Starting /dee2/code/volunteer_pipeline.sh SRR1635416 current disk space = 1523759902720 free memory = 1601576488 SRR1635416 SRAfilesize 49f421dc2b5005313c043ca00a5310c2 SRR1635416.sra SRR1635416.sra file validated SRR1635416 is paired end SRR1635416 is conventional basespace SRR1635416 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1635416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12025 34.0 31.0 34.0 31.0 34.0 2 32.62575 34.0 31.0 34.0 31.0 34.0 3 32.941 34.0 31.0 34.0 31.0 34.0 4 36.43075 37.0 37.0 37.0 35.0 37.0 5 36.29175 37.0 37.0 37.0 35.0 37.0 6 36.3355 37.0 37.0 37.0 35.0 37.0 7 36.34125 37.0 37.0 37.0 35.0 37.0 8 36.33725 37.0 37.0 37.0 35.0 37.0 9 38.15675 39.0 39.0 39.0 37.0 39.0 10-11 38.15525 39.0 39.0 39.0 37.0 39.0 12-13 38.132999999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.606125000000006 41.0 40.0 41.0 37.0 41.0 16-17 39.591499999999996 41.0 40.0 41.0 37.0 41.0 18-19 39.42875 41.0 40.0 41.0 36.0 41.0 20-21 39.428 41.0 39.5 41.0 36.5 41.0 22-23 39.428375 41.0 39.0 41.0 36.0 41.0 24-25 39.448875 41.0 39.0 41.0 36.0 41.0 26-27 39.40125 41.0 39.0 41.0 36.0 41.0 28-29 39.302499999999995 41.0 39.0 41.0 36.0 41.0 30-31 39.135125 41.0 39.0 41.0 35.0 41.0 32-33 39.104875 41.0 39.0 41.0 35.5 41.0 34-35 38.9585 40.5 38.5 41.0 35.0 41.0 36-37 38.781625000000005 40.0 38.0 41.0 35.0 41.0 38-39 38.54525 40.0 38.0 41.0 34.5 41.0 40-41 38.479 40.0 38.0 41.0 34.5 41.0 42-43 38.44475 40.0 37.5 41.0 34.5 41.0 44-45 37.915 40.0 37.0 41.0 33.0 41.0 46-47 37.9075 40.0 36.5 41.0 33.0 41.0 48-49 37.77725 40.0 36.0 41.0 33.0 41.0 50-51 37.724999999999994 40.0 35.5 41.0 33.0 41.0 52-53 37.6315 39.5 35.0 41.0 33.0 41.0 54-55 37.489000000000004 39.0 35.0 41.0 33.0 41.0 56-57 37.2465 39.0 35.0 41.0 33.0 41.0 58-59 36.967 38.5 35.0 41.0 32.5 41.0 60-61 36.767375 37.5 35.0 41.0 33.0 41.0 62-63 36.624125 37.0 35.0 40.0 33.0 41.0 64-65 36.29 37.0 35.0 40.0 32.0 41.0 66-67 35.921 36.0 35.0 39.0 31.0 41.0 68-69 35.736999999999995 35.5 35.0 39.0 32.0 41.0 70-71 35.414500000000004 35.0 35.0 39.0 31.5 40.5 72-73 35.155 35.0 35.0 37.0 32.0 39.5 74-75 34.826750000000004 35.0 35.0 37.0 31.5 39.0 76-77 34.46125 35.0 34.0 36.5 31.0 39.0 78-79 34.183375 35.0 34.0 36.0 31.0 38.0 80-81 33.94975 35.0 34.0 36.0 31.0 37.0 82-83 33.70099999999999 35.0 34.0 35.0 30.0 37.0 84-85 33.526624999999996 35.0 34.0 35.0 30.5 36.0 86-87 33.2635 35.0 34.0 35.0 30.0 36.0 88-89 33.347125 35.0 34.0 35.0 30.0 36.0 90-91 33.03275 35.0 33.5 35.0 29.5 35.5 92-93 33.03825 35.0 34.0 35.0 30.0 35.0 94-95 32.97425 35.0 34.0 35.0 30.0 35.0 96-97 32.986000000000004 35.0 34.0 35.0 30.0 35.0 98-99 32.823875 35.0 34.0 35.0 29.5 35.0 100 32.6935 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 5.0 11 4.0 12 2.0 13 4.0 14 1.0 15 2.0 16 0.0 17 2.0 18 4.0 19 4.0 20 3.0 21 7.0 22 6.0 23 3.0 24 13.0 25 10.0 26 20.0 27 24.0 28 33.0 29 35.0 30 53.0 31 54.0 32 89.0 33 105.0 34 144.0 35 299.0 36 661.0 37 935.0 38 1210.0 39 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.846153846153847 14.051282051282051 12.051282051282051 48.05128205128205 2 25.63781890945473 19.13456728364182 34.167083541770886 21.060530265132567 3 24.5 25.224999999999998 24.275 26.0 4 27.05 30.525000000000002 17.275 25.15 5 27.55 32.175 19.25 21.025 6 20.75 34.875 21.224999999999998 23.150000000000002 7 19.5 14.825 40.25 25.424999999999997 8 21.75 19.025 25.85 33.375 9 21.85 19.5 29.275000000000002 29.375 10-11 26.25 27.3125 19.675 26.7625 12-13 23.474999999999998 22.0875 26.1125 28.325 14-15 25.128141017627204 24.32804100512564 25.128141017627204 25.415676959619955 16-17 25.337500000000002 24.887500000000003 23.2625 26.5125 18-19 24.0375 24.825 24.099999999999998 27.037499999999998 20-21 24.75 25.1875 24.1625 25.900000000000002 22-23 25.5125 24.8625 23.9375 25.687500000000004 24-25 25.35 24.0 24.575 26.075 26-27 24.675 25.2625 24.9 25.162499999999998 28-29 25.2375 24.575 23.775 26.4125 30-31 24.337500000000002 24.712500000000002 23.95 27.0 32-33 25.240655081885237 25.115639454931866 23.91548943617952 25.728216027003377 34-35 26.075 24.087500000000002 24.4125 25.424999999999997 36-37 24.837500000000002 25.0625 23.925 26.174999999999997 38-39 25.275 24.9875 24.087500000000002 25.650000000000002 40-41 25.5125 24.8 24.4875 25.2 42-43 25.124999999999996 24.875 24.7375 25.2625 44-45 24.925 24.3875 25.412499999999998 25.275 46-47 25.387500000000003 24.762500000000003 23.974999999999998 25.874999999999996 48-49 24.8625 24.975 23.6625 26.5 50-51 25.674999999999997 24.5 24.0625 25.7625 52-53 25.8625 25.05 23.674999999999997 25.412499999999998 54-55 25.025 25.474999999999998 23.7625 25.7375 56-57 25.3125 24.7375 25.2125 24.7375 58-59 25.25 25.174999999999997 24.1625 25.412499999999998 60-61 24.425 25.124999999999996 25.2625 25.1875 62-63 25.837500000000002 24.575 25.15 24.4375 64-65 25.7625 24.349999999999998 24.0625 25.825 66-67 24.637500000000003 25.025 25.137500000000003 25.2 68-69 25.2625 24.6625 25.0625 25.0125 70-71 25.974999999999998 23.150000000000002 24.9 25.974999999999998 72-73 25.2125 25.575 25.2 24.0125 74-75 26.05 24.462500000000002 24.8125 24.675 76-77 24.95 25.025 24.2625 25.7625 78-79 25.575 24.837500000000002 23.825 25.7625 80-81 25.6125 24.4375 24.3875 25.5625 82-83 25.5625 24.175 24.5375 25.724999999999998 84-85 25.4875 24.1375 25.5 24.875 86-87 24.725 25.45 24.3625 25.4625 88-89 26.0625 24.7875 24.337500000000002 24.8125 90-91 25.587500000000002 24.875 24.4125 25.124999999999996 92-93 26.737499999999997 24.4125 24.525 24.325 94-95 25.362499999999997 24.6 24.7875 25.25 96-97 26.125 24.2625 25.687500000000004 23.925 98-99 26.0125 24.9125 24.7375 24.337500000000002 100 27.200000000000003 23.0 24.425 25.374999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 2.0 28 5.0 29 5.0 30 6.5 31 10.0 32 10.0 33 11.0 34 18.0 35 32.0 36 43.5 37 57.0 38 74.0 39 85.0 40 97.0 41 122.5 42 156.0 43 185.5 44 184.0 45 183.0 46 193.0 47 176.5 48 161.5 49 153.0 50 155.0 51 148.5 52 122.5 53 119.5 54 111.0 55 82.5 56 83.0 57 95.5 58 99.0 59 89.5 60 78.0 61 82.0 62 78.5 63 69.0 64 68.0 65 69.5 66 75.0 67 77.5 68 69.0 69 56.5 70 52.0 71 46.0 72 29.0 73 22.0 74 18.0 75 10.0 76 8.0 77 6.0 78 3.0 79 1.5 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1635416 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1635416_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2465 34.0 31.0 34.0 31.0 34.0 2 32.4565 34.0 31.0 34.0 31.0 34.0 3 32.384 34.0 31.0 34.0 31.0 34.0 4 35.78725 37.0 37.0 37.0 35.0 37.0 5 35.773 37.0 37.0 37.0 35.0 37.0 6 35.75325 37.0 37.0 37.0 35.0 37.0 7 35.72475 37.0 37.0 37.0 35.0 37.0 8 35.72975 37.0 37.0 37.0 35.0 37.0 9 37.5075 39.0 38.0 39.0 35.0 39.0 10-11 37.291624999999996 39.0 38.0 39.0 34.5 39.0 12-13 37.278875 39.0 38.0 39.0 35.0 39.0 14-15 38.70375 41.0 39.0 41.0 35.5 41.0 16-17 38.693124999999995 41.0 39.0 41.0 35.5 41.0 18-19 38.854124999999996 41.0 39.0 41.0 36.0 41.0 20-21 38.737875 41.0 39.0 41.0 35.5 41.0 22-23 38.724374999999995 41.0 39.0 41.0 35.5 41.0 24-25 38.54 41.0 39.0 41.0 34.5 41.0 26-27 38.37225 41.0 38.5 41.0 34.0 41.0 28-29 38.24725 40.5 38.5 41.0 33.5 41.0 30-31 38.319 40.0 38.0 41.0 34.0 41.0 32-33 38.293 40.0 38.0 41.0 34.0 41.0 34-35 38.119 40.0 38.0 41.0 33.5 41.0 36-37 37.9055 40.0 38.0 41.0 33.0 41.0 38-39 37.718875 40.0 38.0 41.0 33.0 41.0 40-41 37.622375000000005 40.0 37.0 41.0 33.0 41.0 42-43 37.404624999999996 40.0 37.0 41.0 33.0 41.0 44-45 37.227875 40.0 36.5 41.0 32.5 41.0 46-47 37.048 40.0 35.5 41.0 32.0 41.0 48-49 36.926125 40.0 35.5 41.0 31.5 41.0 50-51 36.663375 39.5 35.0 41.0 31.0 41.0 52-53 36.65875 39.0 35.0 41.0 31.5 41.0 54-55 36.53975 39.0 35.0 41.0 31.5 41.0 56-57 36.111625000000004 39.0 35.0 41.0 30.0 41.0 58-59 35.997625 38.0 35.0 41.0 31.0 41.0 60-61 35.70125 37.5 35.0 40.5 30.5 41.0 62-63 35.449124999999995 37.0 35.0 40.0 30.0 41.0 64-65 35.13125 36.0 34.5 40.0 30.0 41.0 66-67 34.919124999999994 36.0 34.0 39.0 29.5 41.0 68-69 34.599125 35.5 34.0 39.0 29.5 41.0 70-71 34.316375 35.0 34.0 38.5 29.0 40.5 72-73 33.887874999999994 35.0 34.0 37.0 29.0 39.5 74-75 33.661125 35.0 34.0 37.0 29.0 39.0 76-77 33.342375000000004 35.0 34.0 36.5 29.0 39.0 78-79 32.984625 35.0 33.5 36.0 27.5 37.5 80-81 32.699875 35.0 33.0 35.5 27.5 37.0 82-83 32.231750000000005 35.0 33.0 35.0 26.0 37.0 84-85 32.178 35.0 33.0 35.0 26.5 36.0 86-87 32.04725 35.0 33.0 35.0 27.0 36.0 88-89 31.869999999999997 35.0 33.0 35.0 26.5 36.0 90-91 31.674 35.0 33.0 35.0 25.0 35.5 92-93 31.576749999999997 35.0 33.0 35.0 25.0 35.0 94-95 31.33425 35.0 33.0 35.0 24.0 35.0 96-97 31.647624999999998 35.0 33.0 35.0 26.0 35.0 98-99 31.654625000000003 35.0 33.0 35.0 26.0 35.0 100 31.5025 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 5.0 4 5.0 5 2.0 6 3.0 7 8.0 8 3.0 9 4.0 10 3.0 11 8.0 12 11.0 13 5.0 14 8.0 15 5.0 16 6.0 17 3.0 18 6.0 19 8.0 20 10.0 21 11.0 22 9.0 23 15.0 24 11.0 25 18.0 26 24.0 27 27.0 28 28.0 29 62.0 30 53.0 31 70.0 32 82.0 33 99.0 34 155.0 35 349.0 36 567.0 37 959.0 38 1073.0 39 246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.455569461827285 12.715894868585732 12.740926157697121 50.087609511889866 2 25.832290362953692 20.475594493116393 33.41677096370463 20.275344180225282 3 23.829787234042556 24.53066332916145 25.131414267834796 26.5081351689612 4 25.00625782227785 30.43804755944931 16.7459324155194 27.80976220275344 5 28.060075093867333 31.314142678347935 19.349186483103882 21.27659574468085 6 21.457185778668002 33.900851276915375 21.106659989984976 23.535302954431646 7 19.90984222389181 14.400200350613574 38.79288755321813 26.897069872276486 8 21.34268537074148 20.791583166332668 25.37575150300601 32.48997995991984 9 20.31563126252505 18.637274549098194 29.984969939879758 31.062124248496993 10-11 24.71192384769539 27.918336673346694 19.977454909819638 27.392284569138276 12-13 23.782091421415153 22.47964934251722 26.24921728240451 27.48904195366312 14-15 23.810120240480963 23.810120240480963 26.127254509018037 26.252505010020037 16-17 25.814128256513026 23.960420841683366 24.123246492985974 26.102204408817638 18-19 25.025050100200403 25.112725450901802 24.110721442885772 25.751503006012022 20-21 25.645201703833624 24.455023803558003 23.816086193936357 26.083688298672016 22-23 24.812124248496996 24.273547094188377 25.0375751503006 25.876753507014026 24-25 24.104234527687296 24.30468554247056 24.24204460035079 27.349035329491358 26-27 24.517664745677774 24.931094963668254 24.642946629917315 25.90829366073666 28-29 24.345320135321387 24.808921187821078 24.92168901140208 25.924069665455455 30-31 24.30468554247056 25.093961413179656 24.354798296166376 26.246554748183414 32-33 24.417439238286143 24.79328489100476 24.71811576046104 26.07116011024806 34-35 25.140995112169445 24.56448176463216 24.66474495550821 25.629778167690187 36-37 24.480080180405913 24.818341267852666 24.40491104986219 26.296667501879227 38-39 25.156602355299423 24.642946629917315 24.379854673014282 25.82059634176898 40-41 24.702492797194036 24.790179130652636 24.539646749342353 25.967681322810975 42-43 25.10648960160361 24.71811576046104 23.653219744424955 26.522174893510396 44-45 26.10547413253163 23.900789177001126 24.865338845045724 25.128397845421517 46-47 24.379854673014282 25.194186920571287 23.565522425457278 26.860435980957153 48-49 25.137775551102205 24.248496993987974 24.549098196392784 26.064629258517037 50-51 24.73994234866525 25.09086351673142 24.36395538288006 25.805238751723277 52-53 25.250501002004004 25.237975951903806 24.03557114228457 25.475951903807616 54-55 24.843397644700577 24.843397644700577 25.119017790027563 25.194186920571287 56-57 24.818341267852666 25.231771485843147 24.743172137308946 25.206715108995237 58-59 25.156602355299423 24.880982209972437 24.943623152092208 25.018792282635932 60-61 25.378930226731804 24.85281222598021 23.838156081673556 25.93010146561443 62-63 24.010521042084168 24.9874749498998 25.839178356713425 25.162825651302605 64-65 25.870709095464793 24.605362064645455 23.95389626659985 25.570032573289904 66-67 24.9185667752443 25.457278877474316 24.141819092959157 25.482335254322226 68-69 25.043848659483835 24.555249310949637 25.169130543723377 25.231771485843147 70-71 24.95615134051616 24.730643948884993 24.32974191931847 25.98346279128038 72-73 25.115871226356006 24.339220844294125 24.815232368783665 25.7296755605662 74-75 25.419694312202456 23.778501628664493 26.146329240791783 24.65547481834127 76-77 26.29731762346453 25.23188769115066 23.614941087991976 24.85585359739283 78-79 24.46421857375611 25.328988595062036 23.524251159293144 26.68254167188871 80-81 24.852738438400802 24.965534528136356 24.639679157789196 25.542047875673646 82-83 25.805238751723277 25.128462213309938 24.33888958516105 24.72740944980574 84-85 24.385656970912738 24.66148445336008 25.313440320962886 25.63941825476429 86-87 25.04387064427175 25.14414640260717 25.106542993231386 24.705439959889695 88-89 25.77733199598796 24.473420260782348 24.41073219658977 25.33851554663992 90-91 25.385290063901767 24.946748527753414 24.182433279037717 25.485528129307106 92-93 25.59829595288811 24.683623606064405 24.282671344443052 25.435409096604435 94-95 25.32581453634085 25.48872180451128 24.62406015037594 24.561403508771928 96-97 24.774436090225564 25.38847117794486 24.924812030075188 24.912280701754387 98-99 25.3104226765333 24.106358961495044 24.796187131569045 25.787031230402608 100 24.956107348883872 24.404314020566844 25.357411587659897 25.28216704288939 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.5 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.5 29 4.0 30 6.5 31 10.0 32 14.5 33 16.0 34 18.0 35 29.5 36 45.0 37 55.5 38 76.0 39 89.0 40 114.0 41 148.5 42 144.5 43 157.5 44 180.0 45 188.0 46 180.5 47 175.5 48 176.5 49 155.0 50 153.0 51 148.0 52 124.5 53 109.0 54 106.0 55 96.0 56 89.5 57 92.0 58 83.0 59 75.0 60 84.0 61 85.0 62 75.0 63 73.5 64 74.0 65 75.0 66 71.5 67 73.0 68 67.0 69 55.0 70 47.0 71 40.5 72 35.0 73 27.5 74 15.0 75 6.0 76 5.0 77 5.5 78 5.5 79 3.5 80 2.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.125 6 0.15 7 0.17500000000000002 8 0.2 9 0.2 10-11 0.2 12-13 0.1875 14-15 0.2 16-17 0.2 18-19 0.2 20-21 0.22499999999999998 22-23 0.2 24-25 0.22499999999999998 26-27 0.22499999999999998 28-29 0.2375 30-31 0.22499999999999998 32-33 0.22499999999999998 34-35 0.2625 36-37 0.22499999999999998 38-39 0.22499999999999998 40-41 0.21250000000000002 42-43 0.22499999999999998 44-45 0.21250000000000002 46-47 0.22499999999999998 48-49 0.2 50-51 0.2625 52-53 0.2 54-55 0.22499999999999998 56-57 0.22499999999999998 58-59 0.22499999999999998 60-61 0.21250000000000002 62-63 0.2 64-65 0.22499999999999998 66-67 0.22499999999999998 68-69 0.22499999999999998 70-71 0.22499999999999998 72-73 0.21250000000000002 74-75 0.22499999999999998 76-77 0.27499999999999997 78-79 0.2625 80-81 0.2625 82-83 0.2625 84-85 0.3 86-87 0.27499999999999997 88-89 0.3 90-91 0.2375 92-93 0.2375 94-95 0.25 96-97 0.25 98-99 0.3375 100 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84966173891256 99.625 2 0.12528188423953898 0.25 3 0.0 0.0 4 0.0 0.0 5 0.025056376847907794 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474733 spots for SRR1635416.sra Written 474733 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra Read 474717 spots for SRR1635416.sra Written 474717 spots for SRR1635416.sra SRR ids: ['SRR1635416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_te3rk8oc SRR1635416.sra spots: 9494356 blocks: [[1, 474717], [474718, 949434], [949435, 1424151], [1424152, 1898868], [1898869, 2373585], [2373586, 2848302], [2848303, 3323019], [3323020, 3797736], [3797737, 4272453], [4272454, 4747170], [4747171, 5221887], [5221888, 5696604], [5696605, 6171321], [6171322, 6646038], [6646039, 7120755], [7120756, 7595472], [7595473, 8070189], [8070190, 8544906], [8544907, 9019623], [9019624, 9494356]] SRR1635416 file size 2571713 SRR1635416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1635416 SRR1635416_1.fastq SRR1635416_2.fastq Input file: SRR1635416_1.fastq Paired file: SRR1635416_2.fastq trimmed: SRR1635416-trimmed-pair1.fastq, SRR1635416-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:07:07 2024 >> started Tue Dec 10 01:07:17 2024 >> done (9.899s) 9494356 read pairs processed; of these: 45397 ( 0.48%) short read pairs filtered out after trimming by size control 76028 ( 0.80%) empty read pairs filtered out after trimming by size control 9372931 (98.72%) read pairs available; of these: 1118895 (11.94%) trimmed read pairs available after processing 8254036 (88.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 20 0.00% 21 34 0.00% 22 57 0.00% 23 90 0.00% 24 104 0.00% 25 137 0.00% 26 162 0.00% 27 223 0.00% 28 260 0.00% 29 289 0.00% 30 334 0.00% 31 387 0.00% 32 433 0.00% 33 503 0.01% 34 525 0.01% 35 587 0.01% 36 625 0.01% 37 670 0.01% 38 717 0.01% 39 815 0.01% 40 871 0.01% 41 892 0.01% 42 940 0.01% 43 972 0.01% 44 1099 0.01% 45 1186 0.01% 46 1178 0.01% 47 1352 0.01% 48 1434 0.02% 49 1470 0.02% 50 1513 0.02% 51 1656 0.02% 52 1872 0.02% 53 1922 0.02% 54 2082 0.02% 55 2329 0.02% 56 2489 0.03% 57 2787 0.03% 58 3042 0.03% 59 7291 0.08% 60 7580 0.08% 61 8313 0.09% 62 8872 0.09% 63 9570 0.10% 64 9958 0.11% 65 10563 0.11% 66 11217 0.12% 67 11648 0.12% 68 12004 0.13% 69 12474 0.13% 70 13112 0.14% 71 13323 0.14% 72 13451 0.14% 73 13477 0.14% 74 13725 0.15% 75 14175 0.15% 76 14537 0.16% 77 14808 0.16% 78 15121 0.16% 79 15481 0.17% 80 15860 0.17% 81 16313 0.17% 82 16740 0.18% 83 17762 0.19% 84 18010 0.19% 85 19346 0.21% 86 23396 0.25% 87 24511 0.26% 88 26144 0.28% 89 28256 0.30% 90 31169 0.33% 91 34452 0.37% 92 38944 0.42% 93 44182 0.47% 94 50821 0.54% 95 59303 0.63% 96 69358 0.74% 97 83487 0.89% 98 106697 1.14% 99 105378 1.12% 100 8254036 88.06% 9372931 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=5.36 fanout-score-rank=13 prefix-density=0.15 prefix-fanout=4.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=191.40 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=22.9 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=4.09 fanout-score-rank=21 prefix-density=0.13 prefix-fanout=3.5 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=266.94 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=24.0 sequence=CGCCGCCGCCGA SRR1635416 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:08:32 Started mapping on | Dec 10 01:08:32 Finished on | Dec 10 01:08:56 Mapping speed, Million of reads per hour | 1405.94 Number of input reads | 9372931 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 9067177 Uniquely mapped reads % | 96.74% Average mapped length | 196.18 Number of splices: Total | 6269016 Number of splices: Annotated (sjdb) | 5947470 Number of splices: GT/AG | 6186517 Number of splices: GC/AG | 71615 Number of splices: AT/AC | 3522 Number of splices: Non-canonical | 7362 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125181 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 12602 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.08% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 186250 186250 186250 N_multimapping 125181 125181 125181 N_noFeature 293236 4592792 4615807 N_ambiguous 174341 11785 11687 UnstrandedReadsAssigned:8599600 PositiveStrandReadsAssigned:4462600 NegativeStrandReadsAssigned:4439683 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1635416 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1635416-trimmed-pair1.fastq SRR1635416-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,372,931 reads, 8,855,332 reads pseudoaligned [quant] estimated average fragment length: 165.257 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR1635416.ke.tsv 35125 SRR1635416.se.tsv 88098 total ==> SRR1635416.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.032 0 0 PNS24247 1044 879.743 39.7628 7.49219 PNS24249 1928 1763.74 71.8382 6.75162 PNS24246 1044 879.743 39.7628 7.49219 PNS24248 1044 879.743 39.7628 7.49219 PNS24244 1471 1306.74 62.8733 7.97561 PNS24243 293 135.323 4 4.89976 KQK14069 1603 1438.74 2520.53 290.4 KQK14071 474 311.699 70.2338 37.3506 ==> SRR1635416.se.tsv <== BRADI_1g14170v3 2723 BRADI_1g53295v3 30 BRADI_1g59795v3 223 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1560 BRADI_1g74790v3 210 BRADI_1g09890v3 8 BRADI_1g77505v3 136 BRADI_1g48960v3 0 SRR1635416 completed mapping pipeline successfully