Starting /dee2/code/volunteer_pipeline.sh SRR1635409 current disk space = 1523755282432 free memory = 1598109644 SRR1635409 SRAfilesize c9d554d0529bbddb34294853ed0299fb SRR1635409.sra SRR1635409.sra file validated SRR1635409 is paired end SRR1635409 is conventional basespace SRR1635409 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1635409_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.29075 34.0 31.0 34.0 31.0 34.0 2 32.70125 34.0 31.0 34.0 31.0 34.0 3 33.0065 34.0 31.0 34.0 31.0 34.0 4 36.42625 37.0 37.0 37.0 35.0 37.0 5 36.3345 37.0 37.0 37.0 35.0 37.0 6 36.35775 37.0 37.0 37.0 35.0 37.0 7 36.36675 37.0 37.0 37.0 35.0 37.0 8 36.37925 37.0 37.0 37.0 35.0 37.0 9 38.154 39.0 39.0 39.0 37.0 39.0 10-11 38.173500000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.15325 39.0 39.0 39.0 37.0 39.0 14-15 39.619 41.0 40.0 41.0 37.0 41.0 16-17 39.554125 41.0 39.5 41.0 37.0 41.0 18-19 39.423 41.0 39.5 41.0 36.0 41.0 20-21 39.35475 41.0 39.0 41.0 36.5 41.0 22-23 39.41875 41.0 39.0 41.0 36.5 41.0 24-25 39.4625 41.0 39.0 41.0 36.5 41.0 26-27 39.371750000000006 41.0 39.0 41.0 36.0 41.0 28-29 39.364625000000004 41.0 39.0 41.0 36.0 41.0 30-31 39.168499999999995 41.0 39.0 41.0 35.5 41.0 32-33 39.06725 41.0 39.0 41.0 35.0 41.0 34-35 38.9735 40.5 38.5 41.0 35.0 41.0 36-37 38.81462500000001 40.0 38.0 41.0 35.0 41.0 38-39 38.64375 40.0 38.0 41.0 35.0 41.0 40-41 38.601375000000004 40.0 38.0 41.0 34.5 41.0 42-43 38.473875 40.0 38.0 41.0 34.5 41.0 44-45 38.0205 40.0 37.0 41.0 33.5 41.0 46-47 37.985875 40.0 36.5 41.0 33.5 41.0 48-49 37.7745 40.0 36.0 41.0 33.0 41.0 50-51 37.616125 39.5 35.0 41.0 33.0 41.0 52-53 37.58725 39.0 35.0 41.0 33.0 41.0 54-55 37.322500000000005 39.0 35.0 41.0 33.0 41.0 56-57 37.1395 39.0 35.0 41.0 33.0 41.0 58-59 36.77975 38.5 35.0 41.0 32.5 41.0 60-61 36.64812499999999 37.5 35.0 40.5 32.0 41.0 62-63 36.419875000000005 37.0 35.0 40.0 33.0 41.0 64-65 36.150999999999996 36.5 35.0 40.0 32.0 41.0 66-67 35.769125 36.0 35.0 39.0 32.0 41.0 68-69 35.573125 35.5 35.0 39.0 32.0 41.0 70-71 35.166875000000005 35.0 35.0 38.5 31.0 40.5 72-73 34.995374999999996 35.0 35.0 37.0 31.5 39.5 74-75 34.6355 35.0 34.0 37.0 31.0 39.0 76-77 34.307625 35.0 34.0 36.5 31.0 39.0 78-79 34.002250000000004 35.0 34.0 36.0 30.5 37.5 80-81 33.822 35.0 34.0 35.5 31.0 37.0 82-83 33.616749999999996 35.0 34.0 35.0 30.5 36.5 84-85 33.402 35.0 34.0 35.0 29.5 36.0 86-87 33.105375 35.0 34.0 35.0 29.5 36.0 88-89 33.133125 35.0 34.0 35.0 30.0 36.0 90-91 32.902125 35.0 33.5 35.0 29.5 35.5 92-93 32.882875 35.0 34.0 35.0 29.0 35.0 94-95 32.90575 35.0 34.0 35.0 30.0 35.0 96-97 32.887125 35.0 34.0 35.0 30.0 35.0 98-99 32.68775 35.0 34.0 35.0 29.5 35.0 100 32.631 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 3.0 10 1.0 11 2.0 12 0.0 13 1.0 14 3.0 15 3.0 16 6.0 17 5.0 18 8.0 19 3.0 20 2.0 21 9.0 22 10.0 23 6.0 24 3.0 25 12.0 26 17.0 27 18.0 28 28.0 29 35.0 30 57.0 31 69.0 32 72.0 33 120.0 34 166.0 35 310.0 36 628.0 37 995.0 38 1150.0 39 256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.085911531577604 14.36972641268218 13.67936589107645 47.86499616466377 2 26.813406703351678 20.66033016508254 32.99149574787394 19.534767383691847 3 24.95 25.650000000000002 24.075 25.324999999999996 4 27.1 29.425 17.9 25.575 5 27.800000000000004 32.5 18.75 20.95 6 21.175 34.150000000000006 20.05 24.625 7 20.4 15.075 39.2 25.324999999999996 8 21.8 19.375 25.3 33.525 9 21.55 20.575 28.000000000000004 29.875 10-11 26.187500000000004 28.0875 19.75 25.974999999999998 12-13 24.0125 22.2 26.887499999999996 26.900000000000002 14-15 24.44361090272568 24.681170292573142 24.831207801950487 26.04401100275069 16-17 25.7375 24.15 24.0 26.1125 18-19 25.0375 24.5125 24.2625 26.187500000000004 20-21 24.9375 25.087500000000002 24.25 25.724999999999998 22-23 25.224999999999998 24.2375 24.587500000000002 25.95 24-25 25.35 25.35 24.025 25.275 26-27 25.662499999999998 24.6625 24.587500000000002 25.087500000000002 28-29 24.887500000000003 24.212500000000002 24.224999999999998 26.674999999999997 30-31 24.425 25.7375 24.125 25.7125 32-33 25.018754688672168 25.656414103525883 23.543385846461614 25.78144536134033 34-35 25.362499999999997 24.3875 24.775 25.474999999999998 36-37 25.7375 24.6 23.849999999999998 25.8125 38-39 25.5125 25.124999999999996 23.8875 25.474999999999998 40-41 25.7375 24.45 24.9875 24.825 42-43 25.825 24.337500000000002 24.887500000000003 24.95 44-45 24.762500000000003 25.2 24.9375 25.1 46-47 24.6625 24.887500000000003 24.925 25.525 48-49 24.85 25.45 23.849999999999998 25.85 50-51 24.95 25.15 24.349999999999998 25.55 52-53 25.8625 24.4125 24.325 25.4 54-55 25.4375 24.337500000000002 25.0 25.224999999999998 56-57 25.874999999999996 25.4 24.05 24.675 58-59 25.55 23.4875 24.5625 26.400000000000002 60-61 25.8125 25.7 23.8125 24.675 62-63 25.3 25.1875 24.099999999999998 25.412499999999998 64-65 24.9875 24.65 25.1 25.2625 66-67 24.95 25.374999999999996 24.712500000000002 24.962500000000002 68-69 25.137500000000003 24.125 24.875 25.8625 70-71 26.237500000000004 23.962500000000002 25.074999999999996 24.725 72-73 25.2375 24.5125 24.8125 25.4375 74-75 25.2125 24.9 24.337500000000002 25.55 76-77 25.662499999999998 24.3125 23.9 26.125 78-79 25.95 24.575 24.0125 25.4625 80-81 25.575 24.712500000000002 24.1875 25.525 82-83 26.1 24.5375 23.8125 25.55 84-85 25.4625 24.3 25.162499999999998 25.074999999999996 86-87 25.912499999999998 24.087500000000002 24.099999999999998 25.900000000000002 88-89 25.387500000000003 25.2375 23.7875 25.587500000000002 90-91 25.775 24.7 24.45 25.074999999999996 92-93 25.1 24.975 25.025 24.9 94-95 25.9625 24.4 24.3125 25.324999999999996 96-97 25.85 25.387500000000003 23.625 25.137500000000003 98-99 25.7625 25.112499999999997 23.3625 25.7625 100 25.95 25.124999999999996 23.75 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 3.0 29 3.0 30 3.5 31 3.0 32 7.0 33 15.5 34 24.5 35 27.5 36 37.0 37 56.0 38 74.5 39 95.5 40 108.5 41 134.5 42 158.5 43 161.0 44 170.0 45 190.0 46 195.5 47 177.0 48 169.5 49 158.5 50 129.5 51 119.5 52 118.5 53 108.5 54 106.5 55 105.5 56 100.5 57 92.5 58 90.0 59 93.5 60 90.5 61 85.0 62 92.0 63 83.5 64 73.5 65 85.0 66 80.0 67 70.0 68 68.0 69 59.5 70 49.0 71 40.0 72 27.0 73 21.5 74 15.0 75 6.5 76 3.5 77 2.0 78 1.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.025 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1635409 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1635409_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.293 34.0 31.0 34.0 30.0 34.0 2 32.44225 34.0 31.0 34.0 31.0 34.0 3 32.36375 34.0 31.0 34.0 30.0 34.0 4 35.75725 37.0 37.0 37.0 35.0 37.0 5 35.81975 37.0 37.0 37.0 35.0 37.0 6 35.8425 37.0 37.0 37.0 35.0 37.0 7 35.83025 37.0 37.0 37.0 35.0 37.0 8 35.77025 37.0 37.0 37.0 35.0 37.0 9 37.524 39.0 38.0 39.0 35.0 39.0 10-11 37.200625 39.0 37.5 39.0 34.0 39.0 12-13 37.232 39.0 38.0 39.0 35.0 39.0 14-15 38.60575 41.0 38.5 41.0 34.5 41.0 16-17 38.658625 41.0 38.5 41.0 35.0 41.0 18-19 38.706625 41.0 39.0 41.0 35.5 41.0 20-21 38.648375 41.0 39.0 41.0 35.0 41.0 22-23 38.541250000000005 40.5 39.0 41.0 35.0 41.0 24-25 38.56525 40.5 39.0 41.0 34.5 41.0 26-27 38.383250000000004 40.0 38.5 41.0 34.0 41.0 28-29 38.256125 40.0 38.5 41.0 33.5 41.0 30-31 38.29075 40.0 38.0 41.0 34.0 41.0 32-33 38.2445 40.0 38.0 41.0 34.0 41.0 34-35 37.908500000000004 40.0 38.0 41.0 33.0 41.0 36-37 37.750625 40.0 37.5 41.0 33.0 41.0 38-39 37.58425 40.0 37.5 41.0 33.0 41.0 40-41 37.57425 40.0 37.0 41.0 33.0 41.0 42-43 37.255375 40.0 37.0 41.0 32.0 41.0 44-45 37.119375000000005 40.0 36.0 41.0 32.0 41.0 46-47 36.883375 40.0 36.0 41.0 31.5 41.0 48-49 36.843374999999995 39.5 35.5 41.0 31.5 41.0 50-51 36.513125 39.0 35.0 41.0 30.5 41.0 52-53 36.448375 39.0 35.0 41.0 31.0 41.0 54-55 36.319375 39.0 35.0 41.0 31.0 41.0 56-57 35.924875 38.0 35.0 41.0 30.5 41.0 58-59 35.821250000000006 38.0 35.0 41.0 31.0 41.0 60-61 35.5155 37.0 35.0 40.0 30.5 41.0 62-63 35.200625 36.5 35.0 40.0 30.0 41.0 64-65 34.82225 36.0 34.0 39.5 29.0 41.0 66-67 34.61825 35.0 34.0 39.0 29.0 41.0 68-69 34.298 35.0 34.0 39.0 29.0 41.0 70-71 33.9825 35.0 34.0 37.5 29.0 40.0 72-73 33.63575 35.0 34.0 37.0 29.0 39.5 74-75 33.37775 35.0 34.0 37.0 28.0 39.0 76-77 33.016999999999996 35.0 33.0 36.0 27.0 39.0 78-79 32.7355 35.0 33.0 36.0 27.0 37.5 80-81 32.547625 35.0 33.0 35.0 27.0 37.0 82-83 32.048125 35.0 33.0 35.0 26.0 36.5 84-85 32.019125 35.0 33.0 35.0 26.0 36.0 86-87 31.912625 35.0 33.0 35.0 26.0 36.0 88-89 31.68575 35.0 33.0 35.0 25.5 36.0 90-91 31.418875 35.0 32.5 35.0 24.0 35.0 92-93 31.370874999999998 35.0 33.0 35.0 24.0 35.0 94-95 31.059375000000003 35.0 32.0 35.0 23.5 35.0 96-97 31.363875 35.0 33.0 35.0 24.5 35.0 98-99 31.39575 35.0 33.0 35.0 25.0 35.0 100 31.31675 35.0 33.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 8.0 4 7.0 5 7.0 6 6.0 7 4.0 8 6.0 9 10.0 10 4.0 11 5.0 12 7.0 13 9.0 14 6.0 15 6.0 16 11.0 17 10.0 18 3.0 19 11.0 20 5.0 21 10.0 22 10.0 23 15.0 24 12.0 25 19.0 26 19.0 27 33.0 28 22.0 29 44.0 30 56.0 31 76.0 32 83.0 33 129.0 34 197.0 35 334.0 36 635.0 37 899.0 38 1041.0 39 212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.91345672836418 13.406703351675839 12.856428214107055 46.823411705852926 2 27.270452839629723 19.06429822366775 32.974731048286216 20.690517888416313 3 24.34325744308231 24.843632724543408 23.692769577182887 27.120340255191394 4 25.88883324987481 29.744616925388083 18.102153229844767 26.264396594892336 5 27.95994993742178 31.939924906132667 19.22403003754693 20.876095118898625 6 20.06010518407213 33.93438517405459 19.734535437014774 26.270974204858504 7 19.634360130227897 13.799148509892312 40.52091159529176 26.045579764588027 8 21.738041572752316 19.133483596293512 26.045579764588027 33.08289506636614 9 21.09746930593836 19.919819594086697 28.263593084439993 30.719118015534953 10-11 26.87875751503006 27.241983967935873 19.614228456913825 26.265030060120242 12-13 22.95164119268354 22.112252568278628 27.186168879979956 27.74993735905788 14-15 24.849624060150376 23.847117794486216 24.235588972431078 27.06766917293233 16-17 25.877192982456144 23.684210526315788 24.135338345864664 26.303258145363408 18-19 25.213032581453632 23.884711779448622 23.884711779448622 27.017543859649123 20-21 24.75557783905741 24.868388067184757 24.22913010779644 26.146903985961394 22-23 25.570318375532715 23.990975181749814 24.46728503384307 25.971421408874406 24-25 25.047010154193305 23.580293343362165 24.15695123480005 27.215745267644476 26-27 25.02193807195688 25.2099786887301 23.943838535790395 25.824244703522623 28-29 25.705329153605017 23.899686520376175 23.786833855799372 26.60815047021944 30-31 24.49542434499185 25.072082236429736 24.119343111445403 26.31315030713301 32-33 25.742946708463947 25.329153605015676 23.849529780564264 25.07836990595611 34-35 26.003512293025587 23.99648770697441 24.422980431510286 25.57701956848971 36-37 25.6362040867494 23.943838535790395 24.808825372947226 25.611132004512978 38-39 24.777429467084637 24.351097178683386 24.96551724137931 25.905956112852664 40-41 25.078330617871913 24.877804236119815 23.77490913648327 26.268956009525002 42-43 24.72107308511972 24.482888303873636 24.29484768710041 26.501190923906233 44-45 24.134904714142426 25.075225677031092 24.974924774322968 25.81494483450351 46-47 24.084754262788366 25.162988966900702 25.012537612838514 25.73971915747242 48-49 25.31962897969416 23.251441464026072 24.893457006768614 26.53547254951116 50-51 24.720933149379153 25.348049667628246 24.006020318575192 25.92499686441741 52-53 25.169215342191027 24.993732765104035 23.451992980696918 26.385058912008024 54-55 24.82447342026078 24.837011033099298 23.884152457372114 26.4543630892678 56-57 25.10969035978438 25.49830763444904 24.72107308511972 24.67092892064686 58-59 24.492353973426926 23.978440711957884 25.14414640260717 26.385058912008024 60-61 25.38847117794486 24.348370927318296 24.285714285714285 25.977443609022554 62-63 25.482577086989224 24.266733517172224 24.17899222862873 26.071697167209827 64-65 25.438816449348046 25.175526579739216 23.68355065195587 25.70210631895687 66-67 25.36359077231695 24.12236710130391 24.849548645937812 25.664493480441326 68-69 26.52370203160271 24.341610233258088 24.20366190117883 24.931025833960373 70-71 24.974924774322968 24.811935807422266 24.398194583751255 25.81494483450351 72-73 25.269491100526448 25.344697919278016 23.853096014038606 25.532714966156934 74-75 25.22567703109328 24.310431293881646 23.82146439317954 26.64242728184554 76-77 25.530046418266217 24.99059089198344 23.79877054321917 25.68059214653118 78-79 25.02508780732564 25.03763171098846 24.448068238835926 25.489212242849973 80-81 24.78053674441936 24.39177326310509 24.943566591422123 25.884123401053422 82-83 25.733634311512414 23.940305994482067 25.156759468271883 25.169300225733632 84-85 24.981179422835634 24.416562107904642 25.282308657465496 25.319949811794228 86-87 25.555137372977043 24.55149918454397 24.400953456279012 25.492409986199977 88-89 26.42409033877039 23.651191969887076 24.353826850690087 25.57089084065245 90-91 25.460930640913084 24.106358961495044 24.971779756678792 25.460930640913084 92-93 24.971779756678792 24.520255863539443 24.60805217609432 25.899912203687446 94-95 25.1254390366282 24.7491219267436 24.498243853487207 25.627195183140994 96-97 25.0 25.388861013547416 23.808329152032112 25.802809834420472 98-99 25.784190715181932 25.282308657465496 23.93977415307403 24.993726474278542 100 24.943538268506902 24.11543287327478 24.66750313676286 26.27352572145546 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.5 2 2.0 3 1.0 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 3.0 29 3.5 30 4.5 31 6.0 32 7.0 33 16.5 34 27.0 35 28.0 36 40.0 37 62.0 38 78.0 39 93.5 40 109.5 41 123.5 42 144.5 43 152.5 44 150.5 45 165.5 46 169.5 47 170.5 48 170.5 49 159.5 50 147.5 51 137.0 52 119.5 53 111.0 54 114.0 55 110.0 56 100.0 57 92.5 58 91.0 59 88.0 60 93.0 61 94.5 62 95.5 63 94.0 64 85.5 65 76.0 66 80.0 67 81.5 68 66.0 69 51.5 70 42.5 71 32.0 72 23.5 73 24.0 74 18.0 75 12.0 76 8.5 77 5.5 78 2.5 79 1.0 80 1.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.075 4 0.15 5 0.125 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.22499999999999998 10-11 0.2 12-13 0.22499999999999998 14-15 0.25 16-17 0.25 18-19 0.25 20-21 0.27499999999999997 22-23 0.27499999999999997 24-25 0.2875 26-27 0.2875 28-29 0.3125 30-31 0.2875 32-33 0.3125 34-35 0.35000000000000003 36-37 0.2875 38-39 0.3125 40-41 0.2625 42-43 0.2875 44-45 0.3 46-47 0.3 48-49 0.27499999999999997 50-51 0.3375 52-53 0.27499999999999997 54-55 0.3 56-57 0.2875 58-59 0.27499999999999997 60-61 0.25 62-63 0.27499999999999997 64-65 0.3 66-67 0.3 68-69 0.325 70-71 0.3 72-73 0.27499999999999997 74-75 0.3 76-77 0.36250000000000004 78-79 0.35000000000000003 80-81 0.325 82-83 0.325 84-85 0.375 86-87 0.36250000000000004 88-89 0.375 90-91 0.3375 92-93 0.3375 94-95 0.35000000000000003 96-97 0.35000000000000003 98-99 0.375 100 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506307 spots for SRR1635409.sra Written 506307 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra Read 506304 spots for SRR1635409.sra Written 506304 spots for SRR1635409.sra SRR ids: ['SRR1635409.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uitqr6k3 SRR1635409.sra spots: 10126083 blocks: [[1, 506304], [506305, 1012608], [1012609, 1518912], [1518913, 2025216], [2025217, 2531520], [2531521, 3037824], [3037825, 3544128], [3544129, 4050432], [4050433, 4556736], [4556737, 5063040], [5063041, 5569344], [5569345, 6075648], [6075649, 6581952], [6581953, 7088256], [7088257, 7594560], [7594561, 8100864], [8100865, 8607168], [8607169, 9113472], [9113473, 9619776], [9619777, 10126083]] SRR1635409 file size 2743014 SRR1635409 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1635409 SRR1635409_1.fastq SRR1635409_2.fastq Input file: SRR1635409_1.fastq Paired file: SRR1635409_2.fastq trimmed: SRR1635409-trimmed-pair1.fastq, SRR1635409-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:11:57 2024 >> started Tue Dec 10 01:12:08 2024 >> done (10.510s) 10126083 read pairs processed; of these: 51710 ( 0.51%) short read pairs filtered out after trimming by size control 84144 ( 0.83%) empty read pairs filtered out after trimming by size control 9990229 (98.66%) read pairs available; of these: 1196324 (11.97%) trimmed read pairs available after processing 8793905 (88.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 20 0.00% 21 28 0.00% 22 70 0.00% 23 87 0.00% 24 111 0.00% 25 184 0.00% 26 185 0.00% 27 200 0.00% 28 304 0.00% 29 339 0.00% 30 384 0.00% 31 469 0.00% 32 474 0.00% 33 536 0.01% 34 556 0.01% 35 668 0.01% 36 749 0.01% 37 765 0.01% 38 844 0.01% 39 895 0.01% 40 954 0.01% 41 1016 0.01% 42 1067 0.01% 43 1092 0.01% 44 1282 0.01% 45 1300 0.01% 46 1400 0.01% 47 1483 0.01% 48 1553 0.02% 49 1701 0.02% 50 1793 0.02% 51 1875 0.02% 52 1989 0.02% 53 2212 0.02% 54 2341 0.02% 55 2539 0.03% 56 2880 0.03% 57 3172 0.03% 58 3426 0.03% 59 8220 0.08% 60 8566 0.09% 61 9334 0.09% 62 9987 0.10% 63 10817 0.11% 64 11219 0.11% 65 12041 0.12% 66 12524 0.13% 67 13276 0.13% 68 13686 0.14% 69 14173 0.14% 70 14615 0.15% 71 15361 0.15% 72 15195 0.15% 73 15225 0.15% 74 15174 0.15% 75 15674 0.16% 76 16120 0.16% 77 16387 0.16% 78 16917 0.17% 79 17115 0.17% 80 17413 0.17% 81 18289 0.18% 82 18732 0.19% 83 19716 0.20% 84 20218 0.20% 85 21324 0.21% 86 24460 0.24% 87 25784 0.26% 88 27455 0.27% 89 29546 0.30% 90 31887 0.32% 91 35288 0.35% 92 39551 0.40% 93 45232 0.45% 94 52006 0.52% 95 60659 0.61% 96 72606 0.73% 97 87628 0.88% 98 113507 1.14% 99 110437 1.11% 100 8793905 88.03% 9990229 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=13 prefix-density=0.20 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=15.97 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=15 prefix-density=0.19 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=34 fanout-score=16.08 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR1635409 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:12:46 Started mapping on | Dec 10 01:12:46 Finished on | Dec 10 01:13:15 Mapping speed, Million of reads per hour | 1240.17 Number of input reads | 9990229 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 9723160 Uniquely mapped reads % | 97.33% Average mapped length | 196.07 Number of splices: Total | 6391151 Number of splices: Annotated (sjdb) | 6070813 Number of splices: GT/AG | 6305164 Number of splices: GC/AG | 74528 Number of splices: AT/AC | 3325 Number of splices: Non-canonical | 8134 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 121541 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 9852 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 152035 152035 152035 N_multimapping 121541 121541 121541 N_noFeature 283436 4907775 4924809 N_ambiguous 197148 12081 11990 UnstrandedReadsAssigned:9242576 PositiveStrandReadsAssigned:4803304 NegativeStrandReadsAssigned:4786361 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1635409 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1635409-trimmed-pair1.fastq SRR1635409-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,990,229 reads, 9,512,773 reads pseudoaligned [quant] estimated average fragment length: 168.449 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52973 SRR1635409.ke.tsv 35125 SRR1635409.se.tsv 88098 total ==> SRR1635409.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.758 2.976e-05 5.8e-06 PNS24247 1044 876.551 25.1427 4.29753 PNS24249 1928 1760.55 41.8793 3.56398 PNS24246 1044 876.551 25.1427 4.29753 PNS24248 1044 876.551 25.1427 4.29753 PNS24244 1471 1303.55 43.6927 5.02187 PNS24243 293 131.462 11 12.5365 KQK14069 1603 1435.55 3080.49 321.504 KQK14071 474 308.176 44.8501 21.8047 ==> SRR1635409.se.tsv <== BRADI_1g14170v3 3193 BRADI_1g53295v3 18 BRADI_1g59795v3 212 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 1772 BRADI_1g74790v3 29 BRADI_1g09890v3 6 BRADI_1g77505v3 162 BRADI_1g48960v3 0 SRR1635409 completed mapping pipeline successfully