Starting /dee2/code/volunteer_pipeline.sh SRR14458927 current disk space = 1551860228096 free memory = 1607290184 SRR14458927 SRAfilesize 69df52d55c6d7d48574219e005450911 SRR14458927.sra SRR14458927.sra file validated SRR14458927 is paired end SRR14458927 is conventional basespace SRR14458927 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458927_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2715 32.0 32.0 32.0 32.0 32.0 2 31.4225 32.0 32.0 32.0 32.0 32.0 3 31.53975 32.0 32.0 32.0 32.0 32.0 4 31.51425 32.0 32.0 32.0 32.0 32.0 5 31.5835 32.0 32.0 32.0 32.0 32.0 6 34.9815 36.0 36.0 36.0 36.0 36.0 7 35.18575 36.0 36.0 36.0 36.0 36.0 8 35.147 36.0 36.0 36.0 36.0 36.0 9 35.10825 36.0 36.0 36.0 36.0 36.0 10-14 35.1063 36.0 36.0 36.0 36.0 36.0 15-19 35.07415 36.0 36.0 36.0 36.0 36.0 20-24 35.0647 36.0 36.0 36.0 36.0 36.0 25-29 34.94245 36.0 36.0 36.0 35.2 36.0 30-34 34.8415 36.0 36.0 36.0 32.0 36.0 35-39 34.80285 36.0 36.0 36.0 32.0 36.0 40-44 34.78185 36.0 36.0 36.0 32.0 36.0 45-49 34.756150000000005 36.0 36.0 36.0 32.0 36.0 50-54 34.63255 36.0 36.0 36.0 32.0 36.0 55-59 34.620999999999995 36.0 36.0 36.0 32.0 36.0 60-64 34.479850000000006 36.0 36.0 36.0 32.0 36.0 65-69 34.57185 36.0 36.0 36.0 32.0 36.0 70-74 34.4649 36.0 36.0 36.0 32.0 36.0 75-79 34.24925 36.0 36.0 36.0 32.0 36.0 80-84 34.22735 36.0 36.0 36.0 32.0 36.0 85-89 34.1086 36.0 36.0 36.0 32.0 36.0 90-94 34.15965 36.0 36.0 36.0 32.0 36.0 95-99 33.899649999999994 36.0 36.0 36.0 30.0 36.0 100-104 33.8488 36.0 36.0 36.0 29.0 36.0 105-109 33.86935 36.0 36.0 36.0 30.0 36.0 110-114 33.69949999999999 36.0 36.0 36.0 27.0 36.0 115-119 33.6726 36.0 36.0 36.0 27.0 36.0 120-124 33.56945 36.0 36.0 36.0 27.0 36.0 125-129 33.53 36.0 36.0 36.0 27.0 36.0 130-134 33.476099999999995 36.0 36.0 36.0 27.0 36.0 135-139 33.4578 36.0 35.2 36.0 27.0 36.0 140-144 33.26365 36.0 34.4 36.0 27.0 36.0 145-149 33.05365 36.0 32.0 36.0 27.0 36.0 150-151 31.439124999999997 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 4.0 21 3.0 22 6.0 23 7.0 24 11.0 25 25.0 26 23.0 27 46.0 28 69.0 29 86.0 30 117.0 31 148.0 32 214.0 33 402.0 34 782.0 35 2057.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.400000000000002 11.924999999999999 13.525 52.15 2 23.849999999999998 17.775 34.875 23.5 3 23.3 21.7 24.55 30.45 4 26.450000000000003 27.500000000000004 18.075 27.975 5 27.025 30.275000000000002 20.375 22.325 6 24.123246492985974 31.988977955911825 19.789579158316634 24.09819639278557 7 21.55 15.1 36.175000000000004 27.175 8 20.5 20.175 26.375 32.95 9 22.35 18.375 30.7 28.575 10-14 24.855 23.945 22.99 28.21 15-19 25.869999999999997 23.345 22.905 27.88 20-24 25.385 23.73 23.580000000000002 27.305 25-29 25.755 23.755000000000003 23.26 27.229999999999997 30-34 26.045 23.255 23.27 27.43 35-39 25.624999999999996 23.52 23.61 27.245 40-44 26.090000000000003 23.630000000000003 22.655 27.625 45-49 26.085 22.89 23.365 27.66 50-54 26.450000000000003 23.150000000000002 23.21 27.189999999999998 55-59 26.669999999999998 22.93 23.435 26.965 60-64 26.375 23.0 23.26 27.365000000000002 65-69 26.52 23.285 23.505000000000003 26.69 70-74 27.24 23.25 22.68 26.83 75-79 27.42 23.57 22.345000000000002 26.665 80-84 26.919999999999998 23.1 23.04 26.939999999999998 85-89 27.125 22.939999999999998 22.79 27.145000000000003 90-94 27.185 22.755 23.155 26.905 95-99 26.840000000000003 23.494999999999997 23.125 26.540000000000003 100-104 26.99 23.01 22.445 27.555000000000003 105-109 27.355 23.119999999999997 22.63 26.895000000000003 110-114 27.51 23.805 22.305 26.38 115-119 27.57 23.380000000000003 22.3 26.75 120-124 27.675 24.125 21.54 26.66 125-129 27.965 23.425 21.685 26.924999999999997 130-134 27.584999999999997 24.310000000000002 21.9 26.205000000000002 135-139 27.215 23.835 22.36 26.590000000000003 140-144 27.32 24.54 21.58 26.56 145-149 27.345000000000002 24.57 21.38 26.705000000000002 150-151 26.0 24.55 22.125 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.5 29 3.5 30 5.5 31 9.5 32 8.5 33 9.0 34 14.0 35 24.0 36 34.5 37 42.5 38 50.5 39 63.5 40 81.5 41 98.0 42 113.5 43 132.0 44 146.5 45 147.0 46 150.5 47 162.0 48 159.0 49 143.0 50 138.5 51 133.5 52 134.0 53 127.0 54 112.5 55 101.0 56 87.5 57 95.0 58 96.0 59 92.0 60 93.5 61 94.5 62 90.0 63 85.5 64 97.0 65 94.0 66 78.5 67 82.0 68 80.0 69 64.5 70 61.5 71 62.0 72 54.5 73 56.5 74 52.0 75 36.5 76 27.5 77 21.5 78 15.5 79 8.0 80 8.0 81 7.5 82 3.5 83 2.0 84 1.0 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36995967741935 98.575 2 0.5292338709677419 1.05 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.5875000000000004 0.0 0.0 0.0 0.0 116-117 2.9625000000000004 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.8875 0.0 0.0 0.0 0.0 124-125 5.5 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.637499999999999 0.0 0.0 0.0 0.0 132-133 8.525 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 10.274999999999999 0.0 0.0 0.0 0.0 138-139 11.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGC 10 0.006830828 145.0 2 GGCTCCA 10 0.006830828 145.0 6 GCTCCAC 15 1.1411342E-4 145.0 7 >>END_MODULE SRR14458927 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458927_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.419 32.0 32.0 32.0 32.0 32.0 2 31.17225 32.0 32.0 32.0 32.0 32.0 3 31.13075 32.0 32.0 32.0 32.0 32.0 4 31.20125 32.0 32.0 32.0 32.0 32.0 5 31.1965 32.0 32.0 32.0 32.0 32.0 6 34.6575 36.0 36.0 36.0 32.0 36.0 7 34.75925 36.0 36.0 36.0 32.0 36.0 8 34.8085 36.0 36.0 36.0 32.0 36.0 9 34.71125 36.0 36.0 36.0 32.0 36.0 10-14 34.692750000000004 36.0 36.0 36.0 32.0 36.0 15-19 34.687200000000004 36.0 36.0 36.0 32.0 36.0 20-24 34.61749999999999 36.0 36.0 36.0 32.0 36.0 25-29 34.621050000000004 36.0 36.0 36.0 32.0 36.0 30-34 34.59310000000001 36.0 36.0 36.0 32.0 36.0 35-39 34.536249999999995 36.0 36.0 36.0 32.0 36.0 40-44 34.5798 36.0 36.0 36.0 32.0 36.0 45-49 34.489250000000006 36.0 36.0 36.0 32.0 36.0 50-54 34.42399999999999 36.0 36.0 36.0 32.0 36.0 55-59 34.307449999999996 36.0 36.0 36.0 32.0 36.0 60-64 34.368100000000005 36.0 36.0 36.0 32.0 36.0 65-69 34.2117 36.0 36.0 36.0 32.0 36.0 70-74 34.1717 36.0 36.0 36.0 32.0 36.0 75-79 34.01155000000001 36.0 36.0 36.0 32.0 36.0 80-84 33.8756 36.0 36.0 36.0 31.0 36.0 85-89 33.6359 36.0 36.0 36.0 28.0 36.0 90-94 33.68845 36.0 36.0 36.0 27.0 36.0 95-99 33.604499999999994 36.0 36.0 36.0 27.0 36.0 100-104 33.65390000000001 36.0 36.0 36.0 27.0 36.0 105-109 33.588100000000004 36.0 36.0 36.0 27.0 36.0 110-114 33.331 36.0 36.0 36.0 27.0 36.0 115-119 33.2703 36.0 33.6 36.0 27.0 36.0 120-124 33.24005 36.0 32.8 36.0 27.0 36.0 125-129 33.20255 36.0 33.6 36.0 27.0 36.0 130-134 33.14614999999999 36.0 32.8 36.0 27.0 36.0 135-139 32.81115 36.0 32.0 36.0 24.6 36.0 140-144 32.84495 36.0 32.0 36.0 25.8 36.0 145-149 32.339749999999995 36.0 32.0 36.0 18.0 36.0 150-151 30.055374999999998 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 1.0 19 3.0 20 4.0 21 5.0 22 11.0 23 12.0 24 21.0 25 35.0 26 44.0 27 49.0 28 81.0 29 104.0 30 143.0 31 172.0 32 259.0 33 416.0 34 861.0 35 1776.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.65 10.975 11.725 53.65 2 24.05 16.325 36.25 23.375 3 23.3 20.95 24.9 30.85 4 28.749999999999996 25.874999999999996 17.724999999999998 27.650000000000002 5 29.549999999999997 29.099999999999998 18.975 22.375 6 22.925 32.2 19.025 25.85 7 20.9 17.025000000000002 37.125 24.95 8 23.200000000000003 19.875 26.1 30.825000000000003 9 23.7 18.375 27.825 30.099999999999998 10-14 25.230000000000004 24.325 22.875 27.57 15-19 25.755 23.505000000000003 23.095 27.644999999999996 20-24 25.995 23.705000000000002 22.95 27.35 25-29 25.729999999999997 23.645 22.82 27.805000000000003 30-34 25.77 23.74 23.35 27.139999999999997 35-39 25.635 23.71 23.285 27.37 40-44 25.995 23.64 22.900000000000002 27.465 45-49 25.865 23.825 23.115 27.195000000000004 50-54 25.71 23.400000000000002 23.055 27.834999999999997 55-59 25.845000000000002 23.575 22.865 27.715 60-64 25.740000000000002 24.085 23.095 27.08 65-69 26.245 23.5 22.919999999999998 27.334999999999997 70-74 26.455000000000002 22.8 23.335 27.41 75-79 26.640000000000004 23.175 23.34 26.845000000000002 80-84 27.165 23.080000000000002 22.685 27.07 85-89 26.790000000000003 23.200000000000003 23.14 26.87 90-94 26.479999999999997 23.400000000000002 23.31 26.810000000000002 95-99 26.44 23.849999999999998 22.62 27.089999999999996 100-104 26.484999999999996 23.36 23.080000000000002 27.075 105-109 27.284999999999997 23.395 22.705000000000002 26.615 110-114 26.995 23.69 22.935 26.38 115-119 27.315 23.86 21.959999999999997 26.865 120-124 27.560000000000002 23.565 22.634999999999998 26.240000000000002 125-129 27.63 23.69 22.6 26.08 130-134 28.57 23.47 22.335 25.624999999999996 135-139 28.815 24.205 21.895 25.085 140-144 29.304999999999996 24.55 21.560000000000002 24.585 145-149 29.425 24.185000000000002 22.0 24.39 150-151 29.0875 24.9875 21.975 23.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 1.0 28 1.5 29 2.5 30 4.0 31 4.5 32 9.5 33 12.0 34 14.5 35 20.0 36 29.0 37 48.0 38 60.5 39 63.5 40 81.0 41 101.0 42 108.5 43 124.0 44 147.0 45 162.5 46 163.5 47 166.5 48 159.0 49 142.0 50 142.0 51 142.0 52 125.0 53 103.0 54 101.0 55 110.0 56 96.0 57 94.0 58 106.0 59 102.5 60 95.0 61 89.5 62 89.5 63 88.0 64 87.5 65 78.0 66 72.5 67 77.5 68 75.0 69 68.0 70 68.0 71 73.0 72 65.0 73 52.0 74 45.0 75 34.0 76 27.0 77 18.0 78 11.0 79 11.5 80 7.5 81 7.5 82 6.0 83 1.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.1 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 4.2375 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.5125 0.0 0.0 0.0 0.0 126-127 6.0875 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.6625 0.0 0.0 0.0 0.0 132-133 8.575 0.0 0.0 0.0 0.0 134-135 9.4375 0.0 0.0 0.025 0.0 136-137 10.350000000000001 0.0 0.0 0.025 0.0 138-139 11.2625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCCC 10 0.006830828 145.0 8 >>END_MODULE Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986994 spots for SRR14458927.sra Written 986994 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra Read 986976 spots for SRR14458927.sra Written 986976 spots for SRR14458927.sra SRR ids: ['SRR14458927.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gj55yxau SRR14458927.sra spots: 19739538 blocks: [[1, 986976], [986977, 1973952], [1973953, 2960928], [2960929, 3947904], [3947905, 4934880], [4934881, 5921856], [5921857, 6908832], [6908833, 7895808], [7895809, 8882784], [8882785, 9869760], [9869761, 10856736], [10856737, 11843712], [11843713, 12830688], [12830689, 13817664], [13817665, 14804640], [14804641, 15791616], [15791617, 16778592], [16778593, 17765568], [17765569, 18752544], [18752545, 19739538]] SRR14458927 file size 6686658 SRR14458927 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458927 SRR14458927_1.fastq SRR14458927_2.fastq Input file: SRR14458927_1.fastq Paired file: SRR14458927_2.fastq trimmed: SRR14458927-trimmed-pair1.fastq, SRR14458927-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:14:28 2024 >> started Fri Dec 6 10:14:52 2024 >> done (23.738s) 19739538 read pairs processed; of these: 4445 ( 0.02%) short read pairs filtered out after trimming by size control 2095 ( 0.01%) empty read pairs filtered out after trimming by size control 19732998 (99.97%) read pairs available; of these: 3637166 (18.43%) trimmed read pairs available after processing 16095832 (81.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 224 0.00% 19 205 0.00% 20 186 0.00% 21 184 0.00% 22 190 0.00% 23 184 0.00% 24 232 0.00% 25 148 0.00% 26 169 0.00% 27 168 0.00% 28 147 0.00% 29 180 0.00% 30 154 0.00% 31 123 0.00% 32 147 0.00% 33 153 0.00% 34 360 0.00% 35 169 0.00% 36 162 0.00% 37 117 0.00% 38 144 0.00% 39 148 0.00% 40 120 0.00% 41 157 0.00% 42 155 0.00% 43 140 0.00% 44 118 0.00% 45 150 0.00% 46 140 0.00% 47 157 0.00% 48 171 0.00% 49 168 0.00% 50 172 0.00% 51 177 0.00% 52 167 0.00% 53 206 0.00% 54 193 0.00% 55 181 0.00% 56 208 0.00% 57 197 0.00% 58 256 0.00% 59 236 0.00% 60 279 0.00% 61 267 0.00% 62 296 0.00% 63 281 0.00% 64 277 0.00% 65 316 0.00% 66 335 0.00% 67 344 0.00% 68 378 0.00% 69 440 0.00% 70 510 0.00% 71 564 0.00% 72 590 0.00% 73 611 0.00% 74 675 0.00% 75 673 0.00% 76 778 0.00% 77 883 0.00% 78 1011 0.01% 79 1165 0.01% 80 1362 0.01% 81 1597 0.01% 82 1900 0.01% 83 2125 0.01% 84 2247 0.01% 85 2429 0.01% 86 2745 0.01% 87 2927 0.01% 88 3369 0.02% 89 3780 0.02% 90 4463 0.02% 91 5274 0.03% 92 5999 0.03% 93 7029 0.04% 94 7803 0.04% 95 8593 0.04% 96 9156 0.05% 97 10356 0.05% 98 11044 0.06% 99 12389 0.06% 100 14171 0.07% 101 15827 0.08% 102 17800 0.09% 103 19748 0.10% 104 21853 0.11% 105 23673 0.12% 106 25597 0.13% 107 26731 0.14% 108 28617 0.15% 109 31276 0.16% 110 33122 0.17% 111 36076 0.18% 112 40221 0.20% 113 43148 0.22% 114 46591 0.24% 115 49768 0.25% 116 50978 0.26% 117 52934 0.27% 118 54504 0.28% 119 56992 0.29% 120 58605 0.30% 121 63132 0.32% 122 66495 0.34% 123 69650 0.35% 124 74450 0.38% 125 76893 0.39% 126 78405 0.40% 127 79485 0.40% 128 80550 0.41% 129 81317 0.41% 130 83348 0.42% 131 85901 0.44% 132 88532 0.45% 133 92180 0.47% 134 95520 0.48% 135 96432 0.49% 136 98623 0.50% 137 99373 0.50% 138 98568 0.50% 139 99655 0.51% 140 99998 0.51% 141 99628 0.50% 142 102387 0.52% 143 103689 0.53% 144 105829 0.54% 145 107253 0.54% 146 106917 0.54% 147 107661 0.55% 148 108449 0.55% 149 107175 0.54% 150 106816 0.54% 151 16095832 81.57% 19732998 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=10 prefix-density=0.52 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=21.07 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.39 fanout-score-rank=8 prefix-density=0.51 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=30.44 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC SRR14458927 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:15:38 Started mapping on | Dec 06 10:15:40 Finished on | Dec 06 10:17:50 Mapping speed, Million of reads per hour | 546.45 Number of input reads | 19732998 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18682154 Uniquely mapped reads % | 94.67% Average mapped length | 292.19 Number of splices: Total | 19114329 Number of splices: Annotated (sjdb) | 18047424 Number of splices: GT/AG | 18857388 Number of splices: GC/AG | 218971 Number of splices: AT/AC | 8088 Number of splices: Non-canonical | 29882 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262107 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 35911 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 1.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 788737 788737 788737 N_multimapping 262107 262107 262107 N_noFeature 527639 9417974 9467923 N_ambiguous 411573 46162 46312 UnstrandedReadsAssigned:17742942 PositiveStrandReadsAssigned:9218018 NegativeStrandReadsAssigned:9167919 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458927 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458927-trimmed-pair1.fastq SRR14458927-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,732,998 reads, 18,494,212 reads pseudoaligned [quant] estimated average fragment length: 238.181 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52973 SRR14458927.ke.tsv 35125 SRR14458927.se.tsv 88098 total ==> SRR14458927.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.085 0 0 PNS24247 1044 806.819 26.0162 2.31988 PNS24249 1928 1690.82 145.293 6.18224 PNS24246 1044 806.819 26.0162 2.31988 PNS24248 1044 806.819 26.0162 2.31988 PNS24244 1471 1233.82 18.6581 1.08796 PNS24243 293 106.134 8 5.42291 KQK14069 1603 1365.82 4678.94 246.463 KQK14071 474 251.886 139.081 39.7248 ==> SRR14458927.se.tsv <== BRADI_1g14170v3 5166 BRADI_1g53295v3 55 BRADI_1g59795v3 278 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 2412 BRADI_1g74790v3 648 BRADI_1g09890v3 7 BRADI_1g77505v3 382 BRADI_1g48960v3 1 SRR14458927 completed mapping pipeline successfully