Starting /dee2/code/volunteer_pipeline.sh SRR14458922 current disk space = 1552299470848 free memory = 1605390900 SRR14458922 SRAfilesize bd8d7d442fe5b54c935573c76726530e SRR14458922.sra SRR14458922.sra file validated SRR14458922 is paired end SRR14458922 is conventional basespace SRR14458922 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458922_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.16375 32.0 32.0 32.0 32.0 32.0 2 31.2085 32.0 32.0 32.0 32.0 32.0 3 31.45125 32.0 32.0 32.0 32.0 32.0 4 31.52425 32.0 32.0 32.0 32.0 32.0 5 31.50775 32.0 32.0 32.0 32.0 32.0 6 34.6815 36.0 36.0 36.0 32.0 36.0 7 35.0155 36.0 36.0 36.0 36.0 36.0 8 34.929 36.0 36.0 36.0 32.0 36.0 9 34.964 36.0 36.0 36.0 36.0 36.0 10-14 34.9207 36.0 36.0 36.0 32.8 36.0 15-19 34.92209999999999 36.0 36.0 36.0 33.6 36.0 20-24 34.857549999999996 36.0 36.0 36.0 32.0 36.0 25-29 34.77895 36.0 36.0 36.0 32.0 36.0 30-34 34.76475 36.0 36.0 36.0 32.0 36.0 35-39 34.65794999999999 36.0 36.0 36.0 32.0 36.0 40-44 34.61705 36.0 36.0 36.0 32.0 36.0 45-49 34.6016 36.0 36.0 36.0 32.0 36.0 50-54 34.51695 36.0 36.0 36.0 32.0 36.0 55-59 34.43495 36.0 36.0 36.0 32.0 36.0 60-64 34.33964999999999 36.0 36.0 36.0 32.0 36.0 65-69 34.3497 36.0 36.0 36.0 32.0 36.0 70-74 34.22245 36.0 36.0 36.0 32.0 36.0 75-79 34.0578 36.0 36.0 36.0 32.0 36.0 80-84 33.956399999999995 36.0 36.0 36.0 31.0 36.0 85-89 33.868849999999995 36.0 36.0 36.0 31.0 36.0 90-94 33.83964999999999 36.0 36.0 36.0 30.0 36.0 95-99 33.69535 36.0 36.0 36.0 28.0 36.0 100-104 33.616949999999996 36.0 36.0 36.0 27.0 36.0 105-109 33.69355 36.0 36.0 36.0 27.0 36.0 110-114 33.49895 36.0 36.0 36.0 27.0 36.0 115-119 33.47019999999999 36.0 36.0 36.0 27.0 36.0 120-124 33.33865 36.0 35.2 36.0 27.0 36.0 125-129 33.227 36.0 32.0 36.0 27.0 36.0 130-134 33.215599999999995 36.0 32.8 36.0 27.0 36.0 135-139 33.1832 36.0 32.8 36.0 27.0 36.0 140-144 33.08800000000001 36.0 32.8 36.0 27.0 36.0 145-149 32.85385 36.0 32.0 36.0 25.8 36.0 150-151 31.25725 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 9.0 23 7.0 24 13.0 25 20.0 26 36.0 27 52.0 28 72.0 29 100.0 30 144.0 31 185.0 32 253.0 33 410.0 34 861.0 35 1834.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.275 11.924999999999999 12.8 51.0 2 22.775000000000002 18.025 36.125 23.075000000000003 3 23.0 23.599999999999998 24.025 29.375 4 27.175 28.249999999999996 16.475 28.1 5 27.650000000000002 30.45 19.75 22.15 6 23.959899749373434 33.7593984962406 18.671679197994987 23.609022556390975 7 22.875 15.950000000000001 37.15 24.025 8 21.4 20.7 26.35 31.55 9 22.900000000000002 18.425 27.575 31.1 10-14 24.94 24.23 23.32 27.51 15-19 25.905 23.075000000000003 23.200000000000003 27.82 20-24 26.27 23.225 23.31 27.195000000000004 25-29 26.325 23.36 23.145 27.169999999999998 30-34 25.72 23.765 23.18 27.334999999999997 35-39 26.06 23.435 23.275000000000002 27.229999999999997 40-44 26.040000000000003 23.78 23.09 27.089999999999996 45-49 26.265 22.655 23.64 27.439999999999998 50-54 26.25 23.5 23.674999999999997 26.575 55-59 26.125 23.11 23.605 27.16 60-64 26.125 23.395 23.474999999999998 27.005000000000003 65-69 26.5 23.335 22.6 27.565 70-74 25.96 23.18 23.53 27.33 75-79 26.47 23.419999999999998 22.8 27.310000000000002 80-84 26.889999999999997 23.685000000000002 23.035 26.39 85-89 26.395000000000003 22.994999999999997 23.285 27.325 90-94 26.775 23.72 22.770000000000003 26.735 95-99 26.724999999999998 23.315 22.869999999999997 27.089999999999996 100-104 26.68 22.564999999999998 23.345 27.41 105-109 26.995 23.53 22.855 26.619999999999997 110-114 27.08 22.95 23.150000000000002 26.82 115-119 26.945000000000004 24.104999999999997 22.384999999999998 26.565 120-124 27.229999999999997 23.04 22.41 27.32 125-129 27.255000000000003 23.925 22.495 26.325 130-134 27.41 24.279999999999998 22.195 26.115 135-139 27.615000000000002 24.215 22.3 25.869999999999997 140-144 28.12 24.21 22.08 25.590000000000003 145-149 27.1 24.265 21.93 26.705000000000002 150-151 27.0625 24.0375 22.375 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 3.0 29 3.5 30 2.5 31 3.0 32 5.5 33 8.0 34 15.0 35 26.5 36 32.0 37 44.5 38 58.5 39 71.0 40 85.5 41 105.5 42 115.5 43 129.5 44 144.5 45 147.0 46 145.5 47 149.5 48 151.5 49 146.0 50 151.5 51 141.5 52 126.0 53 113.5 54 108.5 55 104.5 56 106.0 57 107.5 58 107.5 59 110.5 60 101.0 61 88.5 62 77.5 63 78.5 64 94.0 65 90.5 66 77.0 67 74.0 68 82.0 69 76.0 70 60.0 71 62.0 72 62.5 73 54.0 74 42.0 75 29.0 76 21.0 77 20.0 78 14.0 79 8.5 80 4.5 81 3.0 82 3.5 83 1.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 8.087499999999999 0.0 0.0 0.0 0.0 136-137 8.7375 0.0 0.0 0.0 0.0 138-139 9.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458922 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458922_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3835 32.0 32.0 32.0 32.0 32.0 2 31.1555 32.0 32.0 32.0 32.0 32.0 3 31.1395 32.0 32.0 32.0 32.0 32.0 4 31.11625 32.0 32.0 32.0 32.0 32.0 5 31.18425 32.0 32.0 32.0 32.0 32.0 6 34.65075 36.0 36.0 36.0 32.0 36.0 7 34.72975 36.0 36.0 36.0 32.0 36.0 8 34.60475 36.0 36.0 36.0 32.0 36.0 9 34.76175 36.0 36.0 36.0 32.0 36.0 10-14 34.63705 36.0 36.0 36.0 32.0 36.0 15-19 34.62325 36.0 36.0 36.0 32.0 36.0 20-24 34.56355 36.0 36.0 36.0 32.0 36.0 25-29 34.5807 36.0 36.0 36.0 32.0 36.0 30-34 34.46815 36.0 36.0 36.0 32.0 36.0 35-39 34.457950000000004 36.0 36.0 36.0 32.0 36.0 40-44 34.40385 36.0 36.0 36.0 32.0 36.0 45-49 34.3661 36.0 36.0 36.0 32.0 36.0 50-54 34.31015 36.0 36.0 36.0 32.0 36.0 55-59 34.21505 36.0 36.0 36.0 32.0 36.0 60-64 34.19755000000001 36.0 36.0 36.0 32.0 36.0 65-69 34.0784 36.0 36.0 36.0 31.0 36.0 70-74 34.020500000000006 36.0 36.0 36.0 31.0 36.0 75-79 33.92875 36.0 36.0 36.0 31.0 36.0 80-84 33.8033 36.0 36.0 36.0 29.0 36.0 85-89 33.5269 36.0 36.0 36.0 27.0 36.0 90-94 33.530800000000006 36.0 36.0 36.0 27.0 36.0 95-99 33.467650000000006 36.0 36.0 36.0 27.0 36.0 100-104 33.4537 36.0 36.0 36.0 27.0 36.0 105-109 33.3737 36.0 36.0 36.0 27.0 36.0 110-114 33.2452 36.0 34.4 36.0 27.0 36.0 115-119 33.16505 36.0 32.0 36.0 27.0 36.0 120-124 33.11865 36.0 32.0 36.0 25.8 36.0 125-129 32.98629999999999 36.0 32.0 36.0 25.8 36.0 130-134 32.9625 36.0 32.0 36.0 25.8 36.0 135-139 32.62055 36.0 32.0 36.0 20.8 36.0 140-144 32.6471 36.0 32.0 36.0 19.6 36.0 145-149 32.18005 36.0 32.0 36.0 16.8 36.0 150-151 29.8065 34.0 29.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 3.0 18 3.0 19 3.0 20 4.0 21 5.0 22 12.0 23 13.0 24 25.0 25 28.0 26 37.0 27 53.0 28 85.0 29 105.0 30 151.0 31 195.0 32 301.0 33 446.0 34 921.0 35 1608.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.200000000000003 11.5 12.85 52.449999999999996 2 25.55 17.325 35.4 21.725 3 25.775 21.099999999999998 22.95 30.175 4 27.825 26.474999999999998 17.025000000000002 28.675 5 28.975 29.725 19.775000000000002 21.525 6 22.6 32.025 20.150000000000002 25.224999999999998 7 22.575 15.775 36.55 25.1 8 21.6 20.75 25.974999999999998 31.674999999999997 9 22.425 18.8 29.2 29.575000000000003 10-14 25.424999999999997 24.42 23.095 27.060000000000002 15-19 25.480000000000004 23.075000000000003 23.380000000000003 28.065 20-24 25.72 24.044999999999998 22.939999999999998 27.295 25-29 25.53 23.745 22.919999999999998 27.805000000000003 30-34 25.765 23.66 23.635 26.939999999999998 35-39 26.200000000000003 23.455000000000002 23.189999999999998 27.155 40-44 25.740000000000002 23.815 23.715 26.729999999999997 45-49 25.585 23.425 23.43 27.560000000000002 50-54 26.14 23.599999999999998 23.400000000000002 26.86 55-59 26.33 23.825 22.795 27.05 60-64 25.919999999999998 22.795 23.535 27.750000000000004 65-69 26.165 23.835 22.939999999999998 27.060000000000002 70-74 26.13 23.5 23.095 27.275 75-79 26.36 23.064999999999998 23.255 27.32 80-84 26.105 23.68 23.385 26.83 85-89 26.795 23.25 22.915 27.04 90-94 26.650000000000002 23.73 23.064999999999998 26.555 95-99 26.605 23.465 23.189999999999998 26.740000000000002 100-104 27.04 23.455000000000002 23.275000000000002 26.229999999999997 105-109 26.905 23.345 22.615 27.134999999999998 110-114 27.36 23.435 22.89 26.314999999999998 115-119 27.21 23.755000000000003 22.68 26.355 120-124 27.175 23.45 22.86 26.515 125-129 27.52 24.07 22.495 25.915 130-134 27.884999999999998 23.875 22.36 25.88 135-139 28.050000000000004 23.69 22.57 25.69 140-144 28.68 24.495 21.85 24.975 145-149 29.07 24.195 22.03 24.705 150-151 29.562500000000004 24.0625 22.037499999999998 24.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 2.5 29 1.5 30 2.0 31 5.0 32 7.0 33 10.0 34 17.5 35 24.5 36 27.0 37 37.0 38 58.0 39 79.5 40 98.0 41 101.0 42 118.0 43 146.0 44 144.5 45 138.0 46 146.5 47 160.0 48 153.0 49 142.5 50 137.5 51 119.5 52 116.5 53 120.0 54 108.5 55 98.5 56 97.5 57 102.0 58 116.0 59 121.5 60 106.0 61 103.5 62 110.5 63 97.0 64 80.0 65 75.5 66 78.0 67 76.5 68 71.5 69 68.5 70 70.5 71 66.5 72 54.0 73 46.5 74 37.0 75 26.5 76 20.5 77 18.0 78 12.0 79 6.5 80 4.0 81 3.0 82 2.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.5797832114948324 1.15 3 0.12603982858583312 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7999999999999998 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.512499999999999 0.0 0.0 0.0 0.0 126-127 5.262499999999999 0.0 0.0 0.0 0.0 128-129 6.0 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.3375 0.0 0.0 0.0 0.0 134-135 8.162500000000001 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTTGC 10 0.006830828 145.0 3 >>END_MODULE Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906361 spots for SRR14458922.sra Written 906361 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra Read 906344 spots for SRR14458922.sra Written 906344 spots for SRR14458922.sra SRR ids: ['SRR14458922.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_90fmbqrj SRR14458922.sra spots: 18126897 blocks: [[1, 906344], [906345, 1812688], [1812689, 2719032], [2719033, 3625376], [3625377, 4531720], [4531721, 5438064], [5438065, 6344408], [6344409, 7250752], [7250753, 8157096], [8157097, 9063440], [9063441, 9969784], [9969785, 10876128], [10876129, 11782472], [11782473, 12688816], [12688817, 13595160], [13595161, 14501504], [14501505, 15407848], [15407849, 16314192], [16314193, 17220536], [17220537, 18126897]] SRR14458922 file size 6138612 SRR14458922 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458922 SRR14458922_1.fastq SRR14458922_2.fastq Input file: SRR14458922_1.fastq Paired file: SRR14458922_2.fastq trimmed: SRR14458922-trimmed-pair1.fastq, SRR14458922-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:06:46 2024 >> started Fri Dec 6 10:07:08 2024 >> done (21.597s) 18126897 read pairs processed; of these: 4447 ( 0.02%) short read pairs filtered out after trimming by size control 1401 ( 0.01%) empty read pairs filtered out after trimming by size control 18121049 (99.97%) read pairs available; of these: 3180268 (17.55%) trimmed read pairs available after processing 14940781 (82.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 195 0.00% 19 207 0.00% 20 203 0.00% 21 163 0.00% 22 194 0.00% 23 197 0.00% 24 202 0.00% 25 172 0.00% 26 199 0.00% 27 169 0.00% 28 150 0.00% 29 145 0.00% 30 143 0.00% 31 128 0.00% 32 179 0.00% 33 166 0.00% 34 366 0.00% 35 147 0.00% 36 148 0.00% 37 140 0.00% 38 159 0.00% 39 147 0.00% 40 133 0.00% 41 157 0.00% 42 146 0.00% 43 165 0.00% 44 156 0.00% 45 138 0.00% 46 166 0.00% 47 166 0.00% 48 188 0.00% 49 227 0.00% 50 178 0.00% 51 171 0.00% 52 196 0.00% 53 192 0.00% 54 207 0.00% 55 229 0.00% 56 192 0.00% 57 249 0.00% 58 305 0.00% 59 307 0.00% 60 329 0.00% 61 307 0.00% 62 321 0.00% 63 317 0.00% 64 318 0.00% 65 349 0.00% 66 339 0.00% 67 406 0.00% 68 442 0.00% 69 564 0.00% 70 545 0.00% 71 646 0.00% 72 645 0.00% 73 692 0.00% 74 712 0.00% 75 789 0.00% 76 788 0.00% 77 912 0.01% 78 1002 0.01% 79 1152 0.01% 80 1445 0.01% 81 1555 0.01% 82 1824 0.01% 83 1999 0.01% 84 2303 0.01% 85 2450 0.01% 86 2653 0.01% 87 2833 0.02% 88 3195 0.02% 89 3680 0.02% 90 4082 0.02% 91 4833 0.03% 92 5585 0.03% 93 6362 0.04% 94 7108 0.04% 95 7566 0.04% 96 8227 0.05% 97 8997 0.05% 98 9852 0.05% 99 10892 0.06% 100 12212 0.07% 101 13686 0.08% 102 15466 0.09% 103 17222 0.10% 104 18656 0.10% 105 19850 0.11% 106 21077 0.12% 107 22552 0.12% 108 24135 0.13% 109 25700 0.14% 110 27906 0.15% 111 30565 0.17% 112 33098 0.18% 113 36221 0.20% 114 38385 0.21% 115 40964 0.23% 116 42538 0.23% 117 43974 0.24% 118 45331 0.25% 119 47774 0.26% 120 49451 0.27% 121 52637 0.29% 122 56148 0.31% 123 58889 0.32% 124 62540 0.35% 125 64740 0.36% 126 66061 0.36% 127 67410 0.37% 128 69215 0.38% 129 70031 0.39% 130 71029 0.39% 131 74647 0.41% 132 77387 0.43% 133 79416 0.44% 134 83048 0.46% 135 84775 0.47% 136 86558 0.48% 137 87141 0.48% 138 87387 0.48% 139 88546 0.49% 140 88797 0.49% 141 89907 0.50% 142 92305 0.51% 143 94556 0.52% 144 95169 0.53% 145 96430 0.53% 146 97241 0.54% 147 98275 0.54% 148 100076 0.55% 149 97803 0.54% 150 98538 0.54% 151 14940781 82.45% 18121049 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=7 prefix-density=0.58 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=28.66 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=8 prefix-density=0.57 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=26.08 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458922 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:07:53 Started mapping on | Dec 06 10:07:53 Finished on | Dec 06 10:10:09 Mapping speed, Million of reads per hour | 479.67 Number of input reads | 18121049 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17054099 Uniquely mapped reads % | 94.11% Average mapped length | 292.49 Number of splices: Total | 17242209 Number of splices: Annotated (sjdb) | 16285319 Number of splices: GT/AG | 17008732 Number of splices: GC/AG | 197578 Number of splices: AT/AC | 7021 Number of splices: Non-canonical | 28878 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254746 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 38847 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 1.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 812204 812204 812204 N_multimapping 254746 254746 254746 N_noFeature 519706 8592360 8677286 N_ambiguous 369113 34323 34526 UnstrandedReadsAssigned:16165280 PositiveStrandReadsAssigned:8427416 NegativeStrandReadsAssigned:8342287 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458922 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458922-trimmed-pair1.fastq SRR14458922-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,121,049 reads, 16,914,781 reads pseudoaligned [quant] estimated average fragment length: 230.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR14458922.ke.tsv 35125 SRR14458922.se.tsv 88098 total ==> SRR14458922.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.822 0 0 PNS24247 1044 814.428 15.1431 1.4788 PNS24249 1928 1698.43 126.465 5.922 PNS24246 1044 814.428 15.1431 1.4788 PNS24248 1044 814.428 15.1431 1.4788 PNS24244 1471 1241.43 34.106 2.18502 PNS24243 293 105.508 2 1.50762 KQK14069 1603 1373.43 5833.08 337.783 KQK14071 474 254.406 327.308 102.324 ==> SRR14458922.se.tsv <== BRADI_1g14170v3 7111 BRADI_1g53295v3 33 BRADI_1g59795v3 236 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2471 BRADI_1g74790v3 581 BRADI_1g09890v3 13 BRADI_1g77505v3 326 BRADI_1g48960v3 0 SRR14458922 completed mapping pipeline successfully