Starting /dee2/code/volunteer_pipeline.sh SRR14458930 current disk space = 1551908163584 free memory = 1607272804 SRR14458930 SRAfilesize 2d249caee04c6d8ab313d5d05f257386 SRR14458930.sra SRR14458930.sra file validated SRR14458930 is paired end SRR14458930 is conventional basespace SRR14458930 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14075 32.0 32.0 32.0 32.0 32.0 2 31.3875 32.0 32.0 32.0 32.0 32.0 3 31.46275 32.0 32.0 32.0 32.0 32.0 4 31.4655 32.0 32.0 32.0 32.0 32.0 5 31.50225 32.0 32.0 32.0 32.0 32.0 6 34.86975 36.0 36.0 36.0 32.0 36.0 7 35.06975 36.0 36.0 36.0 36.0 36.0 8 34.7785 36.0 36.0 36.0 32.0 36.0 9 34.90675 36.0 36.0 36.0 32.0 36.0 10-14 34.97795 36.0 36.0 36.0 33.6 36.0 15-19 34.93580000000001 36.0 36.0 36.0 33.6 36.0 20-24 34.892450000000004 36.0 36.0 36.0 32.0 36.0 25-29 34.771750000000004 36.0 36.0 36.0 32.0 36.0 30-34 34.7607 36.0 36.0 36.0 32.0 36.0 35-39 34.659499999999994 36.0 36.0 36.0 32.0 36.0 40-44 34.64274999999999 36.0 36.0 36.0 32.0 36.0 45-49 34.515950000000004 36.0 36.0 36.0 32.0 36.0 50-54 34.505 36.0 36.0 36.0 32.0 36.0 55-59 34.4188 36.0 36.0 36.0 32.0 36.0 60-64 34.38445 36.0 36.0 36.0 32.0 36.0 65-69 34.3509 36.0 36.0 36.0 32.0 36.0 70-74 34.24345 36.0 36.0 36.0 32.0 36.0 75-79 34.12935 36.0 36.0 36.0 32.0 36.0 80-84 34.043150000000004 36.0 36.0 36.0 32.0 36.0 85-89 33.892849999999996 36.0 36.0 36.0 31.0 36.0 90-94 33.9137 36.0 36.0 36.0 32.0 36.0 95-99 33.6995 36.0 36.0 36.0 29.0 36.0 100-104 33.611399999999996 36.0 36.0 36.0 27.0 36.0 105-109 33.6871 36.0 36.0 36.0 27.0 36.0 110-114 33.566900000000004 36.0 36.0 36.0 27.0 36.0 115-119 33.3945 36.0 36.0 36.0 27.0 36.0 120-124 33.32275 36.0 35.2 36.0 27.0 36.0 125-129 33.2692 36.0 32.8 36.0 27.0 36.0 130-134 33.28265 36.0 33.6 36.0 27.0 36.0 135-139 33.189699999999995 36.0 32.8 36.0 27.0 36.0 140-144 33.13825 36.0 32.0 36.0 27.0 36.0 145-149 33.007949999999994 36.0 32.0 36.0 27.0 36.0 150-151 31.223374999999997 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 5.0 22 1.0 23 6.0 24 11.0 25 31.0 26 39.0 27 33.0 28 76.0 29 114.0 30 146.0 31 175.0 32 259.0 33 395.0 34 852.0 35 1854.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.625 12.15 13.450000000000001 52.775000000000006 2 21.425 18.675 36.35 23.549999999999997 3 22.175 22.900000000000002 24.349999999999998 30.575000000000003 4 27.625 25.924999999999997 18.75 27.700000000000003 5 28.025 29.099999999999998 20.7 22.175 6 23.74749498997996 32.26452905811623 19.06312625250501 24.9248496993988 7 21.375 15.8 38.625 24.2 8 21.075 20.1 26.775 32.05 9 22.7 18.925 29.25 29.125 10-14 25.1 24.385 23.56 26.955000000000002 15-19 25.7 24.15 23.44 26.71 20-24 25.465 23.330000000000002 23.655 27.55 25-29 25.569999999999997 24.145 23.45 26.834999999999997 30-34 26.035000000000004 23.685000000000002 23.380000000000003 26.900000000000002 35-39 25.77 23.525 23.419999999999998 27.284999999999997 40-44 26.200000000000003 23.830000000000002 23.015 26.955000000000002 45-49 26.355 23.72 23.005 26.919999999999998 50-54 25.905 23.47 23.47 27.155 55-59 25.795 24.005000000000003 23.41 26.790000000000003 60-64 25.6 23.44 23.724999999999998 27.235 65-69 26.195 23.84 22.985 26.979999999999997 70-74 26.085 23.195 23.645 27.075 75-79 26.565 23.815 22.900000000000002 26.72 80-84 26.479999999999997 23.235 23.395 26.889999999999997 85-89 26.6 23.53 22.830000000000002 27.04 90-94 26.495 23.07 23.665 26.77 95-99 26.05 23.35 23.325000000000003 27.275 100-104 25.96 23.89 23.830000000000002 26.32 105-109 27.165 22.814999999999998 23.51 26.51 110-114 26.840000000000003 23.915 23.015 26.229999999999997 115-119 26.565 23.13 23.28 27.025 120-124 27.310000000000002 23.765 22.145 26.779999999999998 125-129 26.484999999999996 23.445 23.325000000000003 26.745 130-134 27.495000000000005 24.03 22.34 26.135 135-139 27.105 23.875 22.81 26.21 140-144 27.145000000000003 23.76 22.53 26.565 145-149 27.224999999999998 24.154999999999998 22.0 26.619999999999997 150-151 27.0125 24.2375 22.037499999999998 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 1.0 28 2.5 29 4.5 30 3.0 31 3.5 32 11.0 33 19.5 34 22.5 35 26.0 36 35.5 37 47.5 38 57.0 39 68.0 40 88.5 41 105.0 42 115.0 43 132.5 44 147.0 45 169.5 46 168.5 47 141.0 48 146.5 49 156.0 50 138.5 51 128.5 52 124.0 53 117.0 54 117.0 55 105.5 56 98.5 57 97.5 58 96.5 59 100.5 60 99.5 61 94.5 62 97.5 63 96.5 64 79.5 65 69.0 66 69.0 67 77.0 68 80.0 69 72.5 70 67.0 71 51.5 72 46.0 73 46.5 74 37.0 75 29.5 76 22.5 77 15.5 78 14.0 79 12.5 80 6.5 81 6.5 82 5.5 83 2.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.9 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCTT 10 0.006830828 145.0 4 ACTTTCA 10 0.006830828 145.0 145 CTGTTCA 10 0.006830828 145.0 5 >>END_MODULE SRR14458930 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458930_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.954 32.0 32.0 32.0 32.0 32.0 2 30.698 32.0 32.0 32.0 32.0 32.0 3 30.7005 32.0 32.0 32.0 32.0 32.0 4 30.571 32.0 32.0 32.0 32.0 32.0 5 30.72275 32.0 32.0 32.0 32.0 32.0 6 33.83425 36.0 36.0 36.0 32.0 36.0 7 34.03325 36.0 36.0 36.0 32.0 36.0 8 34.03125 36.0 36.0 36.0 32.0 36.0 9 34.11675 36.0 36.0 36.0 32.0 36.0 10-14 34.00125 36.0 36.0 36.0 32.0 36.0 15-19 33.93895 36.0 36.0 36.0 32.0 36.0 20-24 33.7748 36.0 36.0 36.0 31.0 36.0 25-29 33.9097 36.0 36.0 36.0 32.0 36.0 30-34 33.705200000000005 36.0 36.0 36.0 28.8 36.0 35-39 33.70649999999999 36.0 36.0 36.0 29.0 36.0 40-44 33.6601 36.0 36.0 36.0 28.0 36.0 45-49 33.591899999999995 36.0 36.0 36.0 27.8 36.0 50-54 33.559749999999994 36.0 36.0 36.0 27.0 36.0 55-59 33.45095 36.0 36.0 36.0 21.0 36.0 60-64 33.417049999999996 36.0 36.0 36.0 23.4 36.0 65-69 33.26835 36.0 36.0 36.0 21.0 36.0 70-74 33.24065 36.0 36.0 36.0 20.8 36.0 75-79 33.1279 36.0 35.2 36.0 21.0 36.0 80-84 32.904 36.0 32.8 36.0 16.8 36.0 85-89 32.714800000000004 36.0 32.0 36.0 19.6 36.0 90-94 32.72955 36.0 32.0 36.0 16.8 36.0 95-99 32.6891 36.0 32.0 36.0 18.2 36.0 100-104 32.70425 36.0 32.0 36.0 18.2 36.0 105-109 32.452799999999996 36.0 32.0 36.0 14.0 36.0 110-114 32.3808 36.0 32.0 36.0 14.0 36.0 115-119 32.38815 36.0 32.0 36.0 14.0 36.0 120-124 32.3337 36.0 32.0 36.0 14.0 36.0 125-129 32.28605 36.0 32.0 36.0 14.0 36.0 130-134 32.1508 36.0 32.0 36.0 14.0 36.0 135-139 31.95135 36.0 32.0 36.0 14.0 36.0 140-144 31.867949999999997 36.0 32.0 36.0 14.0 36.0 145-149 31.561349999999997 36.0 30.0 36.0 14.0 36.0 150-151 29.134875 34.0 20.5 34.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 1.0 17 3.0 18 2.0 19 2.0 20 4.0 21 11.0 22 10.0 23 17.0 24 29.0 25 55.0 26 69.0 27 76.0 28 137.0 29 165.0 30 213.0 31 304.0 32 395.0 33 625.0 34 910.0 35 969.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.293219914936202 12.084063047285463 12.284213159869903 51.33850387790844 2 24.125 16.175 35.199999999999996 24.5 3 25.0 21.125 23.474999999999998 30.4 4 27.425 26.325 17.65 28.599999999999998 5 29.7 29.175 19.55 21.575 6 21.325 34.65 19.55 24.474999999999998 7 21.475 15.950000000000001 37.05 25.525 8 20.525 20.349999999999998 27.575 31.55 9 22.525000000000002 20.349999999999998 29.275000000000002 27.85 10-14 24.995 24.46 23.119999999999997 27.425 15-19 25.97 23.605 23.035 27.389999999999997 20-24 25.480000000000004 24.23 23.599999999999998 26.69 25-29 25.790000000000003 24.32 23.425 26.465 30-34 26.005 23.810000000000002 23.175 27.01 35-39 25.21 24.240000000000002 23.74 26.810000000000002 40-44 25.869999999999997 23.56 23.380000000000003 27.189999999999998 45-49 26.015 24.165 22.845 26.974999999999998 50-54 26.125 23.74 23.16 26.974999999999998 55-59 26.355 23.794999999999998 23.21 26.640000000000004 60-64 26.16 23.28 23.365 27.195000000000004 65-69 26.229999999999997 23.645 23.080000000000002 27.045 70-74 26.755000000000003 23.14 22.985 27.12 75-79 26.375 23.630000000000003 23.35 26.645000000000003 80-84 26.46 23.135 23.5 26.905 85-89 25.97 23.674999999999997 22.84 27.515 90-94 26.375 23.605 23.155 26.865 95-99 26.290000000000003 23.919999999999998 22.98 26.810000000000002 100-104 27.084999999999997 22.775000000000002 23.335 26.805 105-109 26.795 23.29 23.085 26.83 110-114 26.71 23.615 23.235 26.44 115-119 27.400000000000002 23.435 22.27 26.895000000000003 120-124 26.71 23.305 23.22 26.765 125-129 27.450000000000003 23.494999999999997 22.68 26.375 130-134 27.935 23.799999999999997 22.495 25.77 135-139 27.61 23.735 22.56 26.095000000000002 140-144 28.410000000000004 23.645 22.165000000000003 25.779999999999998 145-149 29.134999999999998 23.84 22.23 24.795 150-151 28.775000000000002 23.974999999999998 21.875 25.374999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.0 26 1.0 27 1.0 28 3.0 29 3.0 30 2.5 31 7.0 32 10.0 33 11.0 34 19.0 35 29.0 36 36.0 37 44.0 38 61.0 39 78.0 40 97.0 41 115.5 42 121.0 43 133.5 44 146.0 45 158.0 46 158.0 47 147.5 48 145.0 49 145.0 50 138.5 51 125.0 52 121.0 53 119.5 54 106.5 55 92.0 56 95.5 57 98.5 58 95.5 59 96.0 60 106.5 61 112.0 62 103.0 63 93.0 64 85.0 65 73.5 66 66.5 67 70.5 68 71.5 69 66.5 70 61.0 71 55.5 72 52.0 73 45.0 74 35.0 75 35.0 76 33.5 77 23.5 78 13.5 79 8.5 80 5.5 81 4.0 82 5.0 83 3.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96307536671725 97.82499999999999 2 0.9357612544258977 1.8499999999999999 3 0.07587253414264036 0.22499999999999998 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.225 0.0 0.0 0.0 0.0 126-127 2.6 0.0 0.0 0.0 0.0 128-129 3.1 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.0076550315 18.125 30-34 >>END_MODULE Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834150 spots for SRR14458930.sra Written 834150 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra Read 834133 spots for SRR14458930.sra Written 834133 spots for SRR14458930.sra SRR ids: ['SRR14458930.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rge5p4hi SRR14458930.sra spots: 16682677 blocks: [[1, 834133], [834134, 1668266], [1668267, 2502399], [2502400, 3336532], [3336533, 4170665], [4170666, 5004798], [5004799, 5838931], [5838932, 6673064], [6673065, 7507197], [7507198, 8341330], [8341331, 9175463], [9175464, 10009596], [10009597, 10843729], [10843730, 11677862], [11677863, 12511995], [12511996, 13346128], [13346129, 14180261], [14180262, 15014394], [15014395, 15848527], [15848528, 16682677]] SRR14458930 file size 5647803 SRR14458930 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458930 SRR14458930_1.fastq SRR14458930_2.fastq Input file: SRR14458930_1.fastq Paired file: SRR14458930_2.fastq trimmed: SRR14458930-trimmed-pair1.fastq, SRR14458930-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:16:18 2024 >> started Fri Dec 6 10:16:38 2024 >> done (19.924s) 16682677 read pairs processed; of these: 2545 ( 0.02%) short read pairs filtered out after trimming by size control 1029 ( 0.01%) empty read pairs filtered out after trimming by size control 16679103 (99.98%) read pairs available; of these: 2061729 (12.36%) trimmed read pairs available after processing 14617374 (87.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 139 0.00% 19 143 0.00% 20 125 0.00% 21 111 0.00% 22 130 0.00% 23 124 0.00% 24 123 0.00% 25 112 0.00% 26 91 0.00% 27 103 0.00% 28 115 0.00% 29 111 0.00% 30 95 0.00% 31 105 0.00% 32 93 0.00% 33 100 0.00% 34 244 0.00% 35 107 0.00% 36 113 0.00% 37 89 0.00% 38 107 0.00% 39 103 0.00% 40 91 0.00% 41 96 0.00% 42 100 0.00% 43 101 0.00% 44 83 0.00% 45 113 0.00% 46 113 0.00% 47 110 0.00% 48 106 0.00% 49 134 0.00% 50 131 0.00% 51 128 0.00% 52 127 0.00% 53 145 0.00% 54 134 0.00% 55 140 0.00% 56 146 0.00% 57 122 0.00% 58 158 0.00% 59 168 0.00% 60 195 0.00% 61 189 0.00% 62 192 0.00% 63 187 0.00% 64 191 0.00% 65 218 0.00% 66 229 0.00% 67 261 0.00% 68 262 0.00% 69 301 0.00% 70 314 0.00% 71 375 0.00% 72 353 0.00% 73 406 0.00% 74 384 0.00% 75 407 0.00% 76 442 0.00% 77 468 0.00% 78 522 0.00% 79 578 0.00% 80 653 0.00% 81 720 0.00% 82 842 0.01% 83 950 0.01% 84 1016 0.01% 85 1087 0.01% 86 1244 0.01% 87 1331 0.01% 88 1387 0.01% 89 1686 0.01% 90 1835 0.01% 91 2198 0.01% 92 2518 0.02% 93 2889 0.02% 94 3060 0.02% 95 3481 0.02% 96 3684 0.02% 97 4034 0.02% 98 4443 0.03% 99 4833 0.03% 100 5575 0.03% 101 6198 0.04% 102 7104 0.04% 103 8142 0.05% 104 8918 0.05% 105 9817 0.06% 106 10481 0.06% 107 11371 0.07% 108 11990 0.07% 109 13005 0.08% 110 14312 0.09% 111 15496 0.09% 112 17732 0.11% 113 19281 0.12% 114 20857 0.13% 115 22701 0.14% 116 23835 0.14% 117 24944 0.15% 118 25789 0.15% 119 27066 0.16% 120 28621 0.17% 121 30384 0.18% 122 32414 0.19% 123 35181 0.21% 124 37893 0.23% 125 39790 0.24% 126 41722 0.25% 127 42860 0.26% 128 43694 0.26% 129 44712 0.27% 130 45935 0.28% 131 47751 0.29% 132 50104 0.30% 133 52910 0.32% 134 55602 0.33% 135 57438 0.34% 136 59757 0.36% 137 60826 0.36% 138 60478 0.36% 139 62105 0.37% 140 62607 0.38% 141 63127 0.38% 142 65543 0.39% 143 67415 0.40% 144 69302 0.42% 145 71026 0.43% 146 72478 0.43% 147 74109 0.44% 148 75490 0.45% 149 74982 0.45% 150 75465 0.45% 151 14617374 87.64% 16679103 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=10 prefix-density=0.50 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=33.09 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=9 prefix-density=0.49 prefix-fanout=3.3 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=19.14 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458930 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:17:36 Started mapping on | Dec 06 10:17:37 Finished on | Dec 06 10:19:27 Mapping speed, Million of reads per hour | 545.86 Number of input reads | 16679103 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13681034 Uniquely mapped reads % | 82.02% Average mapped length | 287.73 Number of splices: Total | 13962015 Number of splices: Annotated (sjdb) | 13176641 Number of splices: GT/AG | 13769842 Number of splices: GC/AG | 161355 Number of splices: AT/AC | 5928 Number of splices: Non-canonical | 24890 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265094 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 78505 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.28% % of reads unmapped: other | 3.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2732997 2732997 2732997 N_multimapping 265094 265094 265094 N_noFeature 500750 6933309 7008342 N_ambiguous 342059 53378 52511 UnstrandedReadsAssigned:12838225 PositiveStrandReadsAssigned:6694347 NegativeStrandReadsAssigned:6620181 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458930 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458930-trimmed-pair1.fastq SRR14458930-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,679,103 reads, 15,111,230 reads pseudoaligned [quant] estimated average fragment length: 237.46 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR14458930.ke.tsv 35125 SRR14458930.se.tsv 88098 total ==> SRR14458930.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.869 0 0 PNS24247 1044 807.54 23.3402 2.509 PNS24249 1928 1691.54 96.6291 4.9589 PNS24246 1044 807.54 23.3402 2.509 PNS24248 1044 807.54 23.3402 2.509 PNS24244 1471 1234.54 47.3502 3.32948 PNS24243 293 102.608 4 3.38408 KQK14069 1603 1366.54 6770.32 430.078 KQK14071 474 249.719 235.923 82.0123 ==> SRR14458930.se.tsv <== BRADI_1g14170v3 6728 BRADI_1g53295v3 53 BRADI_1g59795v3 226 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 1862 BRADI_1g74790v3 401 BRADI_1g09890v3 3 BRADI_1g77505v3 307 BRADI_1g48960v3 0 SRR14458930 completed mapping pipeline successfully