29.0 36.0 105-109 33.84655 36.0 36.0 36.0 28.0 36.0 110-114 33.68345000000001 36.0 36.0 36.0 27.0 36.0 115-119 33.6943 36.0 36.0 36.0 27.0 36.0 120-124 33.62385 36.0 36.0 36.0 27.0 36.0 125-129 33.55955 36.0 36.0 36.0 27.0 36.0 130-134 33.474000000000004 36.0 36.0 36.0 27.0 36.0 135-139 33.426050000000004 36.0 35.2 36.0 27.0 36.0 140-144 33.3736 36.0 34.4 36.0 27.0 36.0 145-149 33.1558 36.0 32.8 36.0 27.0 36.0 150-151 31.6015 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 5.0 22 5.0 23 5.0 24 11.0 25 21.0 26 30.0 27 52.0 28 66.0 29 87.0 30 98.0 31 158.0 32 208.0 33 381.0 34 788.0 35 2083.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.900000000000002 11.75 11.575000000000001 53.77499999999999 2 23.35 17.45 36.4 22.8 3 23.200000000000003 21.925 24.575 30.3 4 26.325 28.275 16.650000000000002 28.749999999999996 5 28.499999999999996 29.75 19.2 22.55 6 23.15973960941412 32.8242363545318 20.681021532298445 23.335002503755632 7 21.85 15.85 38.45 23.849999999999998 8 22.15 19.075 25.5 33.275 9 22.325 19.2 29.175 29.299999999999997 10-14 24.325 25.095 23.035 27.544999999999998 15-19 25.21 23.494999999999997 23.385 27.91 20-24 26.150000000000002 23.445 23.22 27.185 25-29 25.705 23.27 23.345 27.68 30-34 25.419999999999998 24.12 23.169999999999998 27.29 35-39 25.495 24.355 22.78 27.37 40-44 25.955000000000002 23.724999999999998 23.085 27.235 45-49 25.974999999999998 23.474999999999998 23.44 27.11 50-54 26.340000000000003 23.28 23.865 26.515 55-59 25.759999999999998 23.674999999999997 22.97 27.595 60-64 26.02 23.355 22.645 27.98 65-69 26.43 23.82 23.04 26.71 70-74 26.290000000000003 23.555 23.465 26.69 75-79 25.655 23.945 23.395 27.005000000000003 80-84 26.400000000000002 23.205000000000002 23.375 27.02 85-89 26.455000000000002 23.54 22.96 27.045 90-94 26.240000000000002 23.145 23.52 27.095000000000002 95-99 26.375 23.325000000000003 23.580000000000002 26.72 100-104 27.115000000000002 23.46 22.720000000000002 26.705000000000002 105-109 27.089999999999996 23.244999999999997 22.765 26.900000000000002 110-114 26.845000000000002 23.235 23.305 26.615 115-119 27.16 23.91 22.835 26.095000000000002 120-124 26.919999999999998 24.025 22.564999999999998 26.490000000000002 125-129 27.229999999999997 23.485 22.975 26.31 130-134 27.474999999999998 23.935000000000002 22.009999999999998 26.58 135-139 27.11 23.7 22.869999999999997 26.32 140-144 27.35 23.415 22.770000000000003 26.465 145-149 26.77 24.485 22.07 26.674999999999997 150-151 26.474999999999998 24.0125 23.200000000000003 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 4.5 30 5.5 31 5.5 32 8.0 33 14.0 34 21.0 35 27.5 36 38.0 37 51.5 38 66.0 39 75.5 40 90.5 41 103.5 42 128.0 43 144.5 44 133.5 45 139.5 46 152.0 47 147.5 48 141.0 49 134.5 50 126.0 51 127.5 52 117.0 53 109.0 54 101.5 55 99.0 56 107.0 57 116.5 58 123.0 59 113.0 60 98.5 61 96.0 62 101.5 63 93.0 64 90.0 65 84.0 66 73.5 67 78.5 68 81.0 69 64.5 70 57.0 71 59.0 72 52.5 73 48.0 74 38.5 75 29.0 76 23.0 77 17.5 78 14.0 79 9.0 80 6.0 81 5.0 82 3.5 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.579199194157643 1.15 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.225 0.0 0.0 0.0 0.0 132-133 6.987500000000001 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.8125 0.0 0.0 0.0 0.0 138-139 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458921 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458921_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3925 32.0 32.0 32.0 32.0 32.0 2 31.12575 32.0 32.0 32.0 32.0 32.0 3 31.0895 32.0 32.0 32.0 32.0 32.0 4 31.18375 32.0 32.0 32.0 32.0 32.0 5 31.17025 32.0 32.0 32.0 32.0 32.0 6 34.735 36.0 36.0 36.0 32.0 36.0 7 34.74175 36.0 36.0 36.0 32.0 36.0 8 34.7035 36.0 36.0 36.0 32.0 36.0 9 34.77675 36.0 36.0 36.0 32.0 36.0 10-14 34.6919 36.0 36.0 36.0 32.0 36.0 15-19 34.68235 36.0 36.0 36.0 32.0 36.0 20-24 34.626250000000006 36.0 36.0 36.0 32.0 36.0 25-29 34.629149999999996 36.0 36.0 36.0 32.0 36.0 30-34 34.480999999999995 36.0 36.0 36.0 32.0 36.0 35-39 34.49135 36.0 36.0 36.0 32.0 36.0 40-44 34.4711 36.0 36.0 36.0 32.0 36.0 45-49 34.426 36.0 36.0 36.0 32.0 36.0 50-54 34.412400000000005 36.0 36.0 36.0 32.0 36.0 55-59 34.23105 36.0 36.0 36.0 32.0 36.0 60-64 34.23395000000001 36.0 36.0 36.0 32.0 36.0 65-69 34.1804 36.0 36.0 36.0 32.0 36.0 70-74 34.11825 36.0 36.0 36.0 32.0 36.0 75-79 34.02765 36.0 36.0 36.0 32.0 36.0 80-84 33.8308 36.0 36.0 36.0 31.0 36.0 85-89 33.642450000000004 36.0 36.0 36.0 28.0 36.0 90-94 33.61315 36.0 36.0 36.0 27.0 36.0 95-99 33.5108 36.0 36.0 36.0 27.0 36.0 100-104 33.5306 36.0 36.0 36.0 27.0 36.0 105-109 33.4749 36.0 36.0 36.0 27.0 36.0 110-114 33.35895 36.0 36.0 36.0 27.0 36.0 115-119 33.3206 36.0 33.6 36.0 27.0 36.0 120-124 33.267649999999996 36.0 34.4 36.0 27.0 36.0 125-129 33.15265000000001 36.0 33.6 36.0 27.0 36.0 130-134 33.192400000000006 36.0 34.4 36.0 27.0 36.0 135-139 32.866299999999995 36.0 32.0 36.0 24.4 36.0 140-144 32.716049999999996 36.0 32.0 36.0 19.6 36.0 145-149 32.3648 36.0 32.0 36.0 19.6 36.0 150-151 30.040625 34.0 29.5 36.0 17.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 3.0 17 4.0 18 3.0 19 4.0 20 6.0 21 7.0 22 11.0 23 13.0 24 16.0 25 32.0 26 47.0 27 61.0 28 78.0 29 95.0 30 127.0 31 194.0 32 238.0 33 392.0 34 841.0 35 1825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.18609304652326 12.231115557778889 11.830915457728866 53.75187593796898 2 24.099999999999998 17.75 35.025 23.125 3 23.425 22.55 23.5 30.525000000000002 4 28.175 26.950000000000003 16.8 28.075 5 30.325000000000003 29.475 19.025 21.175 6 23.05 33.125 20.05 23.775 7 21.3 15.475 36.95 26.275 8 21.2 19.325 26.775 32.7 9 22.8 20.05 27.750000000000004 29.4 10-14 25.345000000000002 24.095 22.939999999999998 27.62 15-19 25.385 24.03 22.925 27.66 20-24 25.624999999999996 23.555 23.76 27.060000000000002 25-29 25.775 22.605 23.674999999999997 27.944999999999997 30-34 25.424999999999997 23.794999999999998 23.3 27.48 35-39 25.72 23.455000000000002 23.645 27.18 40-44 25.679999999999996 23.985 22.955000000000002 27.38 45-49 25.865 23.7 23.09 27.345000000000002 50-54 25.825 23.565 23.330000000000002 27.279999999999998 55-59 26.784999999999997 23.669999999999998 22.975 26.57 60-64 26.369999999999997 23.52 22.78 27.33 65-69 26.625 23.645 23.035 26.695 70-74 26.505000000000003 23.35 23.46 26.685 75-79 25.69 23.995 22.67 27.644999999999996 80-84 26.775 23.494999999999997 23.64 26.090000000000003 85-89 26.825 23.04 22.884999999999998 27.250000000000004 90-94 26.810000000000002 23.630000000000003 22.720000000000002 26.840000000000003 95-99 26.740000000000002 24.305 22.64 26.314999999999998 100-104 27.24 23.835 22.735 26.19 105-109 26.790000000000003 23.185 23.525 26.5 110-114 27.3 23.150000000000002 23.18 26.369999999999997 115-119 28.025 23.41 22.065 26.5 120-124 27.625 23.21 22.555 26.61 125-129 27.650000000000002 23.705000000000002 22.895 25.75 130-134 27.900000000000002 24.0 22.35 25.75 135-139 28.015 24.44 21.975 25.569999999999997 140-144 28.134999999999998 24.735 21.845 25.285000000000004 145-149 29.435 23.82 21.834999999999997 24.91 150-151 29.812499999999996 23.849999999999998 21.275 25.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 3.0 27 2.0 28 1.5 29 1.5 30 4.5 31 8.0 32 9.5 33 11.0 34 17.5 35 23.5 36 26.5 37 43.5 38 59.5 39 73.5 40 90.0 41 105.0 42 132.5 43 146.0 44 143.5 45 143.5 46 147.0 47 155.5 48 149.5 49 138.0 50 131.0 51 123.5 52 111.5 53 103.5 54 105.5 55 109.5 56 104.0 57 106.0 58 111.0 59 112.5 60 108.5 61 96.0 62 99.5 63 102.0 64 86.5 65 72.0 66 71.0 67 77.5 68 76.0 69 68.5 70 65.5 71 53.0 72 54.0 73 49.5 74 38.5 75 33.5 76 23.5 77 19.0 78 15.0 79 14.0 80 9.5 81 3.5 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.4875 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.55 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTC 10 0.006830828 145.0 2 CTTCACT 10 0.006830828 145.0 1 GTACAAC 10 0.006830828 145.0 145 CTGGCTT 10 0.006830828 145.0 1 >>END_MODULE Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra Read 974734 spots for SRR14458921.sra Written 974734 spots for SRR14458921.sra Read 974717 spots for SRR14458921.sra Written 974717 spots for SRR14458921.sra SRR ids: ['SRR14458921.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ix7ueih_ SRR14458921.sra spots: 19494357 blocks: [[1, 974717], [974718, 1949434], [1949435, 2924151], [2924152, 3898868], [3898869, 4873585], [4873586, 5848302], [5848303, 6823019], [6823020, 7797736], [7797737, 8772453], [8772454, 9747170], [9747171, 10721887], [10721888, 11696604], [11696605, 12671321], [12671322, 13646038], [13646039, 14620755], [14620756, 15595472], [15595473, 16570189], [16570190, 17544906], [17544907, 18519623], [18519624, 19494357]] SRR14458921 file size 6603335 SRR14458921 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458921 SRR14458921_1.fastq SRR14458921_2.fastq Input file: SRR14458921_1.fastq Paired file: SRR14458921_2.fastq trimmed: SRR14458921-trimmed-pair1.fastq, SRR14458921-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:54:09 2024 >> started Fri Dec 6 09:55:10 2024 >> done (61.039s) 19494357 read pairs processed; of these: 4597 ( 0.02%) short read pairs filtered out after trimming by size control 1654 ( 0.01%) empty read pairs filtered out after trimming by size control 19488106 (99.97%) read pairs available; of these: 3225043 (16.55%) trimmed read pairs available after processing 16263063 (83.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 205 0.00% 19 200 0.00% 20 189 0.00% 21 201 0.00% 22 198 0.00% 23 164 0.00% 24 193 0.00% 25 175 0.00% 26 155 0.00% 27 165 0.00% 28 139 0.00% 29 164 0.00% 30 164 0.00% 31 125 0.00% 32 168 0.00% 33 155 0.00% 34 411 0.00% 35 143 0.00% 36 182 0.00% 37 141 0.00% 38 170 0.00% 39 148 0.00% 40 165 0.00% 41 148 0.00% 42 130 0.00% 43 163 0.00% 44 139 0.00% 45 121 0.00% 46 149 0.00% 47 187 0.00% 48 181 0.00% 49 200 0.00% 50 200 0.00% 51 206 0.00% 52 197 0.00% 53 199 0.00% 54 176 0.00% 55 195 0.00% 56 201 0.00% 57 214 0.00% 58 252 0.00% 59 281 0.00% 60 282 0.00% 61 317 0.00% 62 328 0.00% 63 313 0.00% 64 297 0.00% 65 350 0.00% 66 339 0.00% 67 402 0.00% 68 441 0.00% 69 492 0.00% 70 559 0.00% 71 610 0.00% 72 618 0.00% 73 640 0.00% 74 709 0.00% 75 708 0.00% 76 795 0.00% 77 831 0.00% 78 980 0.01% 79 1143 0.01% 80 1223 0.01% 81 1454 0.01% 82 1709 0.01% 83 1884 0.01% 84 2035 0.01% 85 2147 0.01% 86 2397 0.01% 87 2559 0.01% 88 2801 0.01% 89 3277 0.02% 90 3707 0.02% 91 4306 0.02% 92 5106 0.03% 93 5625 0.03% 94 6292 0.03% 95 6781 0.03% 96 7418 0.04% 97 7772 0.04% 98 8566 0.04% 99 9825 0.05% 100 11031 0.06% 101 12285 0.06% 102 13968 0.07% 103 15382 0.08% 104 17150 0.09% 105 18392 0.09% 106 19699 0.10% 107 20896 0.11% 108 22423 0.12% 109 24569 0.13% 110 26231 0.13% 111 28822 0.15% 112 31746 0.16% 113 34473 0.18% 114 37198 0.19% 115 40287 0.21% 116 41534 0.21% 117 42694 0.22% 118 44703 0.23% 119 47271 0.24% 120 49717 0.26% 121 52610 0.27% 122 56224 0.29% 123 58911 0.30% 124 62971 0.32% 125 65694 0.34% 126 67256 0.35% 127 68753 0.35% 128 69998 0.36% 129 71370 0.37% 130 73560 0.38% 131 76792 0.39% 132 79622 0.41% 133 83267 0.43% 134 86288 0.44% 135 87720 0.45% 136 89484 0.46% 137 90001 0.46% 138 90584 0.46% 139 91411 0.47% 140 92192 0.47% 141 93372 0.48% 142 96630 0.50% 143 98474 0.51% 144 99285 0.51% 145 101854 0.52% 146 102077 0.52% 147 102336 0.53% 148 104166 0.53% 149 102613 0.53% 150 103360 0.53% 151 16263063 83.45% 19488106 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=8 prefix-density=0.58 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=37.32 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=6 prefix-density=0.58 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=32.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458921 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:56:40 Started mapping on | Dec 06 09:56:40 Finished on | Dec 06 09:59:10 Mapping speed, Million of reads per hour | 467.71 Number of input reads | 19488106 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18357134 Uniquely mapped reads % | 94.20% Average mapped length | 293.16 Number of splices: Total | 18648346 Number of splices: Annotated (sjdb) | 17610520 Number of splices: GT/AG | 18393894 Number of splices: GC/AG | 215435 Number of splices: AT/AC | 7286 Number of splices: Non-canonical | 31731 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279833 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 41889 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 1.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 851139 851139 851139 N_multimapping 279833 279833 279833 N_noFeature 534270 9251595 9309989 N_ambiguous 409186 41437 41798 UnstrandedReadsAssigned:17413678 PositiveStrandReadsAssigned:9064102 NegativeStrandReadsAssigned:9005347 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458921 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458921-trimmed-pair1.fastq SRR14458921-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,488,106 reads, 18,194,332 reads pseudoaligned [quant] estimated average fragment length: 240.457 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR14458921.ke.tsv 35125 SRR14458921.se.tsv 88098 total ==> SRR14458921.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.845 0 0 PNS24247 1044 804.543 19.9353 1.77984 PNS24249 1928 1688.54 139.034 5.9145 PNS24246 1044 804.543 19.9353 1.77984 PNS24248 1044 804.543 19.9353 1.77984 PNS24244 1471 1231.54 44.1596 2.57563 PNS24243 293 104.518 5 3.43628 KQK14069 1603 1363.54 4440.35 233.914 KQK14071 474 249.847 256.005 73.6007 ==> SRR14458921.se.tsv <== BRADI_1g14170v3 5660 BRADI_1g53295v3 47 BRADI_1g59795v3 285 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 2799 BRADI_1g74790v3 624 BRADI_1g09890v3 7 BRADI_1g77505v3 381 BRADI_1g48960v3 1 SRR14458921 completed mapping pipeline successfully