Starting /dee2/code/volunteer_pipeline.sh SRR14458931 current disk space = 1551923593216 free memory = 1607263668 SRR14458931 SRAfilesize 12bf4df27b6c64d65b29daaf1d1cbb7e SRR14458931.sra SRR14458931.sra file validated SRR14458931 is paired end SRR14458931 is conventional basespace SRR14458931 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458931_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.402 32.0 32.0 32.0 32.0 32.0 2 31.451 32.0 32.0 32.0 32.0 32.0 3 31.5145 32.0 32.0 32.0 32.0 32.0 4 31.59125 32.0 32.0 32.0 32.0 32.0 5 31.57175 32.0 32.0 32.0 32.0 32.0 6 34.9245 36.0 36.0 36.0 36.0 36.0 7 35.2215 36.0 36.0 36.0 36.0 36.0 8 35.0175 36.0 36.0 36.0 36.0 36.0 9 35.156 36.0 36.0 36.0 36.0 36.0 10-14 35.17635 36.0 36.0 36.0 36.0 36.0 15-19 35.0663 36.0 36.0 36.0 36.0 36.0 20-24 35.104600000000005 36.0 36.0 36.0 36.0 36.0 25-29 34.9969 36.0 36.0 36.0 34.4 36.0 30-34 34.9009 36.0 36.0 36.0 32.8 36.0 35-39 34.7957 36.0 36.0 36.0 32.0 36.0 40-44 34.7851 36.0 36.0 36.0 32.0 36.0 45-49 34.765100000000004 36.0 36.0 36.0 32.0 36.0 50-54 34.676750000000006 36.0 36.0 36.0 32.0 36.0 55-59 34.6632 36.0 36.0 36.0 32.0 36.0 60-64 34.4782 36.0 36.0 36.0 32.0 36.0 65-69 34.54600000000001 36.0 36.0 36.0 32.0 36.0 70-74 34.4995 36.0 36.0 36.0 32.0 36.0 75-79 34.414750000000005 36.0 36.0 36.0 32.0 36.0 80-84 34.2161 36.0 36.0 36.0 32.0 36.0 85-89 34.14575000000001 36.0 36.0 36.0 32.0 36.0 90-94 34.181200000000004 36.0 36.0 36.0 32.0 36.0 95-99 33.98864999999999 36.0 36.0 36.0 32.0 36.0 100-104 33.89025 36.0 36.0 36.0 30.0 36.0 105-109 33.89395 36.0 36.0 36.0 30.0 36.0 110-114 33.7996 36.0 36.0 36.0 28.0 36.0 115-119 33.6776 36.0 36.0 36.0 27.0 36.0 120-124 33.65500000000001 36.0 36.0 36.0 27.0 36.0 125-129 33.5377 36.0 36.0 36.0 27.0 36.0 130-134 33.592 36.0 36.0 36.0 27.0 36.0 135-139 33.528800000000004 36.0 35.2 36.0 27.0 36.0 140-144 33.37285 36.0 35.2 36.0 27.0 36.0 145-149 33.2447 36.0 32.8 36.0 27.0 36.0 150-151 31.576375 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 4.0 22 6.0 23 9.0 24 9.0 25 22.0 26 33.0 27 45.0 28 64.0 29 97.0 30 95.0 31 123.0 32 222.0 33 349.0 34 810.0 35 2108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.400000000000002 11.95 10.95 54.7 2 24.099999999999998 18.25 35.425000000000004 22.225 3 22.425 22.1 24.8 30.675 4 27.900000000000002 26.05 17.675 28.375 5 28.575 30.225 19.55 21.65 6 23.37759959909797 32.29766975695315 19.468804810824356 24.85592583312453 7 22.0 16.375 37.425000000000004 24.2 8 22.2 20.125 26.05 31.624999999999996 9 23.575 19.7 27.800000000000004 28.925 10-14 24.895 25.06 22.085 27.96 15-19 26.0 22.675 23.11 28.215 20-24 25.83 24.125 22.935 27.11 25-29 25.945 23.61 23.29 27.155 30-34 26.229999999999997 23.549999999999997 23.14 27.08 35-39 26.200000000000003 23.575 22.945 27.279999999999998 40-44 25.985000000000003 23.330000000000002 23.04 27.644999999999996 45-49 26.05 23.515 23.105 27.33 50-54 26.86 23.405 22.770000000000003 26.965 55-59 26.590000000000003 23.580000000000002 22.975 26.855 60-64 26.384999999999998 23.150000000000002 22.935 27.529999999999998 65-69 26.529999999999998 23.419999999999998 22.919999999999998 27.13 70-74 26.755000000000003 23.585 22.52 27.139999999999997 75-79 26.939999999999998 22.785 23.075000000000003 27.200000000000003 80-84 26.615 23.355 23.105 26.924999999999997 85-89 26.985 23.34 22.56 27.115000000000002 90-94 26.86 22.905 22.900000000000002 27.334999999999997 95-99 27.42 22.95 22.74 26.889999999999997 100-104 27.76 22.425 22.935 26.88 105-109 27.189999999999998 23.175 22.595000000000002 27.04 110-114 27.634999999999998 23.05 22.82 26.495 115-119 27.650000000000002 23.445 22.37 26.534999999999997 120-124 27.195000000000004 23.5 22.585 26.72 125-129 27.82 23.064999999999998 22.470000000000002 26.645000000000003 130-134 27.105 23.580000000000002 22.245 27.07 135-139 28.04 23.415 22.07 26.474999999999998 140-144 27.32 24.085 22.095000000000002 26.5 145-149 27.284999999999997 23.915 21.81 26.99 150-151 27.5125 24.4375 21.1375 26.9125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 5.0 30 5.5 31 6.0 32 8.0 33 11.5 34 15.5 35 21.5 36 36.0 37 46.0 38 56.0 39 70.0 40 82.5 41 90.5 42 109.0 43 129.5 44 150.0 45 158.5 46 147.5 47 139.5 48 144.0 49 148.5 50 131.5 51 121.5 52 114.5 53 121.0 54 133.5 55 116.0 56 84.5 57 88.5 58 110.5 59 111.5 60 108.0 61 99.5 62 96.0 63 93.5 64 80.5 65 74.0 66 82.5 67 75.5 68 75.5 69 80.0 70 65.5 71 56.5 72 49.0 73 48.0 74 41.0 75 31.0 76 32.5 77 27.5 78 18.5 79 11.5 80 9.5 81 9.5 82 7.5 83 5.0 84 2.0 85 1.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.579199194157643 1.15 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0125 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.075 0.0 0.0 0.0 0.025 82-83 0.075 0.0 0.0 0.0 0.025 84-85 0.075 0.0 0.0 0.0 0.025 86-87 0.1125 0.0 0.0 0.0 0.025 88-89 0.125 0.0 0.0 0.0 0.025 90-91 0.16249999999999998 0.0 0.0 0.0 0.025 92-93 0.175 0.0 0.0 0.0 0.025 94-95 0.1875 0.0 0.0 0.0 0.025 96-97 0.21250000000000002 0.0 0.0 0.0 0.025 98-99 0.3625 0.0 0.0 0.0 0.025 100-101 0.44999999999999996 0.0 0.0 0.0 0.025 102-103 0.5 0.0 0.0 0.0 0.025 104-105 0.6625 0.0 0.0 0.0 0.025 106-107 0.9750000000000001 0.0 0.0 0.0 0.025 108-109 1.1875 0.0 0.0 0.0 0.025 110-111 1.3375 0.0 0.0 0.0 0.025 112-113 1.6875 0.0 0.0 0.0 0.025 114-115 2.075 0.0 0.0 0.0 0.025 116-117 2.4749999999999996 0.0 0.0 0.0 0.025 118-119 2.7874999999999996 0.0 0.0 0.0 0.025 120-121 3.2874999999999996 0.0 0.0 0.0 0.025 122-123 3.7875 0.0 0.0 0.0 0.025 124-125 4.425 0.0 0.0 0.0 0.025 126-127 5.1625 0.0 0.0 0.0 0.025 128-129 5.9 0.0 0.0 0.0 0.025 130-131 6.45 0.0 0.0 0.0 0.025 132-133 7.1875 0.0 0.0 0.0 0.025 134-135 7.9750000000000005 0.0 0.0 0.0 0.025 136-137 8.7 0.0 0.0 0.0 0.025 138-139 9.55 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGCCT 10 0.006830828 145.0 5 >>END_MODULE SRR14458931 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14458931_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.38025 32.0 32.0 32.0 32.0 32.0 2 31.2125 32.0 32.0 32.0 32.0 32.0 3 31.22925 32.0 32.0 32.0 32.0 32.0 4 31.18125 32.0 32.0 32.0 32.0 32.0 5 31.32925 32.0 32.0 32.0 32.0 32.0 6 34.77025 36.0 36.0 36.0 32.0 36.0 7 34.902 36.0 36.0 36.0 32.0 36.0 8 34.81925 36.0 36.0 36.0 32.0 36.0 9 34.7695 36.0 36.0 36.0 32.0 36.0 10-14 34.82775 36.0 36.0 36.0 32.8 36.0 15-19 34.70115 36.0 36.0 36.0 32.0 36.0 20-24 34.6562 36.0 36.0 36.0 32.0 36.0 25-29 34.67705 36.0 36.0 36.0 32.0 36.0 30-34 34.632749999999994 36.0 36.0 36.0 32.0 36.0 35-39 34.594350000000006 36.0 36.0 36.0 32.0 36.0 40-44 34.612300000000005 36.0 36.0 36.0 32.0 36.0 45-49 34.5548 36.0 36.0 36.0 32.0 36.0 50-54 34.49535 36.0 36.0 36.0 32.0 36.0 55-59 34.38135 36.0 36.0 36.0 32.0 36.0 60-64 34.40075 36.0 36.0 36.0 32.0 36.0 65-69 34.22095 36.0 36.0 36.0 32.0 36.0 70-74 34.1644 36.0 36.0 36.0 32.0 36.0 75-79 33.9944 36.0 36.0 36.0 31.0 36.0 80-84 33.934349999999995 36.0 36.0 36.0 31.0 36.0 85-89 33.70725 36.0 36.0 36.0 28.0 36.0 90-94 33.686800000000005 36.0 36.0 36.0 27.0 36.0 95-99 33.6312 36.0 36.0 36.0 27.0 36.0 100-104 33.7003 36.0 36.0 36.0 27.0 36.0 105-109 33.5723 36.0 36.0 36.0 27.0 36.0 110-114 33.439550000000004 36.0 35.2 36.0 27.0 36.0 115-119 33.3589 36.0 33.6 36.0 27.0 36.0 120-124 33.31795 36.0 35.2 36.0 27.0 36.0 125-129 33.288149999999995 36.0 35.2 36.0 27.0 36.0 130-134 33.27115 36.0 35.2 36.0 27.0 36.0 135-139 32.8557 36.0 32.0 36.0 25.8 36.0 140-144 32.942299999999996 36.0 32.0 36.0 25.8 36.0 145-149 32.49145 36.0 32.0 36.0 24.6 36.0 150-151 30.169874999999998 34.0 29.5 36.0 20.5 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 3.0 18 2.0 19 4.0 20 3.0 21 2.0 22 13.0 23 11.0 24 21.0 25 26.0 26 43.0 27 51.0 28 77.0 29 107.0 30 124.0 31 184.0 32 244.0 33 398.0 34 810.0 35 1875.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.15578894723681 11.47786946736684 10.252563140785197 55.11377844461115 2 24.85 16.25 36.05 22.85 3 24.075 20.95 24.474999999999998 30.5 4 27.825 26.5 17.625 28.050000000000004 5 28.549999999999997 29.625 19.8 22.025 6 22.175 33.125 20.150000000000002 24.55 7 22.075 15.375 37.15 25.4 8 21.224999999999998 19.25 26.5 33.025 9 22.125 19.900000000000002 28.95 29.025000000000002 10-14 24.95 24.349999999999998 22.835 27.865000000000002 15-19 25.264999999999997 23.59 23.235 27.91 20-24 25.380000000000003 23.599999999999998 23.43 27.589999999999996 25-29 25.650000000000002 23.369999999999997 23.555 27.425 30-34 25.840000000000003 23.86 22.745 27.555000000000003 35-39 25.31 23.525 22.95 28.215 40-44 26.029999999999998 23.59 22.675 27.705000000000002 45-49 26.465 23.06 22.91 27.565 50-54 26.025 23.505000000000003 22.84 27.63 55-59 26.185000000000002 23.31 23.06 27.445000000000004 60-64 26.07 23.794999999999998 22.64 27.495000000000005 65-69 26.105 23.56 22.915 27.42 70-74 25.495 23.205000000000002 23.485 27.815 75-79 26.825 22.835 22.795 27.544999999999998 80-84 26.795 23.085 22.64 27.48 85-89 26.419999999999998 23.115 22.62 27.845 90-94 26.334999999999997 22.895 23.18 27.589999999999996 95-99 26.405 23.115 23.005 27.474999999999998 100-104 27.095000000000002 23.29 22.54 27.075 105-109 26.97 23.335 22.61 27.084999999999997 110-114 26.865 23.01 22.955000000000002 27.169999999999998 115-119 26.834999999999997 23.400000000000002 22.555 27.21 120-124 27.939999999999998 23.3 22.259999999999998 26.5 125-129 28.249999999999996 23.0 22.39 26.36 130-134 28.000000000000004 23.66 21.975 26.365 135-139 28.765 23.419999999999998 22.355 25.46 140-144 28.87 23.84 22.355 24.935 145-149 29.15 23.945 22.045 24.86 150-151 29.45 23.549999999999997 22.3875 24.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 2.0 29 2.0 30 2.5 31 5.0 32 7.0 33 10.5 34 15.0 35 24.5 36 31.0 37 44.5 38 60.5 39 71.5 40 79.5 41 90.0 42 112.0 43 127.0 44 142.0 45 159.5 46 158.0 47 149.5 48 156.5 49 148.5 50 129.5 51 113.5 52 116.0 53 118.5 54 105.5 55 105.5 56 106.0 57 105.5 58 98.0 59 95.5 60 100.5 61 97.0 62 98.5 63 97.5 64 87.0 65 80.5 66 73.0 67 83.0 68 84.0 69 78.5 70 85.0 71 67.5 72 50.5 73 48.0 74 42.5 75 29.0 76 23.5 77 21.5 78 19.0 79 16.5 80 9.5 81 4.0 82 1.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.6809583858764187 1.35 3 0.025220680958385876 0.075 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 7.2375 0.0 0.0 0.0 0.0 134-135 8.0 0.0 0.0 0.0 0.0 136-137 8.774999999999999 0.0 0.0 0.0 0.0 138-139 9.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGTGT 10 0.006830828 145.0 3 CTCGATA 10 0.006830828 145.0 2 >>END_MODULE Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917122 spots for SRR14458931.sra Written 917122 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra Read 917105 spots for SRR14458931.sra Written 917105 spots for SRR14458931.sra SRR ids: ['SRR14458931.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2x26qbjq SRR14458931.sra spots: 18342117 blocks: [[1, 917105], [917106, 1834210], [1834211, 2751315], [2751316, 3668420], [3668421, 4585525], [4585526, 5502630], [5502631, 6419735], [6419736, 7336840], [7336841, 8253945], [8253946, 9171050], [9171051, 10088155], [10088156, 11005260], [11005261, 11922365], [11922366, 12839470], [12839471, 13756575], [13756576, 14673680], [14673681, 15590785], [15590786, 16507890], [16507891, 17424995], [17424996, 18342117]] SRR14458931 file size 6211753 SRR14458931 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14458931 SRR14458931_1.fastq SRR14458931_2.fastq Input file: SRR14458931_1.fastq Paired file: SRR14458931_2.fastq trimmed: SRR14458931-trimmed-pair1.fastq, SRR14458931-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:17:56 2024 >> started Fri Dec 6 10:18:25 2024 >> done (29.066s) 18342117 read pairs processed; of these: 4240 ( 0.02%) short read pairs filtered out after trimming by size control 1353 ( 0.01%) empty read pairs filtered out after trimming by size control 18336524 (99.97%) read pairs available; of these: 2929709 (15.98%) trimmed read pairs available after processing 15406815 (84.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 208 0.00% 19 253 0.00% 20 200 0.00% 21 230 0.00% 22 168 0.00% 23 184 0.00% 24 199 0.00% 25 166 0.00% 26 135 0.00% 27 165 0.00% 28 136 0.00% 29 176 0.00% 30 131 0.00% 31 139 0.00% 32 162 0.00% 33 107 0.00% 34 354 0.00% 35 133 0.00% 36 131 0.00% 37 133 0.00% 38 122 0.00% 39 136 0.00% 40 115 0.00% 41 150 0.00% 42 148 0.00% 43 141 0.00% 44 120 0.00% 45 123 0.00% 46 108 0.00% 47 159 0.00% 48 149 0.00% 49 153 0.00% 50 152 0.00% 51 153 0.00% 52 155 0.00% 53 173 0.00% 54 159 0.00% 55 153 0.00% 56 161 0.00% 57 189 0.00% 58 207 0.00% 59 179 0.00% 60 263 0.00% 61 245 0.00% 62 244 0.00% 63 245 0.00% 64 256 0.00% 65 266 0.00% 66 284 0.00% 67 340 0.00% 68 370 0.00% 69 343 0.00% 70 421 0.00% 71 519 0.00% 72 498 0.00% 73 539 0.00% 74 575 0.00% 75 580 0.00% 76 614 0.00% 77 665 0.00% 78 714 0.00% 79 811 0.00% 80 958 0.01% 81 1196 0.01% 82 1331 0.01% 83 1519 0.01% 84 1657 0.01% 85 1868 0.01% 86 2002 0.01% 87 2136 0.01% 88 2337 0.01% 89 2876 0.02% 90 3115 0.02% 91 3740 0.02% 92 4314 0.02% 93 4969 0.03% 94 5634 0.03% 95 6152 0.03% 96 6542 0.04% 97 7245 0.04% 98 7949 0.04% 99 8762 0.05% 100 9936 0.05% 101 11230 0.06% 102 12559 0.07% 103 14198 0.08% 104 15754 0.09% 105 17111 0.09% 106 18450 0.10% 107 19900 0.11% 108 21229 0.12% 109 22847 0.12% 110 23991 0.13% 111 26725 0.15% 112 29541 0.16% 113 32264 0.18% 114 34963 0.19% 115 37813 0.21% 116 39028 0.21% 117 40564 0.22% 118 42464 0.23% 119 43851 0.24% 120 45777 0.25% 121 48521 0.26% 122 52373 0.29% 123 54831 0.30% 124 58660 0.32% 125 61273 0.33% 126 62610 0.34% 127 64129 0.35% 128 65702 0.36% 129 65802 0.36% 130 67261 0.37% 131 69574 0.38% 132 71565 0.39% 133 75006 0.41% 134 78242 0.43% 135 79893 0.44% 136 82097 0.45% 137 82452 0.45% 138 82199 0.45% 139 83330 0.45% 140 82693 0.45% 141 82947 0.45% 142 85709 0.47% 143 86529 0.47% 144 88003 0.48% 145 89903 0.49% 146 90435 0.49% 147 91404 0.50% 148 92755 0.51% 149 91225 0.50% 150 90482 0.49% 151 15406815 84.02% 18336524 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=10 prefix-density=0.53 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=25.21 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=7 prefix-density=0.56 prefix-fanout=3.3 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=25.57 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR14458931 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:19:48 Started mapping on | Dec 06 10:19:49 Finished on | Dec 06 10:21:44 Mapping speed, Million of reads per hour | 574.01 Number of input reads | 18336524 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17305650 Uniquely mapped reads % | 94.38% Average mapped length | 293.39 Number of splices: Total | 17562669 Number of splices: Annotated (sjdb) | 16554148 Number of splices: GT/AG | 17325712 Number of splices: GC/AG | 201272 Number of splices: AT/AC | 6859 Number of splices: Non-canonical | 28826 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250706 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 38165 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 1.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 780168 780168 780168 N_multimapping 250706 250706 250706 N_noFeature 514241 8737931 8780199 N_ambiguous 392772 48140 47246 UnstrandedReadsAssigned:16398637 PositiveStrandReadsAssigned:8519579 NegativeStrandReadsAssigned:8478205 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR14458931 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR14458931-trimmed-pair1.fastq SRR14458931-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,336,524 reads, 17,122,404 reads pseudoaligned [quant] estimated average fragment length: 249.5 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52973 SRR14458931.ke.tsv 35125 SRR14458931.se.tsv 88098 total ==> SRR14458931.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.869 2.90567e-07 3.23849e-08 PNS24247 1044 795.5 21.2375 2.04675 PNS24249 1928 1679.5 128.74 5.87671 PNS24246 1044 795.5 21.2375 2.04675 PNS24248 1044 795.5 21.2375 2.04675 PNS24244 1471 1222.5 19.5477 1.22588 PNS24243 293 103.265 2 1.48483 KQK14069 1603 1354.5 5415.27 306.509 KQK14071 474 244.601 131.086 41.0865 ==> SRR14458931.se.tsv <== BRADI_1g14170v3 6102 BRADI_1g53295v3 51 BRADI_1g59795v3 242 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2319 BRADI_1g74790v3 532 BRADI_1g09890v3 12 BRADI_1g77505v3 354 BRADI_1g48960v3 0 SRR14458931 completed mapping pipeline successfully