Starting /dee2/code/volunteer_pipeline.sh SRR14458923 current disk space = 1552299470848 free memory = 1605395340 SRR14458923 SRAfilesize fb321c79f2611c5a49dae1c0a11e5ed7 SRR14458923.sra SRR14458923.sra file validated SRR14458923 is paired end SRR14458923 is conventional basespace SRR14458923 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458923_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36275 32.0 32.0 32.0 32.0 32.0 2 31.487 32.0 32.0 32.0 32.0 32.0 3 31.5825 32.0 32.0 32.0 32.0 32.0 4 31.5755 32.0 32.0 32.0 32.0 32.0 5 31.59025 32.0 32.0 32.0 32.0 32.0 6 34.915 36.0 36.0 36.0 36.0 36.0 7 35.22425 36.0 36.0 36.0 36.0 36.0 8 35.09525 36.0 36.0 36.0 36.0 36.0 9 35.249 36.0 36.0 36.0 36.0 36.0 10-14 35.19415 36.0 36.0 36.0 36.0 36.0 15-19 35.1451 36.0 36.0 36.0 36.0 36.0 20-24 35.168899999999994 36.0 36.0 36.0 36.0 36.0 25-29 35.016450000000006 36.0 36.0 36.0 36.0 36.0 30-34 34.985299999999995 36.0 36.0 36.0 34.4 36.0 35-39 34.879900000000006 36.0 36.0 36.0 33.6 36.0 40-44 34.8308 36.0 36.0 36.0 32.0 36.0 45-49 34.8692 36.0 36.0 36.0 33.6 36.0 50-54 34.8137 36.0 36.0 36.0 32.8 36.0 55-59 34.6968 36.0 36.0 36.0 32.0 36.0 60-64 34.6102 36.0 36.0 36.0 32.0 36.0 65-69 34.62565 36.0 36.0 36.0 32.0 36.0 70-74 34.505250000000004 36.0 36.0 36.0 32.0 36.0 75-79 34.3852 36.0 36.0 36.0 32.0 36.0 80-84 34.33385 36.0 36.0 36.0 32.0 36.0 85-89 34.249900000000004 36.0 36.0 36.0 32.0 36.0 90-94 34.194900000000004 36.0 36.0 36.0 32.0 36.0 95-99 34.0489 36.0 36.0 36.0 32.0 36.0 100-104 33.977050000000006 36.0 36.0 36.0 31.0 36.0 105-109 33.992450000000005 36.0 36.0 36.0 32.0 36.0 110-114 33.8894 36.0 36.0 36.0 29.0 36.0 115-119 33.7965 36.0 36.0 36.0 27.0 36.0 120-124 33.713 36.0 36.0 36.0 27.0 36.0 125-129 33.6016 36.0 36.0 36.0 27.0 36.0 130-134 33.59615 36.0 36.0 36.0 27.0 36.0 135-139 33.55625 36.0 35.2 36.0 27.0 36.0 140-144 33.540299999999995 36.0 35.2 36.0 27.0 36.0 145-149 33.3612 36.0 32.8 36.0 27.0 36.0 150-151 31.743000000000002 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 4.0 22 5.0 23 7.0 24 8.0 25 11.0 26 24.0 27 33.0 28 67.0 29 65.0 30 104.0 31 175.0 32 229.0 33 342.0 34 772.0 35 2153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.325000000000003 10.65 12.35 53.675 2 22.85 17.224999999999998 36.475 23.45 3 23.425 21.8 24.425 30.349999999999998 4 26.1 27.650000000000002 17.45 28.799999999999997 5 29.725 29.375 19.75 21.15 6 23.43945851090499 33.59237904236651 18.8017046878917 24.166457758836803 7 20.9 15.6 38.1 25.4 8 22.6 20.0 25.825 31.574999999999996 9 22.400000000000002 19.5 29.349999999999998 28.749999999999996 10-14 25.215 24.765 23.145 26.875 15-19 25.779999999999998 23.61 23.785 26.825 20-24 25.635 23.77 23.974999999999998 26.619999999999997 25-29 25.655 23.59 23.48 27.275 30-34 25.564999999999998 23.775 22.965 27.694999999999997 35-39 25.86 23.75 23.465 26.924999999999997 40-44 25.855 23.635 23.599999999999998 26.91 45-49 25.924999999999997 23.875 23.119999999999997 27.08 50-54 26.525 23.325000000000003 23.474999999999998 26.674999999999997 55-59 26.590000000000003 23.605 22.994999999999997 26.810000000000002 60-64 26.11 23.315 23.41 27.165 65-69 26.005 23.43 23.9 26.665 70-74 26.58 23.265 23.294999999999998 26.86 75-79 25.735000000000003 24.015 23.474999999999998 26.775 80-84 26.805 23.625 22.865 26.705000000000002 85-89 27.13 23.64 22.695 26.534999999999997 90-94 27.045 23.335 23.585 26.035000000000004 95-99 26.729999999999997 23.235 23.52 26.515 100-104 26.915 23.595 22.805 26.685 105-109 26.525 23.580000000000002 23.47 26.424999999999997 110-114 26.584999999999997 23.59 23.23 26.595000000000002 115-119 26.229999999999997 23.7 23.145 26.924999999999997 120-124 27.155 24.27 22.575 26.0 125-129 26.775 23.755000000000003 23.11 26.36 130-134 27.165 24.235 22.515 26.085 135-139 27.29 23.68 22.919999999999998 26.11 140-144 26.740000000000002 24.84 22.06 26.36 145-149 27.18 24.845 22.14 25.835 150-151 26.85 25.1 21.75 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 2.0 29 3.0 30 3.5 31 4.0 32 7.0 33 10.0 34 13.5 35 22.5 36 29.0 37 39.0 38 61.0 39 81.0 40 88.0 41 103.5 42 125.5 43 129.5 44 141.0 45 164.5 46 176.5 47 168.0 48 150.0 49 140.5 50 138.5 51 141.5 52 130.0 53 112.5 54 93.0 55 84.0 56 101.0 57 104.5 58 102.0 59 106.5 60 110.5 61 107.5 62 92.5 63 93.0 64 100.5 65 92.0 66 76.0 67 70.0 68 74.0 69 70.0 70 65.5 71 53.5 72 42.0 73 42.0 74 37.5 75 26.0 76 16.5 77 13.0 78 12.0 79 10.0 80 5.5 81 4.0 82 3.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.037500000000000006 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.5875000000000004 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 5.0375 0.0 0.0 0.0 0.0 128-129 5.625 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 9.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCAAC 10 0.006830828 145.0 3 GACCAAT 10 0.006830828 145.0 145 CGCGCGC 20 0.00593511 29.0 75-79 >>END_MODULE SRR14458923 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458923_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4025 32.0 32.0 32.0 32.0 32.0 2 31.11575 32.0 32.0 32.0 32.0 32.0 3 31.27425 32.0 32.0 32.0 32.0 32.0 4 31.2705 32.0 32.0 32.0 32.0 32.0 5 31.27 32.0 32.0 32.0 32.0 32.0 6 34.80725 36.0 36.0 36.0 32.0 36.0 7 34.929 36.0 36.0 36.0 36.0 36.0 8 34.93625 36.0 36.0 36.0 32.0 36.0 9 34.83025 36.0 36.0 36.0 32.0 36.0 10-14 34.801750000000006 36.0 36.0 36.0 32.0 36.0 15-19 34.803650000000005 36.0 36.0 36.0 32.8 36.0 20-24 34.77714999999999 36.0 36.0 36.0 32.8 36.0 25-29 34.80285 36.0 36.0 36.0 32.0 36.0 30-34 34.6991 36.0 36.0 36.0 32.0 36.0 35-39 34.7001 36.0 36.0 36.0 32.0 36.0 40-44 34.6649 36.0 36.0 36.0 32.0 36.0 45-49 34.6255 36.0 36.0 36.0 32.0 36.0 50-54 34.57305 36.0 36.0 36.0 32.0 36.0 55-59 34.466300000000004 36.0 36.0 36.0 32.0 36.0 60-64 34.424800000000005 36.0 36.0 36.0 32.0 36.0 65-69 34.302499999999995 36.0 36.0 36.0 32.0 36.0 70-74 34.32395 36.0 36.0 36.0 32.0 36.0 75-79 34.0927 36.0 36.0 36.0 32.0 36.0 80-84 33.990899999999996 36.0 36.0 36.0 31.0 36.0 85-89 33.732749999999996 36.0 36.0 36.0 29.0 36.0 90-94 33.7691 36.0 36.0 36.0 27.0 36.0 95-99 33.782 36.0 36.0 36.0 27.0 36.0 100-104 33.7702 36.0 36.0 36.0 27.0 36.0 105-109 33.68655 36.0 36.0 36.0 27.0 36.0 110-114 33.512950000000004 36.0 36.0 36.0 27.0 36.0 115-119 33.48585 36.0 34.4 36.0 27.0 36.0 120-124 33.458749999999995 36.0 36.0 36.0 27.0 36.0 125-129 33.334050000000005 36.0 34.4 36.0 27.0 36.0 130-134 33.4038 36.0 36.0 36.0 27.0 36.0 135-139 33.0172 36.0 32.0 36.0 27.0 36.0 140-144 33.005900000000004 36.0 32.0 36.0 27.0 36.0 145-149 32.59575 36.0 32.0 36.0 25.8 36.0 150-151 30.259125 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 1.0 18 4.0 19 4.0 20 3.0 21 6.0 22 9.0 23 10.0 24 13.0 25 20.0 26 49.0 27 44.0 28 68.0 29 88.0 30 120.0 31 177.0 32 241.0 33 419.0 34 837.0 35 1884.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.305826456614152 11.202800700175043 12.07801950487622 53.41335333833458 2 23.225 18.45 36.175000000000004 22.15 3 23.674999999999997 21.625 24.325 30.375000000000004 4 26.775 27.224999999999998 16.950000000000003 29.049999999999997 5 29.525000000000002 29.25 19.2 22.025 6 22.55 32.525 20.275000000000002 24.65 7 21.2 16.6 37.75 24.45 8 22.475 20.775 26.0 30.75 9 22.825 20.25 29.925 27.0 10-14 24.915000000000003 25.259999999999998 22.78 27.045 15-19 25.224999999999998 23.494999999999997 23.395 27.884999999999998 20-24 25.195 23.400000000000002 24.325 27.08 25-29 25.779999999999998 23.825 23.31 27.084999999999997 30-34 25.525 23.57 23.655 27.250000000000004 35-39 25.865 23.93 23.435 26.77 40-44 25.729999999999997 23.849999999999998 22.900000000000002 27.52 45-49 26.415 23.31 23.32 26.955000000000002 50-54 25.759999999999998 24.425 23.44 26.375 55-59 25.745 23.724999999999998 23.13 27.400000000000002 60-64 26.25 23.635 23.01 27.105 65-69 25.845000000000002 23.73 23.74 26.685 70-74 26.174999999999997 23.705000000000002 23.189999999999998 26.93 75-79 25.840000000000003 23.51 23.41 27.24 80-84 26.33 23.29 23.825 26.555 85-89 26.51 23.35 23.375 26.765 90-94 26.700000000000003 23.735 22.770000000000003 26.795 95-99 26.779999999999998 23.76 23.18 26.279999999999998 100-104 26.055 23.630000000000003 23.525 26.790000000000003 105-109 26.810000000000002 23.515 22.770000000000003 26.905 110-114 26.855 23.549999999999997 23.669999999999998 25.924999999999997 115-119 26.945000000000004 23.645 22.7 26.71 120-124 26.855 24.01 22.830000000000002 26.305 125-129 26.950000000000003 24.25 22.8 26.0 130-134 28.435 23.535 22.43 25.6 135-139 28.345 23.76 22.31 25.585 140-144 28.599999999999998 23.945 22.11 25.345000000000002 145-149 28.84 24.115000000000002 22.535 24.51 150-151 29.4 24.4125 21.9375 24.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 1.0 27 2.0 28 1.5 29 4.0 30 7.0 31 8.5 32 9.5 33 7.5 34 13.0 35 27.0 36 34.5 37 43.0 38 57.5 39 73.0 40 90.0 41 110.5 42 136.0 43 148.0 44 153.0 45 159.5 46 164.0 47 165.0 48 152.0 49 141.5 50 133.0 51 118.0 52 111.5 53 102.5 54 96.5 55 97.0 56 101.5 57 106.5 58 99.0 59 107.5 60 107.0 61 95.0 62 102.5 63 99.0 64 87.5 65 77.5 66 71.5 67 70.0 68 77.5 69 74.5 70 57.0 71 56.0 72 51.5 73 52.0 74 44.0 75 25.5 76 19.5 77 14.5 78 15.0 79 9.0 80 2.5 81 3.0 82 2.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.5374999999999996 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.85 0.0 0.0 0.0 0.0 124-125 4.45 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.074999999999999 0.0 0.0 0.0 0.0 132-133 6.637499999999999 0.0 0.0 0.0 0.0 134-135 7.3625 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGG 10 0.006830828 145.0 145 >>END_MODULE Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952593 spots for SRR14458923.sra Written 952593 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra Read 952584 spots for SRR14458923.sra Written 952584 spots for SRR14458923.sra SRR ids: ['SRR14458923.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qti9ztzb SRR14458923.sra spots: 19051689 blocks: [[1, 952584], [952585, 1905168], [1905169, 2857752], [2857753, 3810336], [3810337, 4762920], [4762921, 5715504], [5715505, 6668088], [6668089, 7620672], [7620673, 8573256], [8573257, 9525840], [9525841, 10478424], [10478425, 11431008], [11431009, 12383592], [12383593, 13336176], [13336177, 14288760], [14288761, 15241344], [15241345, 16193928], [16193929, 17146512], [17146513, 18099096], [18099097, 19051689]] SRR14458923 file size 6452897 SRR14458923 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458923 SRR14458923_1.fastq SRR14458923_2.fastq Input file: SRR14458923_1.fastq Paired file: SRR14458923_2.fastq trimmed: SRR14458923-trimmed-pair1.fastq, SRR14458923-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 09:52:49 2024 >> started Fri Dec 6 09:53:16 2024 >> done (26.800s) 19051689 read pairs processed; of these: 4002 ( 0.02%) short read pairs filtered out after trimming by size control 1372 ( 0.01%) empty read pairs filtered out after trimming by size control 19046315 (99.97%) read pairs available; of these: 3159925 (16.59%) trimmed read pairs available after processing 15886390 (83.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 211 0.00% 19 199 0.00% 20 196 0.00% 21 206 0.00% 22 213 0.00% 23 172 0.00% 24 189 0.00% 25 158 0.00% 26 165 0.00% 27 145 0.00% 28 160 0.00% 29 151 0.00% 30 151 0.00% 31 121 0.00% 32 149 0.00% 33 131 0.00% 34 371 0.00% 35 150 0.00% 36 130 0.00% 37 123 0.00% 38 137 0.00% 39 138 0.00% 40 124 0.00% 41 154 0.00% 42 128 0.00% 43 130 0.00% 44 139 0.00% 45 122 0.00% 46 126 0.00% 47 134 0.00% 48 168 0.00% 49 175 0.00% 50 176 0.00% 51 156 0.00% 52 176 0.00% 53 202 0.00% 54 190 0.00% 55 187 0.00% 56 213 0.00% 57 204 0.00% 58 245 0.00% 59 266 0.00% 60 267 0.00% 61 283 0.00% 62 278 0.00% 63 281 0.00% 64 280 0.00% 65 301 0.00% 66 284 0.00% 67 398 0.00% 68 372 0.00% 69 409 0.00% 70 488 0.00% 71 550 0.00% 72 584 0.00% 73 606 0.00% 74 613 0.00% 75 628 0.00% 76 685 0.00% 77 792 0.00% 78 855 0.00% 79 1027 0.01% 80 1098 0.01% 81 1271 0.01% 82 1481 0.01% 83 1655 0.01% 84 1825 0.01% 85 1962 0.01% 86 2106 0.01% 87 2336 0.01% 88 2602 0.01% 89 3085 0.02% 90 3391 0.02% 91 4118 0.02% 92 4595 0.02% 93 5145 0.03% 94 6025 0.03% 95 6419 0.03% 96 6878 0.04% 97 7835 0.04% 98 8499 0.04% 99 9446 0.05% 100 10633 0.06% 101 12033 0.06% 102 13452 0.07% 103 15457 0.08% 104 16829 0.09% 105 18217 0.10% 106 19578 0.10% 107 20965 0.11% 108 22359 0.12% 109 24274 0.13% 110 26109 0.14% 111 28514 0.15% 112 31498 0.17% 113 34313 0.18% 114 36660 0.19% 115 39430 0.21% 116 41213 0.22% 117 42461 0.22% 118 44347 0.23% 119 46202 0.24% 120 48537 0.25% 121 51631 0.27% 122 54909 0.29% 123 58084 0.30% 124 61697 0.32% 125 64839 0.34% 126 65805 0.35% 127 67301 0.35% 128 69430 0.36% 129 70461 0.37% 130 72547 0.38% 131 74948 0.39% 132 77758 0.41% 133 81085 0.43% 134 83756 0.44% 135 85541 0.45% 136 87272 0.46% 137 88324 0.46% 138 88718 0.47% 139 90012 0.47% 140 91147 0.48% 141 91517 0.48% 142 94540 0.50% 143 96028 0.50% 144 97441 0.51% 145 99112 0.52% 146 99467 0.52% 147 100118 0.53% 148 102121 0.54% 149 101165 0.53% 150 101136 0.53% 151 15886390 83.41% 19046315 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=7 prefix-density=0.59 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=26.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=8 prefix-density=0.59 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=30.86 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458923 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 09:55:03 Started mapping on | Dec 06 09:55:04 Finished on | Dec 06 09:57:02 Mapping speed, Million of reads per hour | 581.07 Number of input reads | 19046315 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18083787 Uniquely mapped reads % | 94.95% Average mapped length | 293.27 Number of splices: Total | 18497691 Number of splices: Annotated (sjdb) | 17456320 Number of splices: GT/AG | 18247991 Number of splices: GC/AG | 212133 Number of splices: AT/AC | 7097 Number of splices: Non-canonical | 30470 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223006 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 34298 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 1.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 739522 739522 739522 N_multimapping 223006 223006 223006 N_noFeature 515124 9103356 9168811 N_ambiguous 402466 40292 40088 UnstrandedReadsAssigned:17166197 PositiveStrandReadsAssigned:8940139 NegativeStrandReadsAssigned:8874888 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458923 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458923-trimmed-pair1.fastq SRR14458923-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,046,315 reads, 17,898,376 reads pseudoaligned [quant] estimated average fragment length: 239.837 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52973 SRR14458923.ke.tsv 35125 SRR14458923.se.tsv 88098 total ==> SRR14458923.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.557 0 0 PNS24247 1044 805.163 22.9741 2.12894 PNS24249 1928 1689.16 118.585 5.23802 PNS24246 1044 805.163 22.9741 2.12894 PNS24248 1044 805.163 22.9741 2.12894 PNS24244 1471 1232.16 15.4927 0.93814 PNS24243 293 104.557 4 2.85441 KQK14069 1603 1364.16 8358.06 457.138 KQK14071 474 250.981 199.94 59.4385 ==> SRR14458923.se.tsv <== BRADI_1g14170v3 9145 BRADI_1g53295v3 60 BRADI_1g59795v3 305 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 1643 BRADI_1g74790v3 563 BRADI_1g09890v3 9 BRADI_1g77505v3 372 BRADI_1g48960v3 0 SRR14458923 completed mapping pipeline successfully