Starting /dee2/code/volunteer_pipeline.sh SRR14458924 current disk space = 1552040693760 free memory = 1603843300 SRR14458924 SRAfilesize 5ee428e8df47b6ffbb9e9537b85f4bc4 SRR14458924.sra SRR14458924.sra file validated SRR14458924 is paired end SRR14458924 is conventional basespace SRR14458924 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458924_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.425 32.0 32.0 32.0 32.0 32.0 2 31.39275 32.0 32.0 32.0 32.0 32.0 3 31.53425 32.0 32.0 32.0 32.0 32.0 4 31.64225 32.0 32.0 32.0 32.0 32.0 5 31.67025 32.0 32.0 32.0 32.0 32.0 6 34.91925 36.0 36.0 36.0 36.0 36.0 7 35.15875 36.0 36.0 36.0 36.0 36.0 8 35.20725 36.0 36.0 36.0 36.0 36.0 9 35.14575 36.0 36.0 36.0 36.0 36.0 10-14 35.126799999999996 36.0 36.0 36.0 36.0 36.0 15-19 35.10295000000001 36.0 36.0 36.0 36.0 36.0 20-24 35.07305 36.0 36.0 36.0 36.0 36.0 25-29 34.966699999999996 36.0 36.0 36.0 35.2 36.0 30-34 34.92215 36.0 36.0 36.0 32.8 36.0 35-39 34.81545 36.0 36.0 36.0 32.0 36.0 40-44 34.867399999999996 36.0 36.0 36.0 32.8 36.0 45-49 34.79415 36.0 36.0 36.0 32.0 36.0 50-54 34.66395 36.0 36.0 36.0 32.0 36.0 55-59 34.718300000000006 36.0 36.0 36.0 32.0 36.0 60-64 34.51265 36.0 36.0 36.0 32.0 36.0 65-69 34.5313 36.0 36.0 36.0 32.0 36.0 70-74 34.47565 36.0 36.0 36.0 32.0 36.0 75-79 34.305600000000005 36.0 36.0 36.0 32.0 36.0 80-84 34.23055000000001 36.0 36.0 36.0 32.0 36.0 85-89 34.08819999999999 36.0 36.0 36.0 32.0 36.0 90-94 34.1063 36.0 36.0 36.0 32.0 36.0 95-99 33.95385 36.0 36.0 36.0 30.0 36.0 100-104 33.9242 36.0 36.0 36.0 30.0 36.0 105-109 33.803999999999995 36.0 36.0 36.0 28.0 36.0 110-114 33.757149999999996 36.0 36.0 36.0 27.0 36.0 115-119 33.696749999999994 36.0 36.0 36.0 27.0 36.0 120-124 33.6563 36.0 36.0 36.0 27.0 36.0 125-129 33.462199999999996 36.0 36.0 36.0 27.0 36.0 130-134 33.5588 36.0 36.0 36.0 27.0 36.0 135-139 33.4063 36.0 35.2 36.0 27.0 36.0 140-144 33.3134 36.0 34.4 36.0 27.0 36.0 145-149 33.210950000000004 36.0 32.8 36.0 27.0 36.0 150-151 31.4455 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 3.0 21 4.0 22 5.0 23 9.0 24 7.0 25 17.0 26 26.0 27 39.0 28 66.0 29 84.0 30 98.0 31 172.0 32 256.0 33 368.0 34 768.0 35 2077.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.799999999999997 10.975 12.875 52.349999999999994 2 23.225 17.45 35.625 23.7 3 22.825 22.425 24.575 30.175 4 27.025 26.825 18.275 27.875 5 29.275000000000002 29.849999999999998 18.925 21.95 6 22.336425169215342 34.77061920280772 19.32815241915267 23.564803208824266 7 21.55 14.575 37.425000000000004 26.450000000000003 8 22.525000000000002 19.7 25.575 32.2 9 23.875 19.6 28.15 28.375 10-14 25.395 24.395 22.830000000000002 27.38 15-19 25.575 23.244999999999997 23.01 28.17 20-24 26.325 23.56 22.88 27.235 25-29 26.174999999999997 22.875 23.025000000000002 27.925 30-34 26.125 23.945 22.765 27.165 35-39 26.645000000000003 23.775 22.27 27.310000000000002 40-44 26.44 23.169999999999998 23.315 27.075 45-49 26.055 23.185 22.84 27.92 50-54 26.284999999999997 23.005 23.49 27.22 55-59 26.8 22.98 22.59 27.63 60-64 26.595000000000002 22.869999999999997 23.01 27.525 65-69 26.775 23.365 22.67 27.189999999999998 70-74 26.86 22.919999999999998 22.975 27.245 75-79 26.68 23.005 23.165 27.150000000000002 80-84 26.924999999999997 22.615 22.759999999999998 27.700000000000003 85-89 27.47 22.67 22.645 27.215 90-94 27.195000000000004 22.81 22.855 27.139999999999997 95-99 26.695 23.085 23.169999999999998 27.05 100-104 27.295 22.775000000000002 22.575 27.355 105-109 27.415 22.835 22.89 26.86 110-114 27.07 22.795 22.605 27.529999999999998 115-119 27.425 23.16 22.06 27.355 120-124 27.334999999999997 23.03 22.38 27.255000000000003 125-129 27.41 23.415 22.36 26.815 130-134 27.42 23.285 22.650000000000002 26.645000000000003 135-139 27.38 23.52 22.39 26.71 140-144 28.060000000000002 23.86 21.625 26.455000000000002 145-149 27.565 23.73 22.375 26.33 150-151 27.3875 24.087500000000002 21.8625 26.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 2.0 28 2.0 29 1.5 30 6.0 31 7.5 32 9.5 33 11.5 34 12.5 35 21.0 36 26.0 37 36.0 38 47.5 39 63.5 40 93.0 41 98.5 42 110.0 43 134.0 44 143.5 45 146.5 46 152.0 47 151.5 48 153.0 49 151.0 50 131.5 51 120.0 52 120.0 53 115.0 54 100.5 55 93.0 56 94.5 57 95.5 58 106.5 59 113.5 60 103.0 61 101.5 62 97.5 63 91.5 64 92.0 65 91.0 66 87.0 67 83.0 68 81.0 69 78.0 70 65.0 71 55.0 72 58.5 73 55.0 74 45.0 75 35.0 76 28.5 77 25.5 78 16.0 79 11.0 80 11.0 81 6.5 82 2.5 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.6048387096774194 1.2 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.037500000000000006 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.5375 0.0 0.0 0.0 0.0 136-137 7.2625 0.0 0.0 0.0 0.0 138-139 7.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATCA 10 0.006830828 145.0 3 ACACGTC 35 0.0035366106 20.714287 135-139 CACACGT 40 0.0076550315 18.125 135-139 AAGAGCA 40 0.0076550315 18.125 130-134 GTCTGAA 40 0.0076550315 18.125 140-144 AGAGCAC 40 0.0076550315 18.125 130-134 >>END_MODULE SRR14458924 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458924_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.38475 32.0 32.0 32.0 32.0 32.0 2 31.174 32.0 32.0 32.0 32.0 32.0 3 31.14775 32.0 32.0 32.0 32.0 32.0 4 31.13025 32.0 32.0 32.0 32.0 32.0 5 31.23025 32.0 32.0 32.0 32.0 32.0 6 34.7245 36.0 36.0 36.0 32.0 36.0 7 34.73225 36.0 36.0 36.0 32.0 36.0 8 34.829 36.0 36.0 36.0 32.0 36.0 9 34.76925 36.0 36.0 36.0 32.0 36.0 10-14 34.749900000000004 36.0 36.0 36.0 32.0 36.0 15-19 34.70285 36.0 36.0 36.0 32.0 36.0 20-24 34.61875 36.0 36.0 36.0 32.0 36.0 25-29 34.65355 36.0 36.0 36.0 32.0 36.0 30-34 34.565650000000005 36.0 36.0 36.0 32.0 36.0 35-39 34.5212 36.0 36.0 36.0 32.0 36.0 40-44 34.51155 36.0 36.0 36.0 32.0 36.0 45-49 34.515100000000004 36.0 36.0 36.0 32.0 36.0 50-54 34.4828 36.0 36.0 36.0 32.0 36.0 55-59 34.34335 36.0 36.0 36.0 32.0 36.0 60-64 34.2645 36.0 36.0 36.0 32.0 36.0 65-69 34.239050000000006 36.0 36.0 36.0 32.0 36.0 70-74 34.135400000000004 36.0 36.0 36.0 32.0 36.0 75-79 34.0 36.0 36.0 36.0 30.0 36.0 80-84 33.92035 36.0 36.0 36.0 31.0 36.0 85-89 33.7066 36.0 36.0 36.0 28.0 36.0 90-94 33.705200000000005 36.0 36.0 36.0 27.0 36.0 95-99 33.617399999999996 36.0 36.0 36.0 27.0 36.0 100-104 33.64865 36.0 36.0 36.0 27.0 36.0 105-109 33.60770000000001 36.0 36.0 36.0 27.0 36.0 110-114 33.402100000000004 36.0 36.0 36.0 27.0 36.0 115-119 33.37285 36.0 34.4 36.0 27.0 36.0 120-124 33.355149999999995 36.0 35.2 36.0 27.0 36.0 125-129 33.2404 36.0 32.8 36.0 27.0 36.0 130-134 33.23505 36.0 34.4 36.0 27.0 36.0 135-139 32.97475 36.0 32.0 36.0 27.0 36.0 140-144 32.906150000000004 36.0 32.0 36.0 24.6 36.0 145-149 32.4752 36.0 32.0 36.0 23.4 36.0 150-151 29.94475 34.0 29.5 36.0 17.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 4.0 18 2.0 19 4.0 20 7.0 21 7.0 22 12.0 23 12.0 24 16.0 25 29.0 26 45.0 27 47.0 28 84.0 29 96.0 30 119.0 31 181.0 32 284.0 33 374.0 34 829.0 35 1846.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.58089522380595 10.327581895473868 12.478119529882472 53.61340335083771 2 24.25 17.424999999999997 35.15 23.175 3 24.0 22.1 23.925 29.975 4 27.925 26.775 17.325 27.975 5 29.075 29.849999999999998 18.925 22.15 6 22.95 34.0 19.75 23.3 7 22.15 15.6 36.35 25.900000000000002 8 21.875 19.475 25.474999999999998 33.175 9 22.7 19.025 28.9 29.375 10-14 24.85 24.505 22.595000000000002 28.050000000000004 15-19 25.755 23.49 23.41 27.345000000000002 20-24 25.590000000000003 23.580000000000002 23.45 27.38 25-29 26.229999999999997 23.794999999999998 22.88 27.095000000000002 30-34 25.825 23.794999999999998 23.095 27.284999999999997 35-39 25.6 24.77 22.31 27.32 40-44 26.090000000000003 23.995 22.650000000000002 27.265 45-49 25.729999999999997 23.445 23.27 27.555000000000003 50-54 26.0 23.735 22.95 27.315 55-59 26.56 23.189999999999998 22.37 27.88 60-64 26.179999999999996 23.13 23.32 27.37 65-69 26.75 23.35 22.759999999999998 27.139999999999997 70-74 26.045 23.29 22.755 27.91 75-79 26.815 22.99 23.07 27.125 80-84 26.784999999999997 23.05 22.82 27.345000000000002 85-89 27.150000000000002 22.845 22.564999999999998 27.439999999999998 90-94 27.22 23.275000000000002 22.23 27.275 95-99 27.125 22.99 22.735 27.150000000000002 100-104 27.089999999999996 23.285 22.665 26.96 105-109 26.919999999999998 23.185 23.0 26.895000000000003 110-114 27.655 23.14 22.405 26.8 115-119 27.455000000000002 24.044999999999998 22.11 26.39 120-124 28.065 22.745 22.375 26.815 125-129 28.29 23.72 21.955 26.035000000000004 130-134 27.99 23.375 22.25 26.384999999999998 135-139 28.785 22.82 22.220000000000002 26.174999999999997 140-144 29.01 23.549999999999997 22.06 25.380000000000003 145-149 28.87 23.625 22.52 24.985 150-151 28.825 23.8125 21.8125 25.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.5 27 0.5 28 2.5 29 4.0 30 2.5 31 4.0 32 5.5 33 9.0 34 16.0 35 24.5 36 33.5 37 39.0 38 47.0 39 63.0 40 87.5 41 116.0 42 126.5 43 140.0 44 154.0 45 151.0 46 151.5 47 134.5 48 126.5 49 134.0 50 135.5 51 134.5 52 124.0 53 110.0 54 105.0 55 99.5 56 98.0 57 106.5 58 106.0 59 102.5 60 97.5 61 91.0 62 88.0 63 91.5 64 94.5 65 91.0 66 89.5 67 88.5 68 77.5 69 81.0 70 74.5 71 64.5 72 62.0 73 42.5 74 39.0 75 40.0 76 30.0 77 18.5 78 11.5 79 7.5 80 6.5 81 6.0 82 2.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.5797832114948324 1.15 3 0.050415931434333254 0.15 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.55 0.0 0.0 0.0 0.0 136-137 7.25 0.0 0.0 0.0 0.0 138-139 7.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGAGT 10 0.006830828 145.0 2 TAGGGAA 40 0.005621335 54.375 145 GTCGTGT 40 0.0076550315 18.125 135-139 TGTAGGG 40 0.0076550315 18.125 140-144 GTAGGGA 40 0.0076550315 18.125 140-144 >>END_MODULE Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937206 spots for SRR14458924.sra Written 937206 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra Read 937193 spots for SRR14458924.sra Written 937193 spots for SRR14458924.sra SRR ids: ['SRR14458924.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5xwy12jm SRR14458924.sra spots: 18743873 blocks: [[1, 937193], [937194, 1874386], [1874387, 2811579], [2811580, 3748772], [3748773, 4685965], [4685966, 5623158], [5623159, 6560351], [6560352, 7497544], [7497545, 8434737], [8434738, 9371930], [9371931, 10309123], [10309124, 11246316], [11246317, 12183509], [12183510, 13120702], [13120703, 14057895], [14057896, 14995088], [14995089, 15932281], [15932282, 16869474], [16869475, 17806667], [17806668, 18743873]] SRR14458924 file size 6348287 SRR14458924 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458924 SRR14458924_1.fastq SRR14458924_2.fastq Input file: SRR14458924_1.fastq Paired file: SRR14458924_2.fastq trimmed: SRR14458924-trimmed-pair1.fastq, SRR14458924-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:08:12 2024 >> started Fri Dec 6 10:08:32 2024 >> done (20.109s) 18743873 read pairs processed; of these: 4410 ( 0.02%) short read pairs filtered out after trimming by size control 1282 ( 0.01%) empty read pairs filtered out after trimming by size control 18738181 (99.97%) read pairs available; of these: 2692971 (14.37%) trimmed read pairs available after processing 16045210 (85.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 223 0.00% 19 209 0.00% 20 184 0.00% 21 160 0.00% 22 183 0.00% 23 197 0.00% 24 189 0.00% 25 164 0.00% 26 159 0.00% 27 160 0.00% 28 147 0.00% 29 150 0.00% 30 134 0.00% 31 137 0.00% 32 151 0.00% 33 120 0.00% 34 297 0.00% 35 135 0.00% 36 131 0.00% 37 112 0.00% 38 136 0.00% 39 139 0.00% 40 135 0.00% 41 136 0.00% 42 112 0.00% 43 129 0.00% 44 107 0.00% 45 127 0.00% 46 129 0.00% 47 158 0.00% 48 155 0.00% 49 159 0.00% 50 155 0.00% 51 137 0.00% 52 138 0.00% 53 152 0.00% 54 178 0.00% 55 171 0.00% 56 188 0.00% 57 191 0.00% 58 230 0.00% 59 246 0.00% 60 250 0.00% 61 277 0.00% 62 297 0.00% 63 256 0.00% 64 230 0.00% 65 303 0.00% 66 305 0.00% 67 317 0.00% 68 406 0.00% 69 434 0.00% 70 499 0.00% 71 567 0.00% 72 594 0.00% 73 649 0.00% 74 573 0.00% 75 605 0.00% 76 703 0.00% 77 770 0.00% 78 867 0.00% 79 922 0.00% 80 1114 0.01% 81 1334 0.01% 82 1537 0.01% 83 1645 0.01% 84 1831 0.01% 85 2006 0.01% 86 2186 0.01% 87 2357 0.01% 88 2589 0.01% 89 3037 0.02% 90 3483 0.02% 91 3985 0.02% 92 4520 0.02% 93 5014 0.03% 94 5727 0.03% 95 6244 0.03% 96 6600 0.04% 97 7391 0.04% 98 8055 0.04% 99 8725 0.05% 100 9655 0.05% 101 11278 0.06% 102 12246 0.07% 103 13738 0.07% 104 15044 0.08% 105 16208 0.09% 106 17502 0.09% 107 18719 0.10% 108 19695 0.11% 109 21292 0.11% 110 23084 0.12% 111 24691 0.13% 112 27210 0.15% 113 29629 0.16% 114 31876 0.17% 115 33779 0.18% 116 35311 0.19% 117 36437 0.19% 118 37843 0.20% 119 39791 0.21% 120 41535 0.22% 121 43747 0.23% 122 46855 0.25% 123 49218 0.26% 124 52047 0.28% 125 54548 0.29% 126 56135 0.30% 127 56857 0.30% 128 58138 0.31% 129 58825 0.31% 130 61044 0.33% 131 62810 0.34% 132 65211 0.35% 133 67731 0.36% 134 70523 0.38% 135 71703 0.38% 136 73840 0.39% 137 74200 0.40% 138 73923 0.39% 139 75876 0.40% 140 76161 0.41% 141 77096 0.41% 142 79354 0.42% 143 81845 0.44% 144 82697 0.44% 145 83502 0.45% 146 83957 0.45% 147 84907 0.45% 148 86477 0.46% 149 85194 0.45% 150 86033 0.46% 151 16045210 85.63% 18738181 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=8 prefix-density=0.55 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=25.90 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=8 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=28.39 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458924 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:09:19 Started mapping on | Dec 06 10:09:19 Finished on | Dec 06 10:11:17 Mapping speed, Million of reads per hour | 571.67 Number of input reads | 18738181 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17696742 Uniquely mapped reads % | 94.44% Average mapped length | 294.03 Number of splices: Total | 18111898 Number of splices: Annotated (sjdb) | 17101683 Number of splices: GT/AG | 17864827 Number of splices: GC/AG | 210989 Number of splices: AT/AC | 7140 Number of splices: Non-canonical | 28942 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 259513 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 39473 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 1.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 781926 781926 781926 N_multimapping 259513 259513 259513 N_noFeature 522628 8936703 8973228 N_ambiguous 401097 48536 47618 UnstrandedReadsAssigned:16773017 PositiveStrandReadsAssigned:8711503 NegativeStrandReadsAssigned:8675896 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458924 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458924-trimmed-pair1.fastq SRR14458924-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,738,181 reads, 17,507,400 reads pseudoaligned [quant] estimated average fragment length: 250.847 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52973 SRR14458924.ke.tsv 35125 SRR14458924.se.tsv 88098 total ==> SRR14458924.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.438 0 0 PNS24247 1044 794.153 23.2069 2.18658 PNS24249 1928 1678.15 131.513 5.86392 PNS24246 1044 794.153 23.2069 2.18658 PNS24248 1044 794.153 23.2069 2.18658 PNS24244 1471 1221.15 14.8665 0.910941 PNS24243 293 100.608 8 5.94987 KQK14069 1603 1353.15 7163.19 396.106 KQK14071 474 242.592 145.184 44.7811 ==> SRR14458924.se.tsv <== BRADI_1g14170v3 7871 BRADI_1g53295v3 46 BRADI_1g59795v3 263 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 2177 BRADI_1g74790v3 585 BRADI_1g09890v3 6 BRADI_1g77505v3 398 BRADI_1g48960v3 0 SRR14458924 completed mapping pipeline successfully