Starting /dee2/code/volunteer_pipeline.sh SRR14458925 current disk space = 1551987576832 free memory = 1601503868 SRR14458925 SRAfilesize 4dd19f8f4a7de3e0e6bad040f9d924d6 SRR14458925.sra SRR14458925.sra file validated SRR14458925 is paired end SRR14458925 is conventional basespace SRR14458925 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458925_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.30625 32.0 32.0 32.0 32.0 32.0 2 31.5145 32.0 32.0 32.0 32.0 32.0 3 31.467 32.0 32.0 32.0 32.0 32.0 4 31.531 32.0 32.0 32.0 32.0 32.0 5 31.5785 32.0 32.0 32.0 32.0 32.0 6 34.9275 36.0 36.0 36.0 36.0 36.0 7 35.1105 36.0 36.0 36.0 36.0 36.0 8 35.07625 36.0 36.0 36.0 36.0 36.0 9 35.0825 36.0 36.0 36.0 36.0 36.0 10-14 35.0687 36.0 36.0 36.0 36.0 36.0 15-19 35.0349 36.0 36.0 36.0 35.2 36.0 20-24 35.0543 36.0 36.0 36.0 36.0 36.0 25-29 34.96810000000001 36.0 36.0 36.0 34.4 36.0 30-34 34.84975 36.0 36.0 36.0 32.0 36.0 35-39 34.7808 36.0 36.0 36.0 32.0 36.0 40-44 34.76690000000001 36.0 36.0 36.0 32.0 36.0 45-49 34.6948 36.0 36.0 36.0 32.0 36.0 50-54 34.68525 36.0 36.0 36.0 32.0 36.0 55-59 34.6304 36.0 36.0 36.0 32.0 36.0 60-64 34.5233 36.0 36.0 36.0 32.0 36.0 65-69 34.493399999999994 36.0 36.0 36.0 32.0 36.0 70-74 34.428349999999995 36.0 36.0 36.0 32.0 36.0 75-79 34.24515 36.0 36.0 36.0 32.0 36.0 80-84 34.26025 36.0 36.0 36.0 32.0 36.0 85-89 34.04645 36.0 36.0 36.0 32.0 36.0 90-94 34.08285 36.0 36.0 36.0 32.0 36.0 95-99 33.91405 36.0 36.0 36.0 31.0 36.0 100-104 33.865899999999996 36.0 36.0 36.0 29.0 36.0 105-109 33.84495 36.0 36.0 36.0 29.0 36.0 110-114 33.73175 36.0 36.0 36.0 28.0 36.0 115-119 33.6397 36.0 36.0 36.0 27.0 36.0 120-124 33.5861 36.0 36.0 36.0 27.0 36.0 125-129 33.53945 36.0 36.0 36.0 27.0 36.0 130-134 33.4442 36.0 35.2 36.0 27.0 36.0 135-139 33.47315 36.0 35.2 36.0 27.0 36.0 140-144 33.363299999999995 36.0 34.4 36.0 27.0 36.0 145-149 33.239250000000006 36.0 32.0 36.0 27.0 36.0 150-151 31.618750000000002 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 6.0 23 6.0 24 7.0 25 21.0 26 32.0 27 56.0 28 56.0 29 79.0 30 122.0 31 166.0 32 234.0 33 387.0 34 793.0 35 2032.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.525 11.725 12.325 54.425000000000004 2 22.6 17.175 37.1 23.125 3 23.95 21.825 23.925 30.3 4 26.3 28.050000000000004 16.525000000000002 29.125 5 28.1 30.675 19.375 21.85 6 22.720440881763526 34.243486973947896 19.38877755511022 23.647294589178355 7 21.2 16.375 37.5 24.925 8 21.85 19.225 26.325 32.6 9 22.35 19.85 28.749999999999996 29.049999999999997 10-14 24.95 24.8 23.22 27.029999999999998 15-19 25.825 23.025000000000002 23.325000000000003 27.825 20-24 25.55 24.395 23.21 26.845000000000002 25-29 25.46 23.595 23.935000000000002 27.01 30-34 25.900000000000002 23.665 23.365 27.07 35-39 25.91 23.805 23.21 27.075 40-44 25.650000000000002 23.005 23.59 27.755000000000003 45-49 26.56 23.76 22.605 27.075 50-54 26.195 23.195 22.98 27.63 55-59 26.27 23.064999999999998 23.549999999999997 27.115000000000002 60-64 26.08 23.169999999999998 23.055 27.694999999999997 65-69 26.455000000000002 23.875 22.935 26.735 70-74 26.22 22.825 23.735 27.22 75-79 26.195 24.2 22.765 26.840000000000003 80-84 26.085 23.5 23.565 26.85 85-89 26.345000000000002 23.674999999999997 22.475 27.505000000000003 90-94 26.314999999999998 23.86 22.665 27.16 95-99 26.69 23.51 23.400000000000002 26.400000000000002 100-104 26.345000000000002 22.965 23.244999999999997 27.445000000000004 105-109 27.134999999999998 23.419999999999998 23.035 26.41 110-114 27.115000000000002 23.150000000000002 22.48 27.255000000000003 115-119 27.015 23.885 22.564999999999998 26.534999999999997 120-124 27.67 23.555 22.375 26.400000000000002 125-129 26.99 23.544999999999998 22.86 26.605 130-134 27.245 23.985 22.025 26.745 135-139 27.6 24.085 21.685 26.63 140-144 27.77 24.235 21.505 26.490000000000002 145-149 27.29 24.67 21.775 26.265 150-151 25.637500000000003 25.4 22.1375 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 1.5 29 5.5 30 6.0 31 4.5 32 9.0 33 13.0 34 16.5 35 24.0 36 33.5 37 41.0 38 50.5 39 66.5 40 86.5 41 110.5 42 123.0 43 136.5 44 143.5 45 149.5 46 158.0 47 160.0 48 155.0 49 143.0 50 136.0 51 131.0 52 126.5 53 115.0 54 116.0 55 111.0 56 105.5 57 105.5 58 95.5 59 92.5 60 100.5 61 102.5 62 96.0 63 93.0 64 98.0 65 85.0 66 63.0 67 66.5 68 75.5 69 69.5 70 61.0 71 58.5 72 52.5 73 47.5 74 42.5 75 31.5 76 22.0 77 18.5 78 14.0 79 8.5 80 5.5 81 6.0 82 4.0 83 1.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.4124999999999996 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.550000000000001 0.0 0.0 0.0 0.0 132-133 6.2 0.0 0.0 0.0 0.0 134-135 7.0875 0.0 0.0 0.0 0.0 136-137 8.0 0.0 0.0 0.0 0.0 138-139 9.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCCA 25 8.7132835E-4 87.0 2 >>END_MODULE SRR14458925 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458925_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3315 32.0 32.0 32.0 32.0 32.0 2 30.98025 32.0 32.0 32.0 32.0 32.0 3 31.0115 32.0 32.0 32.0 32.0 32.0 4 31.01875 32.0 32.0 32.0 32.0 32.0 5 31.17725 32.0 32.0 32.0 32.0 32.0 6 34.59975 36.0 36.0 36.0 32.0 36.0 7 34.5985 36.0 36.0 36.0 32.0 36.0 8 34.64875 36.0 36.0 36.0 32.0 36.0 9 34.6725 36.0 36.0 36.0 32.0 36.0 10-14 34.483450000000005 36.0 36.0 36.0 32.0 36.0 15-19 34.519549999999995 36.0 36.0 36.0 32.0 36.0 20-24 34.4951 36.0 36.0 36.0 32.0 36.0 25-29 34.487300000000005 36.0 36.0 36.0 32.0 36.0 30-34 34.403499999999994 36.0 36.0 36.0 32.0 36.0 35-39 34.37045 36.0 36.0 36.0 32.0 36.0 40-44 34.390249999999995 36.0 36.0 36.0 32.0 36.0 45-49 34.29624999999999 36.0 36.0 36.0 32.0 36.0 50-54 34.22385 36.0 36.0 36.0 32.0 36.0 55-59 34.1466 36.0 36.0 36.0 32.0 36.0 60-64 34.15185 36.0 36.0 36.0 32.0 36.0 65-69 34.02395 36.0 36.0 36.0 31.0 36.0 70-74 34.090999999999994 36.0 36.0 36.0 31.0 36.0 75-79 33.76655 36.0 36.0 36.0 27.0 36.0 80-84 33.70645 36.0 36.0 36.0 30.0 36.0 85-89 33.497699999999995 36.0 36.0 36.0 27.0 36.0 90-94 33.57064999999999 36.0 36.0 36.0 27.0 36.0 95-99 33.44015 36.0 36.0 36.0 27.0 36.0 100-104 33.39665 36.0 36.0 36.0 27.0 36.0 105-109 33.359449999999995 36.0 36.0 36.0 27.0 36.0 110-114 33.21695 36.0 36.0 36.0 27.0 36.0 115-119 33.15219999999999 36.0 33.6 36.0 27.0 36.0 120-124 33.205650000000006 36.0 34.4 36.0 27.0 36.0 125-129 33.0704 36.0 32.8 36.0 25.8 36.0 130-134 33.118849999999995 36.0 32.8 36.0 25.8 36.0 135-139 32.755 36.0 32.0 36.0 23.4 36.0 140-144 32.7755 36.0 32.0 36.0 22.2 36.0 145-149 32.194900000000004 36.0 32.0 36.0 14.0 36.0 150-151 30.115625 34.0 29.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 1.0 19 6.0 20 4.0 21 6.0 22 11.0 23 22.0 24 28.0 25 25.0 26 44.0 27 70.0 28 91.0 29 107.0 30 147.0 31 178.0 32 283.0 33 428.0 34 856.0 35 1688.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.761380690345174 10.730365182591296 11.430715357678839 55.077538769384695 2 23.95 17.075000000000003 35.75 23.225 3 25.3 21.325 24.55 28.825 4 28.499999999999996 26.625 17.7 27.175 5 29.549999999999997 29.2 19.650000000000002 21.6 6 23.625 32.975 19.975 23.425 7 21.099999999999998 16.925 36.875 25.1 8 21.55 18.875 26.474999999999998 33.1 9 22.325 19.3 29.549999999999997 28.825 10-14 25.119999999999997 24.575 23.16 27.145000000000003 15-19 25.75 24.075 23.125 27.05 20-24 26.16 23.355 23.56 26.924999999999997 25-29 25.91 23.705000000000002 23.155 27.229999999999997 30-34 25.45 24.610000000000003 22.795 27.145000000000003 35-39 25.945 23.74 23.52 26.795 40-44 26.729999999999997 23.25 22.88 27.139999999999997 45-49 26.21 23.419999999999998 23.165 27.205000000000002 50-54 26.064999999999998 23.65 23.175 27.11 55-59 26.19 23.785 23.25 26.775 60-64 26.090000000000003 22.78 23.955000000000002 27.175 65-69 25.885 23.655 23.69 26.77 70-74 26.35 23.315 23.494999999999997 26.840000000000003 75-79 26.55 23.125 23.395 26.93 80-84 26.534999999999997 22.770000000000003 23.56 27.134999999999998 85-89 26.75 23.54 23.14 26.57 90-94 27.005000000000003 23.26 22.795 26.939999999999998 95-99 26.455000000000002 23.59 23.119999999999997 26.834999999999997 100-104 26.93 23.345 22.865 26.86 105-109 26.640000000000004 23.565 23.195 26.6 110-114 27.045 23.395 22.900000000000002 26.66 115-119 27.61 23.305 22.965 26.119999999999997 120-124 27.08 23.835 22.5 26.584999999999997 125-129 27.55 23.669999999999998 22.48 26.3 130-134 28.53 23.93 22.59 24.95 135-139 28.48 23.674999999999997 22.515 25.330000000000002 140-144 28.615000000000002 24.18 21.92 25.285000000000004 145-149 29.54 24.41 21.315 24.735 150-151 29.6875 24.45 22.05 23.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.0 29 4.5 30 4.0 31 4.0 32 8.0 33 8.5 34 14.0 35 20.5 36 28.5 37 40.0 38 53.5 39 69.0 40 85.5 41 105.0 42 130.5 43 156.0 44 146.0 45 139.5 46 159.0 47 157.0 48 152.5 49 153.5 50 136.0 51 126.0 52 130.5 53 119.5 54 109.0 55 106.0 56 97.0 57 98.0 58 108.5 59 111.0 60 116.0 61 98.5 62 83.5 63 88.5 64 81.5 65 74.5 66 82.0 67 85.5 68 74.0 69 67.5 70 63.0 71 48.0 72 41.5 73 43.5 74 37.0 75 36.0 76 29.0 77 20.5 78 14.0 79 7.5 80 8.0 81 6.0 82 1.0 83 1.5 84 2.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5374999999999996 0.0 0.0 0.0 0.0 120-121 2.9625000000000004 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 4.199999999999999 0.0 0.0 0.0 0.0 126-127 4.575 0.0 0.0 0.0 0.0 128-129 4.9875 0.0 0.0 0.0 0.0 130-131 5.7 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 8.0375 0.0 0.0 0.0 0.0 138-139 9.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCAG 10 0.006830828 145.0 1 >>END_MODULE Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968011 spots for SRR14458925.sra Written 968011 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra Read 968000 spots for SRR14458925.sra Written 968000 spots for SRR14458925.sra SRR ids: ['SRR14458925.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ftensjg SRR14458925.sra spots: 19360011 blocks: [[1, 968000], [968001, 1936000], [1936001, 2904000], [2904001, 3872000], [3872001, 4840000], [4840001, 5808000], [5808001, 6776000], [6776001, 7744000], [7744001, 8712000], [8712001, 9680000], [9680001, 10648000], [10648001, 11616000], [11616001, 12584000], [12584001, 13552000], [13552001, 14520000], [14520001, 15488000], [15488001, 16456000], [16456001, 17424000], [17424001, 18392000], [18392001, 19360011]] SRR14458925 file size 6557678 SRR14458925 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458925 SRR14458925_1.fastq SRR14458925_2.fastq Input file: SRR14458925_1.fastq Paired file: SRR14458925_2.fastq trimmed: SRR14458925-trimmed-pair1.fastq, SRR14458925-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:11:20 2024 >> started Fri Dec 6 10:11:44 2024 >> done (24.076s) 19360011 read pairs processed; of these: 3916 ( 0.02%) short read pairs filtered out after trimming by size control 669 ( 0.00%) empty read pairs filtered out after trimming by size control 19355426 (99.98%) read pairs available; of these: 3156267 (16.31%) trimmed read pairs available after processing 16199159 (83.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 224 0.00% 19 172 0.00% 20 175 0.00% 21 166 0.00% 22 156 0.00% 23 164 0.00% 24 161 0.00% 25 143 0.00% 26 135 0.00% 27 136 0.00% 28 127 0.00% 29 170 0.00% 30 146 0.00% 31 136 0.00% 32 136 0.00% 33 111 0.00% 34 308 0.00% 35 149 0.00% 36 128 0.00% 37 140 0.00% 38 120 0.00% 39 134 0.00% 40 123 0.00% 41 146 0.00% 42 133 0.00% 43 130 0.00% 44 118 0.00% 45 160 0.00% 46 116 0.00% 47 134 0.00% 48 161 0.00% 49 166 0.00% 50 171 0.00% 51 162 0.00% 52 163 0.00% 53 165 0.00% 54 167 0.00% 55 145 0.00% 56 178 0.00% 57 185 0.00% 58 234 0.00% 59 251 0.00% 60 258 0.00% 61 258 0.00% 62 299 0.00% 63 296 0.00% 64 249 0.00% 65 272 0.00% 66 282 0.00% 67 334 0.00% 68 377 0.00% 69 410 0.00% 70 529 0.00% 71 528 0.00% 72 577 0.00% 73 586 0.00% 74 620 0.00% 75 616 0.00% 76 653 0.00% 77 722 0.00% 78 826 0.00% 79 940 0.00% 80 1079 0.01% 81 1212 0.01% 82 1433 0.01% 83 1610 0.01% 84 1757 0.01% 85 1932 0.01% 86 2042 0.01% 87 2251 0.01% 88 2455 0.01% 89 2898 0.01% 90 3222 0.02% 91 3811 0.02% 92 4404 0.02% 93 5030 0.03% 94 5657 0.03% 95 6128 0.03% 96 6539 0.03% 97 7329 0.04% 98 7912 0.04% 99 8734 0.05% 100 9850 0.05% 101 11223 0.06% 102 12702 0.07% 103 14362 0.07% 104 16118 0.08% 105 17218 0.09% 106 18927 0.10% 107 19801 0.10% 108 21234 0.11% 109 23204 0.12% 110 25413 0.13% 111 27081 0.14% 112 30238 0.16% 113 33474 0.17% 114 35709 0.18% 115 38489 0.20% 116 40226 0.21% 117 41102 0.21% 118 43914 0.23% 119 45849 0.24% 120 48320 0.25% 121 51445 0.27% 122 55043 0.28% 123 58078 0.30% 124 61880 0.32% 125 65237 0.34% 126 65860 0.34% 127 68018 0.35% 128 69354 0.36% 129 70630 0.36% 130 72238 0.37% 131 75523 0.39% 132 78073 0.40% 133 81231 0.42% 134 84709 0.44% 135 86565 0.45% 136 88354 0.46% 137 89405 0.46% 138 89814 0.46% 139 90933 0.47% 140 91733 0.47% 141 91972 0.48% 142 95643 0.49% 143 97063 0.50% 144 98545 0.51% 145 100379 0.52% 146 100619 0.52% 147 101713 0.53% 148 103822 0.54% 149 102189 0.53% 150 102033 0.53% 151 16199159 83.69% 19355426 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=8 prefix-density=0.55 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=37.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=7 prefix-density=0.53 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=34.99 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458925 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:12:31 Started mapping on | Dec 06 10:12:31 Finished on | Dec 06 10:14:35 Mapping speed, Million of reads per hour | 561.93 Number of input reads | 19355426 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18342027 Uniquely mapped reads % | 94.76% Average mapped length | 293.37 Number of splices: Total | 19122961 Number of splices: Annotated (sjdb) | 18068075 Number of splices: GT/AG | 18863107 Number of splices: GC/AG | 222520 Number of splices: AT/AC | 7949 Number of splices: Non-canonical | 29385 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253232 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 29891 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 760167 760167 760167 N_multimapping 253232 253232 253232 N_noFeature 521954 9249819 9294357 N_ambiguous 398414 41412 41869 UnstrandedReadsAssigned:17421659 PositiveStrandReadsAssigned:9050796 NegativeStrandReadsAssigned:9005801 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458925 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458925-trimmed-pair1.fastq SRR14458925-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,355,426 reads, 18,176,413 reads pseudoaligned [quant] estimated average fragment length: 240.654 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR14458925.ke.tsv 35125 SRR14458925.se.tsv 88098 total ==> SRR14458925.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.681 0 0 PNS24247 1044 804.346 37.5639 3.41729 PNS24249 1928 1688.35 118.905 5.15338 PNS24246 1044 804.346 37.5639 3.41729 PNS24248 1044 804.346 37.5639 3.41729 PNS24244 1471 1231.35 11.4031 0.677636 PNS24243 293 103.412 6 4.24555 KQK14069 1603 1363.35 7373.47 395.748 KQK14071 474 249.882 168.447 49.3266 ==> SRR14458925.se.tsv <== BRADI_1g14170v3 8006 BRADI_1g53295v3 44 BRADI_1g59795v3 285 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2091 BRADI_1g74790v3 660 BRADI_1g09890v3 10 BRADI_1g77505v3 380 BRADI_1g48960v3 0 SRR14458925 completed mapping pipeline successfully