Starting /dee2/code/volunteer_pipeline.sh SRR14458926 current disk space = 1551868563456 free memory = 1589486760 SRR14458926 SRAfilesize 4231f4d8868b22e0d68cb7ec097c4e35 SRR14458926.sra SRR14458926.sra file validated SRR14458926 is paired end SRR14458926 is conventional basespace SRR14458926 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458926_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3905 32.0 32.0 32.0 32.0 32.0 2 31.48125 32.0 32.0 32.0 32.0 32.0 3 31.575 32.0 32.0 32.0 32.0 32.0 4 31.63775 32.0 32.0 32.0 32.0 32.0 5 31.60625 32.0 32.0 32.0 32.0 32.0 6 34.9565 36.0 36.0 36.0 36.0 36.0 7 35.19125 36.0 36.0 36.0 36.0 36.0 8 35.1415 36.0 36.0 36.0 36.0 36.0 9 35.14275 36.0 36.0 36.0 36.0 36.0 10-14 35.1358 36.0 36.0 36.0 36.0 36.0 15-19 35.1352 36.0 36.0 36.0 36.0 36.0 20-24 35.0769 36.0 36.0 36.0 36.0 36.0 25-29 35.045300000000005 36.0 36.0 36.0 35.2 36.0 30-34 34.951800000000006 36.0 36.0 36.0 33.6 36.0 35-39 34.901149999999994 36.0 36.0 36.0 33.6 36.0 40-44 34.85235 36.0 36.0 36.0 32.0 36.0 45-49 34.781549999999996 36.0 36.0 36.0 32.0 36.0 50-54 34.713049999999996 36.0 36.0 36.0 32.0 36.0 55-59 34.7288 36.0 36.0 36.0 32.0 36.0 60-64 34.5306 36.0 36.0 36.0 32.0 36.0 65-69 34.64535 36.0 36.0 36.0 32.0 36.0 70-74 34.49825 36.0 36.0 36.0 32.0 36.0 75-79 34.3853 36.0 36.0 36.0 32.0 36.0 80-84 34.277 36.0 36.0 36.0 32.0 36.0 85-89 34.14895 36.0 36.0 36.0 31.0 36.0 90-94 34.1438 36.0 36.0 36.0 32.0 36.0 95-99 34.003249999999994 36.0 36.0 36.0 30.0 36.0 100-104 33.95604999999999 36.0 36.0 36.0 31.0 36.0 105-109 33.87445 36.0 36.0 36.0 29.0 36.0 110-114 33.7878 36.0 36.0 36.0 27.0 36.0 115-119 33.77575 36.0 36.0 36.0 28.0 36.0 120-124 33.64905 36.0 36.0 36.0 27.0 36.0 125-129 33.5259 36.0 36.0 36.0 27.0 36.0 130-134 33.56549999999999 36.0 36.0 36.0 27.0 36.0 135-139 33.4528 36.0 35.2 36.0 27.0 36.0 140-144 33.323299999999996 36.0 34.4 36.0 27.0 36.0 145-149 33.29755 36.0 32.8 36.0 27.0 36.0 150-151 31.434874999999998 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 4.0 22 4.0 23 6.0 24 14.0 25 19.0 26 26.0 27 53.0 28 56.0 29 79.0 30 101.0 31 147.0 32 214.0 33 384.0 34 753.0 35 2139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.025 11.725 12.275 50.975 2 22.3 18.3 34.925 24.474999999999998 3 24.099999999999998 21.675 23.825 30.4 4 27.6 27.125 16.525000000000002 28.749999999999996 5 28.999999999999996 31.175000000000004 19.400000000000002 20.424999999999997 6 23.62953692115144 33.99249061326658 18.222778473091363 24.155193992490613 7 22.325 15.825 37.375 24.474999999999998 8 22.575 19.05 26.825 31.55 9 21.6 19.400000000000002 29.575000000000003 29.425 10-14 25.35 24.005000000000003 23.435 27.21 15-19 25.845000000000002 22.71 23.5 27.944999999999997 20-24 26.085 23.445 23.1 27.37 25-29 26.279999999999998 23.485 23.01 27.224999999999998 30-34 26.119999999999997 23.77 22.814999999999998 27.295 35-39 25.629999999999995 23.855 23.26 27.255000000000003 40-44 26.284999999999997 23.735 23.175 26.805 45-49 26.640000000000004 23.56 22.55 27.250000000000004 50-54 26.625 23.474999999999998 22.75 27.150000000000002 55-59 27.075 22.845 22.975 27.105 60-64 26.955000000000002 22.37 23.69 26.985 65-69 26.705000000000002 23.64 23.165 26.490000000000002 70-74 27.084999999999997 22.985 23.51 26.419999999999998 75-79 26.39 23.605 22.84 27.165 80-84 26.745 23.44 22.96 26.855 85-89 27.455000000000002 22.895 22.900000000000002 26.75 90-94 26.845000000000002 23.330000000000002 22.875 26.950000000000003 95-99 26.724999999999998 22.84 23.62 26.815 100-104 27.384999999999998 23.025000000000002 23.09 26.5 105-109 26.85 23.27 23.195 26.685 110-114 26.790000000000003 23.200000000000003 22.89 27.12 115-119 27.415 23.72 22.375 26.490000000000002 120-124 27.615000000000002 23.02 22.78 26.584999999999997 125-129 27.36 23.86 22.23 26.55 130-134 27.32 23.849999999999998 22.125 26.705000000000002 135-139 27.205000000000002 24.2 22.09 26.505000000000003 140-144 27.935 24.65 21.365000000000002 26.05 145-149 27.41 24.07 21.915000000000003 26.605 150-151 26.55 25.924999999999997 20.95 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 2.0 29 2.5 30 5.0 31 7.5 32 9.0 33 14.0 34 13.0 35 17.5 36 32.5 37 42.0 38 55.5 39 64.0 40 73.0 41 96.5 42 117.0 43 136.0 44 142.0 45 143.0 46 165.0 47 168.0 48 148.0 49 136.5 50 130.5 51 123.5 52 125.0 53 115.0 54 105.5 55 105.0 56 89.0 57 98.0 58 110.0 59 114.5 60 112.0 61 105.0 62 108.5 63 99.0 64 94.0 65 91.5 66 80.5 67 74.5 68 72.0 69 74.0 70 72.0 71 57.5 72 45.5 73 49.5 74 46.5 75 31.0 76 23.5 77 17.0 78 9.5 79 9.0 80 9.5 81 4.5 82 2.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.425 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 8.3125 0.0 0.0 0.0 0.0 134-135 9.025 0.0 0.0 0.0 0.0 136-137 10.15 0.0 0.0 0.0 0.0 138-139 11.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14458926 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458926_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.348 32.0 32.0 32.0 32.0 32.0 2 31.17075 32.0 32.0 32.0 32.0 32.0 3 31.2005 32.0 32.0 32.0 32.0 32.0 4 31.187 32.0 32.0 32.0 32.0 32.0 5 31.2945 32.0 32.0 32.0 32.0 32.0 6 34.79275 36.0 36.0 36.0 32.0 36.0 7 34.85725 36.0 36.0 36.0 36.0 36.0 8 34.666 36.0 36.0 36.0 32.0 36.0 9 34.80625 36.0 36.0 36.0 32.0 36.0 10-14 34.8089 36.0 36.0 36.0 33.6 36.0 15-19 34.69565 36.0 36.0 36.0 32.0 36.0 20-24 34.69840000000001 36.0 36.0 36.0 32.0 36.0 25-29 34.7039 36.0 36.0 36.0 32.0 36.0 30-34 34.572449999999996 36.0 36.0 36.0 32.0 36.0 35-39 34.556 36.0 36.0 36.0 32.0 36.0 40-44 34.572199999999995 36.0 36.0 36.0 32.0 36.0 45-49 34.4707 36.0 36.0 36.0 32.0 36.0 50-54 34.50115 36.0 36.0 36.0 32.0 36.0 55-59 34.40845 36.0 36.0 36.0 32.0 36.0 60-64 34.26575 36.0 36.0 36.0 32.0 36.0 65-69 34.2432 36.0 36.0 36.0 32.0 36.0 70-74 34.17855 36.0 36.0 36.0 32.0 36.0 75-79 34.057100000000005 36.0 36.0 36.0 32.0 36.0 80-84 33.9495 36.0 36.0 36.0 31.0 36.0 85-89 33.787099999999995 36.0 36.0 36.0 29.0 36.0 90-94 33.72275 36.0 36.0 36.0 27.0 36.0 95-99 33.648700000000005 36.0 36.0 36.0 27.0 36.0 100-104 33.703599999999994 36.0 36.0 36.0 27.0 36.0 105-109 33.55825 36.0 36.0 36.0 27.0 36.0 110-114 33.470150000000004 36.0 36.0 36.0 27.0 36.0 115-119 33.380849999999995 36.0 35.2 36.0 27.0 36.0 120-124 33.3909 36.0 36.0 36.0 27.0 36.0 125-129 33.325649999999996 36.0 35.2 36.0 27.0 36.0 130-134 33.2534 36.0 34.4 36.0 27.0 36.0 135-139 32.89209999999999 36.0 32.0 36.0 25.8 36.0 140-144 32.98465 36.0 32.0 36.0 27.0 36.0 145-149 32.46945 36.0 32.0 36.0 23.4 36.0 150-151 30.0165 34.0 29.5 36.0 17.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 3.0 18 4.0 19 4.0 20 6.0 21 7.0 22 8.0 23 12.0 24 21.0 25 32.0 26 55.0 27 42.0 28 60.0 29 97.0 30 129.0 31 154.0 32 255.0 33 363.0 34 894.0 35 1850.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.5 10.475 12.575 52.449999999999996 2 25.4 16.85 35.025 22.725 3 23.325000000000003 21.325 23.674999999999997 31.674999999999997 4 28.475 27.05 16.2 28.275 5 30.75 28.125 20.474999999999998 20.65 6 23.400000000000002 32.45 19.0 25.15 7 22.45 16.35 37.15 24.05 8 22.75 18.675 25.5 33.074999999999996 9 23.175 20.125 28.349999999999998 28.349999999999998 10-14 25.95 24.02 22.805 27.224999999999998 15-19 25.45 23.845 23.215 27.49 20-24 26.195 23.61 23.119999999999997 27.075 25-29 25.869999999999997 24.104999999999997 22.57 27.455000000000002 30-34 25.905 23.525 23.25 27.32 35-39 26.36 23.5 23.255 26.884999999999998 40-44 26.185000000000002 23.815 22.695 27.305 45-49 26.915 23.225 22.61 27.250000000000004 50-54 26.400000000000002 23.445 22.955000000000002 27.200000000000003 55-59 26.005 23.265 22.96 27.77 60-64 26.145000000000003 22.975 23.49 27.389999999999997 65-69 26.38 23.599999999999998 22.61 27.41 70-74 26.985 22.93 23.285 26.8 75-79 26.31 23.419999999999998 23.05 27.22 80-84 26.615 23.77 22.535 27.08 85-89 26.945000000000004 23.52 22.689999999999998 26.845000000000002 90-94 26.76 22.955000000000002 23.225 27.060000000000002 95-99 26.674999999999997 23.494999999999997 22.814999999999998 27.015 100-104 26.955000000000002 23.189999999999998 22.955000000000002 26.900000000000002 105-109 27.35 23.025000000000002 23.185 26.44 110-114 27.565 23.61 22.35 26.474999999999998 115-119 27.36 23.044999999999998 22.62 26.974999999999998 120-124 27.544999999999998 23.375 22.79 26.290000000000003 125-129 28.134999999999998 23.865 22.28 25.72 130-134 28.395 23.72 22.12 25.765 135-139 28.349999999999998 24.005000000000003 22.415 25.230000000000004 140-144 29.37 24.39 21.265 24.975 145-149 29.659999999999997 23.955000000000002 21.88 24.505 150-151 29.475 24.3625 21.837500000000002 24.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.5 28 3.5 29 3.0 30 4.0 31 8.5 32 7.5 33 12.5 34 22.5 35 24.5 36 28.5 37 39.0 38 61.0 39 70.0 40 75.0 41 110.5 42 132.0 43 126.5 44 146.5 45 162.5 46 151.5 47 144.5 48 134.5 49 124.0 50 133.5 51 127.5 52 106.0 53 102.0 54 108.0 55 102.0 56 90.5 57 94.0 58 108.5 59 109.5 60 98.5 61 99.0 62 106.5 63 111.0 64 95.5 65 87.0 66 82.5 67 69.0 68 71.0 69 83.5 70 74.0 71 57.5 72 54.5 73 54.0 74 51.5 75 38.5 76 25.5 77 17.5 78 12.0 79 10.5 80 8.5 81 5.5 82 3.0 83 1.0 84 0.5 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.875 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.925000000000001 0.0 0.0 0.0 0.0 126-127 5.612500000000001 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 7.25 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 8.962499999999999 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 11.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003719 spots for SRR14458926.sra Written 1003719 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra Read 1003707 spots for SRR14458926.sra Written 1003707 spots for SRR14458926.sra SRR ids: ['SRR14458926.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lsz4ovol SRR14458926.sra spots: 20074152 blocks: [[1, 1003707], [1003708, 2007414], [2007415, 3011121], [3011122, 4014828], [4014829, 5018535], [5018536, 6022242], [6022243, 7025949], [7025950, 8029656], [8029657, 9033363], [9033364, 10037070], [10037071, 11040777], [11040778, 12044484], [12044485, 13048191], [13048192, 14051898], [14051899, 15055605], [15055606, 16059312], [16059313, 17063019], [17063020, 18066726], [18066727, 19070433], [19070434, 20074152]] SRR14458926 file size 6800374 SRR14458926 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458926 SRR14458926_1.fastq SRR14458926_2.fastq Input file: SRR14458926_1.fastq Paired file: SRR14458926_2.fastq trimmed: SRR14458926-trimmed-pair1.fastq, SRR14458926-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:15:28 2024 >> started Fri Dec 6 10:15:52 2024 >> done (23.198s) 20074152 read pairs processed; of these: 4216 ( 0.02%) short read pairs filtered out after trimming by size control 3436 ( 0.02%) empty read pairs filtered out after trimming by size control 20066500 (99.96%) read pairs available; of these: 3802486 (18.95%) trimmed read pairs available after processing 16264014 (81.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 194 0.00% 19 184 0.00% 20 210 0.00% 21 170 0.00% 22 207 0.00% 23 178 0.00% 24 178 0.00% 25 185 0.00% 26 192 0.00% 27 130 0.00% 28 151 0.00% 29 140 0.00% 30 132 0.00% 31 152 0.00% 32 165 0.00% 33 156 0.00% 34 383 0.00% 35 174 0.00% 36 150 0.00% 37 120 0.00% 38 142 0.00% 39 157 0.00% 40 122 0.00% 41 158 0.00% 42 128 0.00% 43 157 0.00% 44 139 0.00% 45 159 0.00% 46 127 0.00% 47 155 0.00% 48 162 0.00% 49 179 0.00% 50 199 0.00% 51 177 0.00% 52 183 0.00% 53 207 0.00% 54 193 0.00% 55 186 0.00% 56 189 0.00% 57 215 0.00% 58 244 0.00% 59 296 0.00% 60 326 0.00% 61 332 0.00% 62 353 0.00% 63 300 0.00% 64 318 0.00% 65 359 0.00% 66 344 0.00% 67 416 0.00% 68 427 0.00% 69 527 0.00% 70 565 0.00% 71 642 0.00% 72 662 0.00% 73 678 0.00% 74 709 0.00% 75 744 0.00% 76 805 0.00% 77 930 0.00% 78 1055 0.01% 79 1209 0.01% 80 1416 0.01% 81 1549 0.01% 82 1855 0.01% 83 2086 0.01% 84 2416 0.01% 85 2506 0.01% 86 2680 0.01% 87 2996 0.01% 88 3351 0.02% 89 3829 0.02% 90 4457 0.02% 91 5192 0.03% 92 5977 0.03% 93 6721 0.03% 94 7591 0.04% 95 8296 0.04% 96 8897 0.04% 97 9889 0.05% 98 10635 0.05% 99 12065 0.06% 100 13491 0.07% 101 15019 0.07% 102 17244 0.09% 103 19225 0.10% 104 21509 0.11% 105 22849 0.11% 106 24551 0.12% 107 26371 0.13% 108 28264 0.14% 109 29871 0.15% 110 32397 0.16% 111 35519 0.18% 112 39372 0.20% 113 43418 0.22% 114 45849 0.23% 115 49606 0.25% 116 52110 0.26% 117 53134 0.26% 118 55287 0.28% 119 57781 0.29% 120 60527 0.30% 121 64095 0.32% 122 69098 0.34% 123 72390 0.36% 124 77098 0.38% 125 80658 0.40% 126 82240 0.41% 127 84199 0.42% 128 84264 0.42% 129 85451 0.43% 130 87590 0.44% 131 90608 0.45% 132 94395 0.47% 133 98014 0.49% 134 100921 0.50% 135 103566 0.52% 136 105262 0.52% 137 105311 0.52% 138 105705 0.53% 139 106501 0.53% 140 106486 0.53% 141 107023 0.53% 142 109890 0.55% 143 112120 0.56% 144 112981 0.56% 145 114351 0.57% 146 114737 0.57% 147 115124 0.57% 148 117479 0.59% 149 114428 0.57% 150 113577 0.57% 151 16264014 81.05% 20066500 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=8 prefix-density=0.62 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=24.80 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=8 prefix-density=0.61 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=28.59 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR14458926 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:16:35 Started mapping on | Dec 06 10:16:35 Finished on | Dec 06 10:18:53 Mapping speed, Million of reads per hour | 523.47 Number of input reads | 20066500 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19014399 Uniquely mapped reads % | 94.76% Average mapped length | 292.14 Number of splices: Total | 19370707 Number of splices: Annotated (sjdb) | 18296467 Number of splices: GT/AG | 19106447 Number of splices: GC/AG | 225852 Number of splices: AT/AC | 7093 Number of splices: Non-canonical | 31315 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249523 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 34672 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 1.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802578 802578 802578 N_multimapping 249523 249523 249523 N_noFeature 531303 9576809 9627785 N_ambiguous 430176 47141 46960 UnstrandedReadsAssigned:18052920 PositiveStrandReadsAssigned:9390449 NegativeStrandReadsAssigned:9339654 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458926 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458926-trimmed-pair1.fastq SRR14458926-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,066,500 reads, 18,834,879 reads pseudoaligned [quant] estimated average fragment length: 234.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR14458926.ke.tsv 35125 SRR14458926.se.tsv 88098 total ==> SRR14458926.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.14 0 0 PNS24247 1044 810.669 27.4345 2.37555 PNS24249 1928 1694.67 130.702 5.4139 PNS24246 1044 810.669 27.4345 2.37555 PNS24248 1044 810.669 27.4345 2.37555 PNS24244 1471 1237.67 28.9941 1.64443 PNS24243 293 107.432 7 4.57378 KQK14069 1603 1369.67 10037.5 514.422 KQK14071 474 254.883 276.116 76.0434 ==> SRR14458926.se.tsv <== BRADI_1g14170v3 11016 BRADI_1g53295v3 52 BRADI_1g59795v3 293 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 1645 BRADI_1g74790v3 672 BRADI_1g09890v3 7 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR14458926 completed mapping pipeline successfully