Starting /dee2/code/volunteer_pipeline.sh SRR14458929 current disk space = 1551908937728 free memory = 1607276832 SRR14458929 SRAfilesize c572a99f8f2c1bac43cee0d73f637c0c SRR14458929.sra SRR14458929.sra file validated SRR14458929 is paired end SRR14458929 is conventional basespace SRR14458929 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4165 32.0 32.0 32.0 32.0 32.0 2 31.524 32.0 32.0 32.0 32.0 32.0 3 31.58525 32.0 32.0 32.0 32.0 32.0 4 31.566 32.0 32.0 32.0 32.0 32.0 5 31.68225 32.0 32.0 32.0 32.0 32.0 6 34.914 36.0 36.0 36.0 36.0 36.0 7 35.22725 36.0 36.0 36.0 36.0 36.0 8 35.206 36.0 36.0 36.0 36.0 36.0 9 35.0325 36.0 36.0 36.0 36.0 36.0 10-14 35.1058 36.0 36.0 36.0 36.0 36.0 15-19 35.104949999999995 36.0 36.0 36.0 36.0 36.0 20-24 35.06805 36.0 36.0 36.0 36.0 36.0 25-29 34.9883 36.0 36.0 36.0 36.0 36.0 30-34 34.9938 36.0 36.0 36.0 36.0 36.0 35-39 34.87135 36.0 36.0 36.0 32.8 36.0 40-44 34.810649999999995 36.0 36.0 36.0 32.0 36.0 45-49 34.7274 36.0 36.0 36.0 32.0 36.0 50-54 34.7491 36.0 36.0 36.0 32.0 36.0 55-59 34.672450000000005 36.0 36.0 36.0 32.0 36.0 60-64 34.5081 36.0 36.0 36.0 32.0 36.0 65-69 34.57985 36.0 36.0 36.0 32.0 36.0 70-74 34.51115 36.0 36.0 36.0 32.0 36.0 75-79 34.33135 36.0 36.0 36.0 32.0 36.0 80-84 34.230450000000005 36.0 36.0 36.0 32.0 36.0 85-89 34.17274999999999 36.0 36.0 36.0 32.0 36.0 90-94 34.15925 36.0 36.0 36.0 32.0 36.0 95-99 33.9238 36.0 36.0 36.0 30.0 36.0 100-104 33.90245 36.0 36.0 36.0 31.0 36.0 105-109 33.89534999999999 36.0 36.0 36.0 30.0 36.0 110-114 33.73505 36.0 36.0 36.0 27.0 36.0 115-119 33.66575 36.0 36.0 36.0 27.0 36.0 120-124 33.704750000000004 36.0 36.0 36.0 27.0 36.0 125-129 33.561150000000005 36.0 36.0 36.0 27.0 36.0 130-134 33.512350000000005 36.0 36.0 36.0 27.0 36.0 135-139 33.519400000000005 36.0 35.2 36.0 27.0 36.0 140-144 33.409499999999994 36.0 34.4 36.0 27.0 36.0 145-149 33.22390000000001 36.0 32.8 36.0 27.0 36.0 150-151 31.498874999999998 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 3.0 21 5.0 22 1.0 23 6.0 24 8.0 25 11.0 26 25.0 27 41.0 28 63.0 29 92.0 30 116.0 31 144.0 32 234.0 33 385.0 34 806.0 35 2058.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.425 11.35 12.125 53.1 2 22.925 17.075000000000003 35.425000000000004 24.575 3 23.7 21.975 24.0 30.325000000000003 4 28.075 26.400000000000002 16.675 28.849999999999998 5 27.0 30.65 19.625 22.725 6 22.54828191622774 32.8567845497868 21.018309505894155 23.5766240280913 7 22.175 14.774999999999999 36.725 26.325 8 21.975 20.1 25.4 32.525 9 22.525000000000002 19.85 29.099999999999998 28.525 10-14 25.165 24.32 22.905 27.61 15-19 25.569999999999997 23.244999999999997 23.18 28.005000000000003 20-24 25.22 23.474999999999998 23.465 27.839999999999996 25-29 25.759999999999998 22.919999999999998 23.615 27.705000000000002 30-34 25.735000000000003 23.875 23.145 27.245 35-39 26.029999999999998 23.355 23.150000000000002 27.465 40-44 25.785000000000004 23.59 23.035 27.589999999999996 45-49 26.305 22.875 23.165 27.655 50-54 26.279999999999998 22.919999999999998 23.31 27.49 55-59 26.395000000000003 23.105 22.725 27.775 60-64 26.11 23.169999999999998 22.6 28.12 65-69 26.215 22.81 23.56 27.415 70-74 26.69 22.82 23.24 27.250000000000004 75-79 26.665 22.74 23.09 27.505000000000003 80-84 26.479999999999997 23.544999999999998 22.384999999999998 27.589999999999996 85-89 26.555 23.265 22.975 27.205000000000002 90-94 27.235 22.73 22.759999999999998 27.275 95-99 27.02 23.215 22.605 27.16 100-104 27.11 23.05 22.24 27.6 105-109 27.47 22.82 22.58 27.13 110-114 27.01 23.75 22.535 26.705000000000002 115-119 27.455000000000002 23.07 21.815 27.66 120-124 27.52 23.02 22.470000000000002 26.99 125-129 27.62 23.630000000000003 21.990000000000002 26.76 130-134 27.52 24.154999999999998 21.245 27.08 135-139 28.105000000000004 23.494999999999997 21.790000000000003 26.61 140-144 28.18 24.285 20.885 26.650000000000002 145-149 26.729999999999997 23.945 22.085 27.24 150-151 26.8625 23.7 22.6 26.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.5 27 1.0 28 0.5 29 0.5 30 3.5 31 9.0 32 11.5 33 12.0 34 16.0 35 22.0 36 28.0 37 37.5 38 57.5 39 75.5 40 88.5 41 107.5 42 122.0 43 124.5 44 136.5 45 144.5 46 145.5 47 141.5 48 132.5 49 141.5 50 143.0 51 125.0 52 115.0 53 115.0 54 108.5 55 97.5 56 94.0 57 94.5 58 107.5 59 119.0 60 99.0 61 92.0 62 103.5 63 100.0 64 90.5 65 93.5 66 87.0 67 74.5 68 77.5 69 78.5 70 72.0 71 57.5 72 52.0 73 53.5 74 49.5 75 41.0 76 29.5 77 21.0 78 14.5 79 8.5 80 7.0 81 6.5 82 3.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.325 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.7830260166708766 1.55 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 5.2125 0.0 0.0 0.0 0.0 128-129 5.95 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.6125 0.0 0.0 0.0 0.0 134-135 8.5875 0.0 0.0 0.0 0.0 136-137 9.525 0.0 0.0 0.0 0.0 138-139 10.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCGCCG 10 0.006830828 145.0 145 >>END_MODULE SRR14458929 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458929_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43775 32.0 32.0 32.0 32.0 32.0 2 31.147 32.0 32.0 32.0 32.0 32.0 3 31.158 32.0 32.0 32.0 32.0 32.0 4 31.2095 32.0 32.0 32.0 32.0 32.0 5 31.282 32.0 32.0 32.0 32.0 32.0 6 34.702 36.0 36.0 36.0 32.0 36.0 7 34.83975 36.0 36.0 36.0 32.0 36.0 8 34.7775 36.0 36.0 36.0 32.0 36.0 9 34.85775 36.0 36.0 36.0 32.0 36.0 10-14 34.77205 36.0 36.0 36.0 32.0 36.0 15-19 34.6967 36.0 36.0 36.0 32.0 36.0 20-24 34.65605000000001 36.0 36.0 36.0 32.0 36.0 25-29 34.6965 36.0 36.0 36.0 32.0 36.0 30-34 34.6057 36.0 36.0 36.0 32.0 36.0 35-39 34.627599999999994 36.0 36.0 36.0 32.0 36.0 40-44 34.51075 36.0 36.0 36.0 32.0 36.0 45-49 34.54955 36.0 36.0 36.0 32.0 36.0 50-54 34.460300000000004 36.0 36.0 36.0 32.0 36.0 55-59 34.3697 36.0 36.0 36.0 32.0 36.0 60-64 34.270050000000005 36.0 36.0 36.0 32.0 36.0 65-69 34.27505 36.0 36.0 36.0 32.0 36.0 70-74 34.265150000000006 36.0 36.0 36.0 32.0 36.0 75-79 34.00045 36.0 36.0 36.0 31.0 36.0 80-84 33.88775 36.0 36.0 36.0 32.0 36.0 85-89 33.7095 36.0 36.0 36.0 28.0 36.0 90-94 33.6758 36.0 36.0 36.0 27.0 36.0 95-99 33.624300000000005 36.0 36.0 36.0 27.0 36.0 100-104 33.59675 36.0 36.0 36.0 27.0 36.0 105-109 33.45895 36.0 36.0 36.0 27.0 36.0 110-114 33.39285 36.0 36.0 36.0 27.0 36.0 115-119 33.31545 36.0 34.4 36.0 27.0 36.0 120-124 33.30485 36.0 35.2 36.0 27.0 36.0 125-129 33.229949999999995 36.0 33.6 36.0 27.0 36.0 130-134 33.204899999999995 36.0 33.6 36.0 27.0 36.0 135-139 32.84375 36.0 32.0 36.0 27.0 36.0 140-144 32.8872 36.0 32.0 36.0 25.8 36.0 145-149 32.34845 36.0 32.0 36.0 19.4 36.0 150-151 30.014499999999998 34.0 29.5 36.0 17.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 3.0 20 6.0 21 5.0 22 11.0 23 10.0 24 17.0 25 26.0 26 33.0 27 62.0 28 84.0 29 90.0 30 118.0 31 217.0 32 228.0 33 440.0 34 881.0 35 1762.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.50562640660165 10.577644411102776 11.70292573143286 55.21380345086272 2 24.45 15.625 35.375 24.55 3 24.025 20.424999999999997 24.3 31.25 4 26.575 25.75 17.2 30.475 5 29.9 28.475 19.225 22.400000000000002 6 22.3 32.95 18.9 25.85 7 21.7 15.85 36.85 25.6 8 23.275000000000002 20.175 25.025 31.525 9 23.575 18.95 28.199999999999996 29.275000000000002 10-14 25.28 23.945 23.225 27.55 15-19 25.56 23.1 23.06 28.28 20-24 25.81 23.165 23.255 27.77 25-29 26.375 23.14 23.195 27.29 30-34 26.665 23.365 22.814999999999998 27.155 35-39 26.229999999999997 23.54 22.345000000000002 27.884999999999998 40-44 26.08 23.544999999999998 22.95 27.425 45-49 26.534999999999997 22.7 22.875 27.889999999999997 50-54 26.810000000000002 22.884999999999998 22.689999999999998 27.615000000000002 55-59 26.534999999999997 23.14 22.3 28.025 60-64 26.450000000000003 22.24 23.330000000000002 27.98 65-69 26.755000000000003 22.96 22.93 27.355 70-74 27.29 22.62 22.89 27.200000000000003 75-79 26.5 23.080000000000002 22.814999999999998 27.605 80-84 26.590000000000003 22.814999999999998 23.24 27.355 85-89 27.02 22.869999999999997 22.875 27.235 90-94 26.825 22.89 22.805 27.48 95-99 27.495000000000005 22.74 22.41 27.355 100-104 27.97 22.8 21.985 27.245 105-109 27.605 22.564999999999998 22.365 27.465 110-114 27.265 22.814999999999998 22.634999999999998 27.284999999999997 115-119 27.700000000000003 22.939999999999998 22.32 27.04 120-124 28.185 23.035 22.16 26.619999999999997 125-129 28.34 23.03 22.384999999999998 26.245 130-134 28.92 23.235 21.75 26.095000000000002 135-139 28.865000000000002 23.645 21.915000000000003 25.575 140-144 29.744999999999997 23.13 21.715 25.41 145-149 29.18 23.27 22.28 25.27 150-151 29.75 23.2625 21.837500000000002 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.0 29 2.0 30 3.5 31 7.0 32 7.5 33 6.5 34 12.5 35 24.0 36 33.5 37 42.0 38 45.0 39 63.5 40 88.0 41 99.5 42 120.5 43 135.5 44 136.5 45 143.5 46 142.5 47 146.0 48 149.5 49 134.0 50 132.0 51 128.0 52 112.5 53 110.0 54 103.0 55 93.0 56 99.0 57 97.5 58 87.5 59 104.5 60 106.0 61 97.5 62 103.0 63 97.5 64 88.0 65 91.5 66 89.0 67 79.5 68 85.5 69 84.0 70 78.0 71 66.0 72 63.0 73 63.5 74 51.0 75 37.5 76 26.0 77 19.0 78 15.0 79 14.5 80 12.0 81 6.5 82 4.5 83 3.0 84 1.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.3375000000000004 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 6.012499999999999 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.7125 0.0 0.0 0.0 0.0 134-135 8.6875 0.0 0.0 0.0 0.0 136-137 9.6125 0.0 0.0 0.0 0.0 138-139 10.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933399 spots for SRR14458929.sra Written 933399 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra Read 933394 spots for SRR14458929.sra Written 933394 spots for SRR14458929.sra SRR ids: ['SRR14458929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b4v3klkl SRR14458929.sra spots: 18667885 blocks: [[1, 933394], [933395, 1866788], [1866789, 2800182], [2800183, 3733576], [3733577, 4666970], [4666971, 5600364], [5600365, 6533758], [6533759, 7467152], [7467153, 8400546], [8400547, 9333940], [9333941, 10267334], [10267335, 11200728], [11200729, 12134122], [12134123, 13067516], [13067517, 14000910], [14000911, 14934304], [14934305, 15867698], [15867699, 16801092], [16801093, 17734486], [17734487, 18667885]] SRR14458929 file size 6322463 SRR14458929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458929 SRR14458929_1.fastq SRR14458929_2.fastq Input file: SRR14458929_1.fastq Paired file: SRR14458929_2.fastq trimmed: SRR14458929-trimmed-pair1.fastq, SRR14458929-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:17:06 2024 >> started Fri Dec 6 10:17:26 2024 >> done (19.857s) 18667885 read pairs processed; of these: 4533 ( 0.02%) short read pairs filtered out after trimming by size control 1567 ( 0.01%) empty read pairs filtered out after trimming by size control 18661785 (99.97%) read pairs available; of these: 3095555 (16.59%) trimmed read pairs available after processing 15566230 (83.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 209 0.00% 19 227 0.00% 20 226 0.00% 21 181 0.00% 22 209 0.00% 23 192 0.00% 24 212 0.00% 25 150 0.00% 26 183 0.00% 27 158 0.00% 28 140 0.00% 29 177 0.00% 30 147 0.00% 31 167 0.00% 32 162 0.00% 33 146 0.00% 34 409 0.00% 35 149 0.00% 36 135 0.00% 37 102 0.00% 38 133 0.00% 39 118 0.00% 40 117 0.00% 41 166 0.00% 42 130 0.00% 43 129 0.00% 44 127 0.00% 45 123 0.00% 46 134 0.00% 47 159 0.00% 48 145 0.00% 49 155 0.00% 50 176 0.00% 51 159 0.00% 52 183 0.00% 53 182 0.00% 54 166 0.00% 55 166 0.00% 56 172 0.00% 57 182 0.00% 58 212 0.00% 59 234 0.00% 60 263 0.00% 61 268 0.00% 62 290 0.00% 63 267 0.00% 64 254 0.00% 65 285 0.00% 66 282 0.00% 67 311 0.00% 68 389 0.00% 69 407 0.00% 70 458 0.00% 71 530 0.00% 72 517 0.00% 73 621 0.00% 74 627 0.00% 75 643 0.00% 76 635 0.00% 77 777 0.00% 78 813 0.00% 79 880 0.00% 80 1077 0.01% 81 1294 0.01% 82 1611 0.01% 83 1641 0.01% 84 1895 0.01% 85 1913 0.01% 86 2085 0.01% 87 2262 0.01% 88 2574 0.01% 89 3007 0.02% 90 3468 0.02% 91 3903 0.02% 92 4533 0.02% 93 5394 0.03% 94 6032 0.03% 95 6507 0.03% 96 6987 0.04% 97 7599 0.04% 98 8288 0.04% 99 9166 0.05% 100 10307 0.06% 101 11636 0.06% 102 13448 0.07% 103 15039 0.08% 104 16950 0.09% 105 18206 0.10% 106 19671 0.11% 107 20427 0.11% 108 21939 0.12% 109 23775 0.13% 110 25467 0.14% 111 27610 0.15% 112 31275 0.17% 113 34191 0.18% 114 36830 0.20% 115 39435 0.21% 116 41776 0.22% 117 42761 0.23% 118 44385 0.24% 119 45838 0.25% 120 47531 0.25% 121 50735 0.27% 122 54305 0.29% 123 57639 0.31% 124 62094 0.33% 125 64697 0.35% 126 67003 0.36% 127 67994 0.36% 128 69569 0.37% 129 69001 0.37% 130 70278 0.38% 131 72539 0.39% 132 75547 0.40% 133 78965 0.42% 134 82642 0.44% 135 85290 0.46% 136 87644 0.47% 137 87659 0.47% 138 87376 0.47% 139 87703 0.47% 140 87515 0.47% 141 87352 0.47% 142 90260 0.48% 143 92001 0.49% 144 93682 0.50% 145 95515 0.51% 146 96353 0.52% 147 97172 0.52% 148 98503 0.53% 149 96359 0.52% 150 95764 0.51% 151 15566230 83.41% 18661785 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=9 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=27.06 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=7 prefix-density=0.56 prefix-fanout=3.3 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=26.89 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC SRR14458929 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:18:18 Started mapping on | Dec 06 10:18:18 Finished on | Dec 06 10:20:16 Mapping speed, Million of reads per hour | 569.34 Number of input reads | 18661785 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17662427 Uniquely mapped reads % | 94.64% Average mapped length | 293.18 Number of splices: Total | 17946467 Number of splices: Annotated (sjdb) | 16927730 Number of splices: GT/AG | 17699744 Number of splices: GC/AG | 209792 Number of splices: AT/AC | 6987 Number of splices: Non-canonical | 29944 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242930 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 35904 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 1.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 756428 756428 756428 N_multimapping 242930 242930 242930 N_noFeature 516909 8909353 8959028 N_ambiguous 402230 48375 47486 UnstrandedReadsAssigned:16743288 PositiveStrandReadsAssigned:8704699 NegativeStrandReadsAssigned:8655913 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458929 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458929-trimmed-pair1.fastq SRR14458929-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,661,785 reads, 17,465,815 reads pseudoaligned [quant] estimated average fragment length: 245.233 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR14458929.ke.tsv 35125 SRR14458929.se.tsv 88098 total ==> SRR14458929.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.158 0 0 PNS24247 1044 799.767 23.2432 2.1842 PNS24249 1928 1683.77 153.44 6.84884 PNS24246 1044 799.767 23.2432 2.1842 PNS24248 1044 799.767 23.2432 2.1842 PNS24244 1471 1226.77 36.8302 2.25632 PNS24243 293 103.916 5 3.61617 KQK14069 1603 1358.77 7447.17 411.913 KQK14071 474 247.298 203.641 61.8876 ==> SRR14458929.se.tsv <== BRADI_1g14170v3 8308 BRADI_1g53295v3 57 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 2300 BRADI_1g74790v3 633 BRADI_1g09890v3 11 BRADI_1g77505v3 390 BRADI_1g48960v3 0 SRR14458929 completed mapping pipeline successfully