Starting /dee2/code/volunteer_pipeline.sh SRR14458928 current disk space = 1551842820096 free memory = 1607291196 SRR14458928 SRAfilesize 7b749708bc56b0f9eaffdb16ef33944c SRR14458928.sra SRR14458928.sra file validated SRR14458928 is paired end SRR14458928 is conventional basespace SRR14458928 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458928_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3025 32.0 32.0 32.0 32.0 32.0 2 31.48725 32.0 32.0 32.0 32.0 32.0 3 31.49875 32.0 32.0 32.0 32.0 32.0 4 31.64475 32.0 32.0 32.0 32.0 32.0 5 31.638 32.0 32.0 32.0 32.0 32.0 6 34.9735 36.0 36.0 36.0 36.0 36.0 7 35.131 36.0 36.0 36.0 36.0 36.0 8 35.1445 36.0 36.0 36.0 36.0 36.0 9 35.194 36.0 36.0 36.0 36.0 36.0 10-14 35.10895 36.0 36.0 36.0 36.0 36.0 15-19 35.097249999999995 36.0 36.0 36.0 36.0 36.0 20-24 35.04535 36.0 36.0 36.0 36.0 36.0 25-29 34.984899999999996 36.0 36.0 36.0 36.0 36.0 30-34 34.914750000000005 36.0 36.0 36.0 33.6 36.0 35-39 34.855 36.0 36.0 36.0 32.0 36.0 40-44 34.783699999999996 36.0 36.0 36.0 32.0 36.0 45-49 34.75855 36.0 36.0 36.0 32.0 36.0 50-54 34.6809 36.0 36.0 36.0 32.0 36.0 55-59 34.71495 36.0 36.0 36.0 32.0 36.0 60-64 34.492149999999995 36.0 36.0 36.0 32.0 36.0 65-69 34.588800000000006 36.0 36.0 36.0 32.0 36.0 70-74 34.45875000000001 36.0 36.0 36.0 32.0 36.0 75-79 34.29605 36.0 36.0 36.0 32.0 36.0 80-84 34.2706 36.0 36.0 36.0 32.0 36.0 85-89 34.0529 36.0 36.0 36.0 31.0 36.0 90-94 34.10295 36.0 36.0 36.0 32.0 36.0 95-99 33.9711 36.0 36.0 36.0 31.0 36.0 100-104 33.8993 36.0 36.0 36.0 30.0 36.0 105-109 33.87415 36.0 36.0 36.0 29.0 36.0 110-114 33.76655 36.0 36.0 36.0 27.0 36.0 115-119 33.645799999999994 36.0 36.0 36.0 27.0 36.0 120-124 33.639500000000005 36.0 36.0 36.0 27.0 36.0 125-129 33.479949999999995 36.0 36.0 36.0 27.0 36.0 130-134 33.45775 36.0 36.0 36.0 27.0 36.0 135-139 33.419200000000004 36.0 35.2 36.0 27.0 36.0 140-144 33.34245 36.0 34.4 36.0 27.0 36.0 145-149 33.2149 36.0 32.8 36.0 27.0 36.0 150-151 31.46175 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 2.0 21 0.0 22 4.0 23 8.0 24 13.0 25 14.0 26 34.0 27 39.0 28 63.0 29 95.0 30 116.0 31 152.0 32 244.0 33 325.0 34 804.0 35 2084.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.45 11.4 11.924999999999999 54.225 2 21.95 18.125 37.85 22.075 3 23.425 21.725 25.55 29.299999999999997 4 26.474999999999998 28.125 16.725 28.675 5 27.224999999999998 30.95 20.1 21.725 6 22.216649949849547 32.64794383149449 20.21063189568706 24.924774322968908 7 20.849999999999998 15.625 38.224999999999994 25.3 8 21.349999999999998 19.15 26.224999999999998 33.275 9 22.575 19.025 28.775000000000002 29.625 10-14 24.995 24.315 22.97 27.72 15-19 25.590000000000003 23.04 23.44 27.93 20-24 25.25 24.09 23.165 27.495000000000005 25-29 25.25 24.104999999999997 23.46 27.185 30-34 25.39 23.35 24.2 27.060000000000002 35-39 25.715 23.330000000000002 23.494999999999997 27.46 40-44 25.905 23.365 23.385 27.345000000000002 45-49 25.900000000000002 23.915 22.695 27.49 50-54 26.575 23.14 23.165 27.12 55-59 26.58 23.105 23.32 26.995 60-64 26.32 22.685 23.365 27.63 65-69 26.529999999999998 23.705000000000002 22.835 26.93 70-74 26.755000000000003 23.04 22.725 27.48 75-79 25.945 23.125 22.71 28.22 80-84 26.674999999999997 22.985 22.919999999999998 27.42 85-89 27.54 22.585 23.14 26.735 90-94 26.775 22.900000000000002 22.98 27.345000000000002 95-99 26.669999999999998 22.88 23.11 27.339999999999996 100-104 27.284999999999997 23.07 22.55 27.095000000000002 105-109 26.655 23.055 23.330000000000002 26.96 110-114 27.055 22.900000000000002 22.895 27.150000000000002 115-119 27.075 23.305 22.31 27.310000000000002 120-124 27.55 23.215 22.495 26.740000000000002 125-129 27.215 24.325 21.93 26.529999999999998 130-134 27.46 24.26 21.62 26.66 135-139 27.91 23.61 22.165000000000003 26.314999999999998 140-144 27.644999999999996 23.865 21.775 26.715 145-149 26.865 23.974999999999998 22.264999999999997 26.895000000000003 150-151 27.3125 24.3875 21.0 27.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.5 28 2.0 29 2.5 30 3.0 31 4.0 32 6.5 33 9.5 34 17.5 35 24.5 36 31.0 37 49.0 38 54.5 39 69.5 40 91.5 41 108.5 42 124.0 43 134.5 44 144.5 45 148.5 46 158.0 47 154.5 48 145.0 49 125.0 50 117.5 51 129.0 52 129.5 53 115.5 54 102.5 55 104.5 56 108.0 57 116.0 58 117.0 59 99.5 60 95.0 61 91.0 62 87.0 63 85.0 64 79.0 65 82.5 66 80.5 67 79.0 68 80.0 69 81.5 70 75.0 71 67.0 72 61.0 73 48.0 74 40.0 75 34.0 76 19.5 77 17.5 78 18.0 79 12.5 80 8.5 81 4.0 82 2.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.3 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.45294413688978363 0.8999999999999999 3 0.10065425264217413 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 6.175000000000001 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.4625 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGA 10 0.006830828 145.0 8 TCGTCTC 10 0.006830828 145.0 2 GAGAGAG 10 0.006830828 145.0 9 CTCGTCT 10 0.006830828 145.0 1 >>END_MODULE SRR14458928 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458928_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4655 32.0 32.0 32.0 32.0 32.0 2 31.15725 32.0 32.0 32.0 32.0 32.0 3 31.16775 32.0 32.0 32.0 32.0 32.0 4 31.25925 32.0 32.0 32.0 32.0 32.0 5 31.304 32.0 32.0 32.0 32.0 32.0 6 34.78625 36.0 36.0 36.0 32.0 36.0 7 34.872 36.0 36.0 36.0 32.0 36.0 8 34.78575 36.0 36.0 36.0 32.0 36.0 9 34.86375 36.0 36.0 36.0 32.0 36.0 10-14 34.81965 36.0 36.0 36.0 32.0 36.0 15-19 34.76475 36.0 36.0 36.0 32.0 36.0 20-24 34.6849 36.0 36.0 36.0 32.0 36.0 25-29 34.7237 36.0 36.0 36.0 32.0 36.0 30-34 34.63835 36.0 36.0 36.0 32.0 36.0 35-39 34.56075 36.0 36.0 36.0 32.0 36.0 40-44 34.554500000000004 36.0 36.0 36.0 32.0 36.0 45-49 34.53945 36.0 36.0 36.0 32.0 36.0 50-54 34.5052 36.0 36.0 36.0 32.0 36.0 55-59 34.36954999999999 36.0 36.0 36.0 32.0 36.0 60-64 34.40125 36.0 36.0 36.0 32.0 36.0 65-69 34.25789999999999 36.0 36.0 36.0 32.0 36.0 70-74 34.24235 36.0 36.0 36.0 32.0 36.0 75-79 34.030950000000004 36.0 36.0 36.0 32.0 36.0 80-84 33.8926 36.0 36.0 36.0 32.0 36.0 85-89 33.69615 36.0 36.0 36.0 28.0 36.0 90-94 33.67785 36.0 36.0 36.0 27.0 36.0 95-99 33.61135 36.0 36.0 36.0 27.0 36.0 100-104 33.605149999999995 36.0 36.0 36.0 27.0 36.0 105-109 33.5964 36.0 36.0 36.0 27.0 36.0 110-114 33.36785 36.0 35.2 36.0 27.0 36.0 115-119 33.3836 36.0 35.2 36.0 27.0 36.0 120-124 33.31595 36.0 35.2 36.0 27.0 36.0 125-129 33.1535 36.0 33.6 36.0 27.0 36.0 130-134 33.226 36.0 33.6 36.0 27.0 36.0 135-139 32.8709 36.0 32.0 36.0 25.8 36.0 140-144 32.8815 36.0 32.0 36.0 24.4 36.0 145-149 32.4053 36.0 32.0 36.0 20.8 36.0 150-151 30.042749999999998 34.0 29.5 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 3.0 19 5.0 20 3.0 21 6.0 22 14.0 23 12.0 24 22.0 25 27.0 26 40.0 27 60.0 28 72.0 29 85.0 30 138.0 31 160.0 32 248.0 33 409.0 34 871.0 35 1821.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.53063265816454 11.977994498624655 12.003000750187546 53.48837209302325 2 24.25 17.825 35.175 22.75 3 24.075 21.55 23.9 30.475 4 28.825 26.525 17.575 27.075 5 29.45 28.349999999999998 20.125 22.075 6 23.674999999999997 33.0 19.25 24.075 7 20.7 16.5 38.725 24.075 8 21.675 19.925 26.650000000000002 31.75 9 23.3 18.275 30.025000000000002 28.4 10-14 24.495 24.875 22.42 28.21 15-19 25.64 22.915 23.45 27.994999999999997 20-24 25.655 23.605 23.285 27.455000000000002 25-29 25.88 23.43 23.115 27.575 30-34 25.585 23.369999999999997 23.380000000000003 27.665 35-39 26.305 23.54 23.075000000000003 27.08 40-44 26.365 23.45 22.935 27.250000000000004 45-49 25.729999999999997 23.265 23.14 27.865000000000002 50-54 25.845000000000002 23.745 23.185 27.224999999999998 55-59 26.029999999999998 22.975 23.485 27.51 60-64 25.740000000000002 23.0 23.36 27.900000000000002 65-69 26.790000000000003 22.785 23.485 26.939999999999998 70-74 26.284999999999997 22.965 23.28 27.47 75-79 26.375 22.775000000000002 23.150000000000002 27.700000000000003 80-84 26.43 23.31 23.145 27.115000000000002 85-89 26.515 22.735 23.13 27.62 90-94 26.63 23.44 22.735 27.195000000000004 95-99 26.540000000000003 22.98 22.685 27.794999999999998 100-104 26.895000000000003 23.54 22.255 27.310000000000002 105-109 26.974999999999998 22.575 23.25 27.200000000000003 110-114 26.82 23.615 22.29 27.275 115-119 27.384999999999998 23.494999999999997 22.505 26.615 120-124 27.339999999999996 23.02 22.825 26.815 125-129 27.529999999999998 23.68 22.16 26.63 130-134 28.42 23.94 21.435000000000002 26.205000000000002 135-139 28.95 23.34 22.52 25.19 140-144 29.744999999999997 23.66 21.705 24.89 145-149 29.445 23.515 22.235 24.805 150-151 28.3125 25.0625 22.1 24.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 4.0 29 5.5 30 4.0 31 6.0 32 10.0 33 12.0 34 15.5 35 22.5 36 37.5 37 50.5 38 63.5 39 72.5 40 80.5 41 97.0 42 120.0 43 137.5 44 144.0 45 146.5 46 150.5 47 152.0 48 149.0 49 139.5 50 128.5 51 121.5 52 122.0 53 124.0 54 108.5 55 96.0 56 90.0 57 91.0 58 95.5 59 98.5 60 95.5 61 95.0 62 94.0 63 84.5 64 93.5 65 89.5 66 80.0 67 78.5 68 68.5 69 71.5 70 75.5 71 70.0 72 56.5 73 53.5 74 48.5 75 37.5 76 30.0 77 20.5 78 13.0 79 10.5 80 11.5 81 10.0 82 5.5 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.425000000000001 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.862500000000001 0.0 0.0 0.0 0.0 134-135 7.487500000000001 0.0 0.0 0.0 0.0 136-137 8.3375 0.0 0.0 0.0 0.0 138-139 9.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAGG 10 0.006830828 145.0 2 >>END_MODULE Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869391 spots for SRR14458928.sra Written 869391 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra Read 869390 spots for SRR14458928.sra Written 869390 spots for SRR14458928.sra SRR ids: ['SRR14458928.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwtqscuq SRR14458928.sra spots: 17387801 blocks: [[1, 869390], [869391, 1738780], [1738781, 2608170], [2608171, 3477560], [3477561, 4346950], [4346951, 5216340], [5216341, 6085730], [6085731, 6955120], [6955121, 7824510], [7824511, 8693900], [8693901, 9563290], [9563291, 10432680], [10432681, 11302070], [11302071, 12171460], [12171461, 13040850], [13040851, 13910240], [13910241, 14779630], [14779631, 15649020], [15649021, 16518410], [16518411, 17387801]] SRR14458928 file size 5887435 SRR14458928 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458928 SRR14458928_1.fastq SRR14458928_2.fastq Input file: SRR14458928_1.fastq Paired file: SRR14458928_2.fastq trimmed: SRR14458928-trimmed-pair1.fastq, SRR14458928-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:15:32 2024 >> started Fri Dec 6 10:15:53 2024 >> done (20.796s) 17387801 read pairs processed; of these: 4919 ( 0.03%) short read pairs filtered out after trimming by size control 2868 ( 0.02%) empty read pairs filtered out after trimming by size control 17380014 (99.96%) read pairs available; of these: 2726905 (15.69%) trimmed read pairs available after processing 14653109 (84.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 265 0.00% 19 241 0.00% 20 228 0.00% 21 244 0.00% 22 233 0.00% 23 198 0.00% 24 216 0.00% 25 181 0.00% 26 179 0.00% 27 179 0.00% 28 156 0.00% 29 192 0.00% 30 163 0.00% 31 157 0.00% 32 180 0.00% 33 144 0.00% 34 419 0.00% 35 140 0.00% 36 156 0.00% 37 137 0.00% 38 144 0.00% 39 139 0.00% 40 136 0.00% 41 165 0.00% 42 146 0.00% 43 158 0.00% 44 131 0.00% 45 137 0.00% 46 151 0.00% 47 167 0.00% 48 178 0.00% 49 201 0.00% 50 160 0.00% 51 164 0.00% 52 147 0.00% 53 202 0.00% 54 206 0.00% 55 161 0.00% 56 195 0.00% 57 178 0.00% 58 212 0.00% 59 216 0.00% 60 286 0.00% 61 262 0.00% 62 252 0.00% 63 249 0.00% 64 275 0.00% 65 279 0.00% 66 290 0.00% 67 336 0.00% 68 368 0.00% 69 397 0.00% 70 466 0.00% 71 527 0.00% 72 554 0.00% 73 573 0.00% 74 561 0.00% 75 617 0.00% 76 656 0.00% 77 691 0.00% 78 808 0.00% 79 893 0.01% 80 1056 0.01% 81 1195 0.01% 82 1396 0.01% 83 1613 0.01% 84 1712 0.01% 85 1861 0.01% 86 2010 0.01% 87 2185 0.01% 88 2383 0.01% 89 2806 0.02% 90 3121 0.02% 91 3676 0.02% 92 4357 0.03% 93 5022 0.03% 94 5619 0.03% 95 6047 0.03% 96 6698 0.04% 97 7074 0.04% 98 7665 0.04% 99 8368 0.05% 100 9682 0.06% 101 10941 0.06% 102 12466 0.07% 103 13841 0.08% 104 15291 0.09% 105 16691 0.10% 106 18030 0.10% 107 18810 0.11% 108 19967 0.11% 109 21545 0.12% 110 23167 0.13% 111 25212 0.15% 112 28376 0.16% 113 30944 0.18% 114 33334 0.19% 115 35732 0.21% 116 36742 0.21% 117 38084 0.22% 118 39921 0.23% 119 40936 0.24% 120 42721 0.25% 121 45660 0.26% 122 48610 0.28% 123 51474 0.30% 124 54779 0.32% 125 57889 0.33% 126 58624 0.34% 127 59984 0.35% 128 60749 0.35% 129 60943 0.35% 130 61893 0.36% 131 63738 0.37% 132 66368 0.38% 133 69342 0.40% 134 72654 0.42% 135 74277 0.43% 136 75419 0.43% 137 76053 0.44% 138 75931 0.44% 139 76117 0.44% 140 75873 0.44% 141 75634 0.44% 142 78272 0.45% 143 79560 0.46% 144 81464 0.47% 145 82668 0.48% 146 83046 0.48% 147 83917 0.48% 148 85433 0.49% 149 82674 0.48% 150 82521 0.47% 151 14653109 84.31% 17380014 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=6 prefix-density=0.56 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=24.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=6 prefix-density=0.57 prefix-fanout=3.3 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=25.64 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458928 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:16:33 Started mapping on | Dec 06 10:16:34 Finished on | Dec 06 10:19:00 Mapping speed, Million of reads per hour | 428.55 Number of input reads | 17380014 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16395457 Uniquely mapped reads % | 94.34% Average mapped length | 293.28 Number of splices: Total | 16701665 Number of splices: Annotated (sjdb) | 15739765 Number of splices: GT/AG | 16471686 Number of splices: GC/AG | 193965 Number of splices: AT/AC | 7035 Number of splices: Non-canonical | 28979 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236265 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 35349 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 1.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748292 748292 748292 N_multimapping 236265 236265 236265 N_noFeature 484793 8289185 8304621 N_ambiguous 371249 45039 44267 UnstrandedReadsAssigned:15539415 PositiveStrandReadsAssigned:8061233 NegativeStrandReadsAssigned:8046569 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458928 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458928-trimmed-pair1.fastq SRR14458928-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,380,014 reads, 16,234,230 reads pseudoaligned [quant] estimated average fragment length: 252.023 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR14458928.ke.tsv 35125 SRR14458928.se.tsv 88098 total ==> SRR14458928.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.418 0 0 PNS24247 1044 792.977 26.6787 2.72079 PNS24249 1928 1676.98 109.48 5.27958 PNS24246 1044 792.977 26.6787 2.72079 PNS24248 1044 792.977 26.6787 2.72079 PNS24244 1471 1219.98 28.4841 1.88818 PNS24243 293 103.235 1 0.783364 KQK14069 1603 1351.98 6478.67 387.533 KQK14071 474 243.075 167.438 55.7066 ==> SRR14458928.se.tsv <== BRADI_1g14170v3 7158 BRADI_1g53295v3 58 BRADI_1g59795v3 209 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 2306 BRADI_1g74790v3 561 BRADI_1g09890v3 3 BRADI_1g77505v3 366 BRADI_1g48960v3 0 SRR14458928 completed mapping pipeline successfully