Starting /dee2/code/volunteer_pipeline.sh SRR1635430 current disk space = 1523749142528 free memory = 1402352996 SRR1635430 SRAfilesize 406a1732352aecea19a9d6087180a989 SRR1635430.sra SRR1635430.sra file validated SRR1635430 is paired end SRR1635430 is conventional basespace SRR1635430 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1635430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27 34.0 31.0 34.0 31.0 34.0 2 32.67975 34.0 31.0 34.0 31.0 34.0 3 32.98575 34.0 31.0 34.0 31.0 34.0 4 36.44675 37.0 37.0 37.0 35.0 37.0 5 36.34025 37.0 37.0 37.0 35.0 37.0 6 36.33575 37.0 37.0 37.0 35.0 37.0 7 36.36275 37.0 37.0 37.0 35.0 37.0 8 36.31325 37.0 37.0 37.0 35.0 37.0 9 38.09225 39.0 39.0 39.0 37.0 39.0 10-11 38.121 39.0 39.0 39.0 36.0 39.0 12-13 38.082625 39.0 39.0 39.0 36.0 39.0 14-15 39.58825 41.0 40.0 41.0 37.0 41.0 16-17 39.514875 41.0 40.0 41.0 36.0 41.0 18-19 39.3825 41.0 39.5 41.0 36.5 41.0 20-21 39.35225 41.0 39.0 41.0 36.5 41.0 22-23 39.406625000000005 41.0 39.0 41.0 36.0 41.0 24-25 39.367875 41.0 39.0 41.0 36.0 41.0 26-27 39.337125 41.0 39.0 41.0 36.0 41.0 28-29 39.333125 41.0 39.0 41.0 36.0 41.0 30-31 39.145624999999995 41.0 39.0 41.0 35.5 41.0 32-33 39.034625 41.0 39.0 41.0 35.0 41.0 34-35 38.93725 40.0 38.5 41.0 35.0 41.0 36-37 38.7975 40.0 38.0 41.0 35.0 41.0 38-39 38.4915 40.0 38.0 41.0 34.0 41.0 40-41 38.490875 40.0 38.0 41.0 34.5 41.0 42-43 38.377250000000004 40.0 37.0 41.0 34.0 41.0 44-45 37.876625000000004 40.0 36.5 41.0 33.0 41.0 46-47 37.794125 40.0 36.0 41.0 33.0 41.0 48-49 37.672125 40.0 35.0 41.0 33.0 41.0 50-51 37.541250000000005 39.0 35.0 41.0 33.0 41.0 52-53 37.560500000000005 39.0 35.0 41.0 33.0 41.0 54-55 37.37875 39.0 35.0 41.0 33.0 41.0 56-57 37.167249999999996 39.0 35.0 41.0 33.0 41.0 58-59 36.855625 38.0 35.0 41.0 33.0 41.0 60-61 36.687124999999995 37.5 35.0 40.5 33.0 41.0 62-63 36.512874999999994 37.0 35.0 40.0 33.0 41.0 64-65 36.23025 36.5 35.0 40.0 32.5 41.0 66-67 35.884625 36.0 35.0 39.0 32.0 41.0 68-69 35.60775 35.5 35.0 39.0 32.0 41.0 70-71 35.213499999999996 35.0 35.0 38.0 31.0 40.5 72-73 34.99825 35.0 35.0 37.0 31.5 39.5 74-75 34.68725 35.0 34.5 37.0 31.0 39.0 76-77 34.346125 35.0 34.0 36.0 31.0 39.0 78-79 34.07 35.0 34.0 36.0 30.5 37.0 80-81 33.907375 35.0 34.0 35.5 31.0 37.0 82-83 33.678 35.0 34.0 35.0 30.5 36.5 84-85 33.40425 35.0 34.0 35.0 30.0 36.0 86-87 33.162625000000006 35.0 34.0 35.0 29.5 36.0 88-89 33.193625 35.0 34.0 35.0 29.5 36.0 90-91 32.923375 35.0 33.5 35.0 29.0 35.0 92-93 32.95425 35.0 34.0 35.0 29.0 35.0 94-95 32.953625 35.0 34.0 35.0 30.0 35.0 96-97 32.893625 35.0 34.0 35.0 29.5 35.0 98-99 32.7885 35.0 34.0 35.0 29.5 35.0 100 32.72175 35.0 34.0 35.0 29.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 5.0 11 4.0 12 2.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 3.0 19 4.0 20 2.0 21 5.0 22 10.0 23 8.0 24 12.0 25 16.0 26 15.0 27 35.0 28 31.0 29 39.0 30 54.0 31 56.0 32 79.0 33 100.0 34 156.0 35 354.0 36 640.0 37 935.0 38 1189.0 39 240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.02249488752556 13.701431492842536 12.295501022494888 47.98057259713702 2 25.324999999999996 20.974999999999998 33.4 20.3 3 24.175 25.7 23.075000000000003 27.05 4 26.474999999999998 31.275 17.625 24.625 5 27.425 32.275 18.6 21.7 6 21.05 34.525 20.375 24.05 7 20.95 14.374999999999998 39.074999999999996 25.6 8 22.6 19.45 25.75 32.2 9 21.725 18.8 30.975 28.499999999999996 10-11 26.125 27.750000000000004 19.8125 26.3125 12-13 24.1125 22.375 25.4625 28.050000000000004 14-15 23.775 24.099999999999998 25.112499999999997 27.0125 16-17 25.4625 24.4125 23.7 26.424999999999997 18-19 24.9875 24.8125 23.9125 26.2875 20-21 24.375 25.3125 24.275 26.0375 22-23 25.6125 25.137500000000003 23.5 25.75 24-25 24.8625 25.5625 23.625 25.95 26-27 24.725 25.75 23.3875 26.137500000000003 28-29 25.8625 24.2 23.7625 26.174999999999997 30-31 24.887500000000003 25.087500000000002 24.45 25.575 32-33 25.387500000000003 25.2875 24.1125 25.2125 34-35 25.5125 24.9375 23.5375 26.0125 36-37 24.712500000000002 25.137500000000003 23.3625 26.787499999999998 38-39 25.525 24.775 23.9375 25.7625 40-41 25.637500000000003 24.9375 23.5625 25.8625 42-43 25.25 23.9125 24.8125 26.025 44-45 25.912499999999998 25.275 23.400000000000002 25.412499999999998 46-47 25.687500000000004 25.0375 23.4625 25.8125 48-49 25.137500000000003 25.2875 24.5 25.074999999999996 50-51 25.7 25.2 24.337500000000002 24.762500000000003 52-53 25.55 24.0625 24.637500000000003 25.75 54-55 24.425 25.2375 24.2625 26.075 56-57 26.05 24.587500000000002 24.1125 25.25 58-59 25.324999999999996 24.925 23.95 25.8 60-61 25.55 25.5625 24.4875 24.4 62-63 25.5625 24.8625 23.9125 25.662499999999998 64-65 25.662499999999998 23.974999999999998 25.074999999999996 25.2875 66-67 25.15 25.8125 23.45 25.587500000000002 68-69 25.912499999999998 24.65 24.725 24.712500000000002 70-71 25.9875 24.875 24.375 24.762500000000003 72-73 26.150000000000002 24.75 24.3125 24.7875 74-75 25.8 24.875 23.6625 25.662499999999998 76-77 25.525 24.8 24.425 25.25 78-79 25.9875 24.2375 24.462500000000002 25.3125 80-81 25.8625 24.6625 23.7 25.775 82-83 25.9875 23.75 24.65 25.6125 84-85 25.025 24.837500000000002 24.5625 25.575 86-87 26.0 24.474999999999998 24.712500000000002 24.8125 88-89 26.325 23.6875 24.325 25.662499999999998 90-91 25.387500000000003 25.05 24.0125 25.55 92-93 25.137500000000003 25.074999999999996 24.025 25.7625 94-95 26.2875 25.4375 23.3875 24.887500000000003 96-97 25.900000000000002 24.887500000000003 23.799999999999997 25.412499999999998 98-99 25.924999999999997 24.55 24.8125 24.712500000000002 100 25.124999999999996 24.6 24.175 26.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.5 27 2.0 28 1.5 29 2.0 30 4.0 31 6.0 32 11.0 33 16.0 34 23.5 35 30.0 36 37.5 37 64.0 38 82.0 39 80.5 40 97.0 41 137.0 42 159.5 43 173.5 44 177.0 45 169.5 46 176.5 47 175.5 48 166.5 49 154.5 50 148.5 51 139.0 52 132.5 53 123.5 54 105.0 55 100.0 56 91.5 57 84.5 58 88.5 59 90.0 60 80.0 61 71.0 62 63.0 63 65.0 64 78.5 65 73.5 66 63.5 67 63.0 68 66.0 69 66.5 70 58.5 71 46.5 72 38.0 73 36.0 74 30.5 75 19.5 76 11.0 77 8.5 78 4.5 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1635430 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1635430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.452 34.0 31.0 34.0 31.0 34.0 2 32.5975 34.0 31.0 34.0 31.0 34.0 3 32.56025 34.0 31.0 34.0 31.0 34.0 4 35.88875 37.0 37.0 37.0 35.0 37.0 5 35.88075 37.0 37.0 37.0 35.0 37.0 6 35.933 37.0 37.0 37.0 35.0 37.0 7 35.87375 37.0 37.0 37.0 35.0 37.0 8 35.86175 37.0 37.0 37.0 35.0 37.0 9 37.662 39.0 38.0 39.0 35.0 39.0 10-11 37.37225 39.0 38.0 39.0 34.0 39.0 12-13 37.447374999999994 39.0 38.0 39.0 35.0 39.0 14-15 38.900375 41.0 39.0 41.0 35.5 41.0 16-17 38.929249999999996 41.0 39.5 41.0 35.5 41.0 18-19 39.02775 41.0 39.0 41.0 36.0 41.0 20-21 38.949875 41.0 39.0 41.0 36.0 41.0 22-23 38.8875 41.0 39.0 41.0 35.0 41.0 24-25 38.760125 41.0 39.0 41.0 35.0 41.0 26-27 38.584374999999994 41.0 39.0 41.0 34.5 41.0 28-29 38.462 40.5 38.5 41.0 34.5 41.0 30-31 38.4385 41.0 38.5 41.0 34.0 41.0 32-33 38.41375 40.5 38.5 41.0 34.5 41.0 34-35 38.25125 40.0 38.0 41.0 34.0 41.0 36-37 37.99675 40.0 38.0 41.0 33.5 41.0 38-39 37.785250000000005 40.0 38.0 41.0 33.0 41.0 40-41 37.807875 40.0 37.5 41.0 33.0 41.0 42-43 37.57025 40.0 37.0 41.0 33.0 41.0 44-45 37.417874999999995 40.0 36.5 41.0 33.0 41.0 46-47 37.232124999999996 40.0 36.0 41.0 33.0 41.0 48-49 37.1485 40.0 35.5 41.0 32.5 41.0 50-51 36.791624999999996 39.5 35.0 41.0 31.0 41.0 52-53 36.775375 39.0 35.0 41.0 31.5 41.0 54-55 36.642624999999995 39.0 35.0 41.0 31.5 41.0 56-57 36.355999999999995 39.0 35.0 41.0 31.0 41.0 58-59 36.16775 38.5 35.0 41.0 31.0 41.0 60-61 35.86025 37.5 35.0 41.0 31.0 41.0 62-63 35.62575 37.0 35.0 40.0 31.0 41.0 64-65 35.214749999999995 36.5 35.0 40.0 30.0 41.0 66-67 34.960625 36.0 35.0 39.0 30.0 41.0 68-69 34.542 35.5 34.0 39.0 29.5 41.0 70-71 34.21225 35.0 34.0 38.5 29.0 40.0 72-73 33.934125 35.0 34.0 37.0 29.0 39.5 74-75 33.662 35.0 34.0 37.0 29.0 39.0 76-77 33.311499999999995 35.0 34.0 36.0 29.0 39.0 78-79 32.897625000000005 35.0 33.5 36.0 27.0 37.5 80-81 32.709999999999994 35.0 33.0 35.5 27.5 37.0 82-83 32.215500000000006 35.0 33.0 35.0 26.0 37.0 84-85 32.151125 35.0 33.0 35.0 26.5 36.0 86-87 32.010375 35.0 33.0 35.0 27.0 36.0 88-89 31.851 35.0 33.0 35.0 26.0 36.0 90-91 31.708750000000002 35.0 33.0 35.0 25.0 35.5 92-93 31.676875000000003 35.0 33.0 35.0 25.5 35.0 94-95 31.378375 35.0 33.0 35.0 24.5 35.0 96-97 31.5785 35.0 33.0 35.0 25.5 35.0 98-99 31.604999999999997 35.0 33.0 35.0 25.5 35.0 100 31.5065 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 4.0 4 4.0 5 4.0 6 8.0 7 7.0 8 5.0 9 1.0 10 5.0 11 2.0 12 7.0 13 10.0 14 6.0 15 7.0 16 10.0 17 13.0 18 11.0 19 13.0 20 7.0 21 11.0 22 7.0 23 8.0 24 17.0 25 23.0 26 17.0 27 17.0 28 32.0 29 42.0 30 59.0 31 67.0 32 72.0 33 126.0 34 191.0 35 282.0 36 583.0 37 871.0 38 1172.0 39 255.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.75 13.750000000000002 12.925 48.575 2 25.94445834375782 19.914936202151615 33.850387790843136 20.290217663247436 3 24.64348261195897 24.993745308981737 24.96872654490868 25.39404553415061 4 26.845133850387793 28.921691268451337 18.16362271703778 26.069552164123095 5 27.195396547410557 31.898924193144857 19.289467100325243 21.61621215911934 6 20.290217663247436 32.524393294971226 21.61621215911934 25.569176882662 7 19.71971971971972 14.214214214214213 39.014014014014016 27.05205205205205 8 21.02102102102102 20.17017017017017 24.724724724724727 34.08408408408408 9 20.47047047047047 20.37037037037037 28.353353353353356 30.805805805805807 10-11 25.738238238238235 28.44094094094094 19.61961961961962 26.2012012012012 12-13 22.62262262262262 22.05955955955956 27.32732732732733 27.990490490490487 14-15 23.51101101101101 24.086586586586588 25.663163163163162 26.739239239239236 16-17 25.462962962962965 23.8988988988989 23.94894894894895 26.68918918918919 18-19 24.56513577774997 23.538981354023274 24.96558628457014 26.930296583656617 20-21 25.05634861006762 25.144002003506138 23.59128474830954 26.208364638116706 22-23 25.488232348522782 24.699549323985977 24.87481221832749 24.937406109163746 24-25 25.42266750156543 24.120225422667502 24.871634314339385 25.585472761427674 26-27 24.483406386975577 24.370695053224797 24.733876017532875 26.41202254226675 28-29 25.12210394489668 24.17031934877896 23.882279273638073 26.825297432686284 30-31 24.62116468378209 25.272385723231057 23.9073262366938 26.199123356293047 32-33 24.37374749498998 24.574148296593187 24.261022044088175 26.791082164328657 34-35 24.912324649298597 24.411322645290582 24.9248496993988 25.751503006012022 36-37 24.85911083281152 24.546023794614904 24.270507201001877 26.3243581715717 38-39 24.514836609490423 24.940528358582696 24.777763866282708 25.766871165644172 40-41 25.07197396420078 24.683940418074855 23.857804481161597 26.386281136562772 42-43 25.17219787100814 24.345648090169068 24.546023794614904 25.936130244207888 44-45 24.204858502379164 25.118958176809414 24.73077886301027 25.945404457801153 46-47 25.24733876017533 24.395742016280526 23.93237319974953 26.424546023794615 48-49 25.378550869728443 24.439994994368664 24.21474158428232 25.966712551620574 50-51 25.463426853707418 24.03557114228457 24.71192384769539 25.789078156312623 52-53 25.043804755944933 24.292866082603254 24.831038798498124 25.832290362953692 54-55 24.95929868503444 24.257983719474012 24.946775203506576 25.835942391984972 56-57 25.184721352536005 24.395742016280526 25.259862241703196 25.159674389480273 58-59 24.505384422739795 25.45704983721513 24.68069120961683 25.356874530428247 60-61 24.283389660783577 24.784078107397672 24.170734760295407 26.761797471523348 62-63 25.610214044310926 24.784078107397672 24.320941294279635 25.284766554011767 64-65 25.46023794614903 24.571070757670633 24.358171571696932 25.610519724483403 66-67 25.150225338007008 24.962443665498245 23.86079118678017 26.02653980971457 68-69 25.688877755511026 24.69939879759519 24.423847695390783 25.187875751503007 70-71 25.435190983093296 25.034439574201627 24.257983719474012 25.272385723231057 72-73 25.591586327782643 24.189307624890446 24.953048704144233 25.266057343182673 74-75 25.410144020037574 23.93237319974953 25.259862241703196 25.397620538509706 76-77 25.926853707414832 23.897795591182362 24.67434869739479 25.501002004008015 78-79 24.940498559438808 24.477013654014783 25.24113741701115 25.341350369535263 80-81 26.336881653099564 23.569192235441452 24.558547276142768 25.53537883531622 82-83 26.449592986850345 24.733876017532875 24.257983719474012 24.558547276142768 84-85 24.9624248496994 23.960420841683366 25.137775551102205 25.93937875751503 86-87 24.91544532130778 24.85281222598021 25.191030940749094 25.04071151196292 88-89 25.9050482274834 24.201428034573468 24.602279844669926 25.291243893273208 90-91 25.35070140280561 24.36122244488978 23.997995991983966 26.290080160320638 92-93 24.862224448897795 23.810120240480963 25.438376753507015 25.889278557114224 94-95 26.715931863727455 24.09819639278557 24.135771543086175 25.0501002004008 96-97 25.951903807615228 23.947895791583164 24.68687374749499 25.413326653306612 98-99 26.196441994487596 23.314958656978202 25.0814332247557 25.407166123778502 100 26.584815835630167 24.30468554247056 23.50288148333751 25.60761713856176 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 0.5 27 0.5 28 1.5 29 3.0 30 3.5 31 6.5 32 14.0 33 19.5 34 22.5 35 32.5 36 46.0 37 57.5 38 73.0 39 87.0 40 101.5 41 132.0 42 151.5 43 154.0 44 166.5 45 195.0 46 195.0 47 174.5 48 177.5 49 168.5 50 145.5 51 124.5 52 115.0 53 115.5 54 108.5 55 99.0 56 96.0 57 88.0 58 82.0 59 81.0 60 80.5 61 85.0 62 76.5 63 65.5 64 70.5 65 73.0 66 68.5 67 66.0 68 61.5 69 52.0 70 48.0 71 45.0 72 39.0 73 38.0 74 31.0 75 18.5 76 10.0 77 7.5 78 7.0 79 4.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.1 16-17 0.1 18-19 0.11249999999999999 20-21 0.17500000000000002 22-23 0.15 24-25 0.1875 26-27 0.1875 28-29 0.1875 30-31 0.1875 32-33 0.2 34-35 0.2 36-37 0.1875 38-39 0.1625 40-41 0.13749999999999998 42-43 0.1875 44-45 0.17500000000000002 46-47 0.1875 48-49 0.11249999999999999 50-51 0.2 52-53 0.125 54-55 0.1875 56-57 0.1875 58-59 0.17500000000000002 60-61 0.13749999999999998 62-63 0.13749999999999998 64-65 0.1875 66-67 0.15 68-69 0.2 70-71 0.1875 72-73 0.1625 74-75 0.1875 76-77 0.2 78-79 0.21250000000000002 80-81 0.1875 82-83 0.1875 84-85 0.2 86-87 0.21250000000000002 88-89 0.21250000000000002 90-91 0.2 92-93 0.2 94-95 0.2 96-97 0.2 98-99 0.22499999999999998 100 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514264 spots for SRR1635430.sra Written 514264 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra Read 514261 spots for SRR1635430.sra Written 514261 spots for SRR1635430.sra SRR ids: ['SRR1635430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q3986dre SRR1635430.sra spots: 10285223 blocks: [[1, 514261], [514262, 1028522], [1028523, 1542783], [1542784, 2057044], [2057045, 2571305], [2571306, 3085566], [3085567, 3599827], [3599828, 4114088], [4114089, 4628349], [4628350, 5142610], [5142611, 5656871], [5656872, 6171132], [6171133, 6685393], [6685394, 7199654], [7199655, 7713915], [7713916, 8228176], [8228177, 8742437], [8742438, 9256698], [9256699, 9770959], [9770960, 10285223]] SRR1635430 file size 2786312 SRR1635430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1635430 SRR1635430_1.fastq SRR1635430_2.fastq Input file: SRR1635430_1.fastq Paired file: SRR1635430_2.fastq trimmed: SRR1635430-trimmed-pair1.fastq, SRR1635430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 01:08:41 2024 >> started Tue Dec 10 01:08:52 2024 >> done (10.806s) 10285223 read pairs processed; of these: 44185 ( 0.43%) short read pairs filtered out after trimming by size control 72339 ( 0.70%) empty read pairs filtered out after trimming by size control 10168699 (98.87%) read pairs available; of these: 1223338 (12.03%) trimmed read pairs available after processing 8945361 (87.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 15 0.00% 21 43 0.00% 22 53 0.00% 23 86 0.00% 24 123 0.00% 25 153 0.00% 26 225 0.00% 27 246 0.00% 28 297 0.00% 29 313 0.00% 30 391 0.00% 31 446 0.00% 32 462 0.00% 33 533 0.01% 34 638 0.01% 35 630 0.01% 36 729 0.01% 37 764 0.01% 38 803 0.01% 39 871 0.01% 40 915 0.01% 41 945 0.01% 42 1066 0.01% 43 1172 0.01% 44 1204 0.01% 45 1194 0.01% 46 1345 0.01% 47 1333 0.01% 48 1434 0.01% 49 1569 0.02% 50 1721 0.02% 51 1747 0.02% 52 1930 0.02% 53 1964 0.02% 54 2255 0.02% 55 2377 0.02% 56 2592 0.03% 57 2891 0.03% 58 3054 0.03% 59 7340 0.07% 60 7752 0.08% 61 8516 0.08% 62 9290 0.09% 63 10053 0.10% 64 10239 0.10% 65 11092 0.11% 66 11555 0.11% 67 12259 0.12% 68 12343 0.12% 69 12992 0.13% 70 13510 0.13% 71 13868 0.14% 72 14059 0.14% 73 14234 0.14% 74 14358 0.14% 75 14528 0.14% 76 15013 0.15% 77 15267 0.15% 78 15780 0.16% 79 16501 0.16% 80 16843 0.17% 81 17050 0.17% 82 18202 0.18% 83 18650 0.18% 84 19481 0.19% 85 20641 0.20% 86 26202 0.26% 87 28027 0.28% 88 29167 0.29% 89 31995 0.31% 90 34979 0.34% 91 39349 0.39% 92 44252 0.44% 93 50963 0.50% 94 57744 0.57% 95 66646 0.66% 96 77582 0.76% 97 93084 0.92% 98 116723 1.15% 99 114667 1.13% 100 8945361 87.97% 10168699 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=29 prefix-density=0.09 prefix-fanout=3.6 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=290.07 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=23.9 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.98 fanout-score-rank=26 prefix-density=0.11 prefix-fanout=4.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=304.96 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=23.4 sequence=CGCCGCCGCCGT SRR1635430 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 01:09:32 Started mapping on | Dec 10 01:09:33 Finished on | Dec 10 01:10:00 Mapping speed, Million of reads per hour | 1355.83 Number of input reads | 10168699 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 9834967 Uniquely mapped reads % | 96.72% Average mapped length | 196.19 Number of splices: Total | 6531243 Number of splices: Annotated (sjdb) | 6193834 Number of splices: GT/AG | 6445699 Number of splices: GC/AG | 73583 Number of splices: AT/AC | 3767 Number of splices: Non-canonical | 8194 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.86 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128840 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 14182 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 210524 210524 210524 N_multimapping 128840 128840 128840 N_noFeature 343286 4999811 5013327 N_ambiguous 188871 12344 12402 UnstrandedReadsAssigned:9302810 PositiveStrandReadsAssigned:4822812 NegativeStrandReadsAssigned:4809238 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR1635430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1635430-trimmed-pair1.fastq SRR1635430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,168,699 reads, 9,576,363 reads pseudoaligned [quant] estimated average fragment length: 163.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52973 SRR1635430.ke.tsv 35125 SRR1635430.se.tsv 88098 total ==> SRR1635430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.023 0 0 PNS24247 1044 881.715 48.3104 8.30411 PNS24249 1928 1765.72 118.414 10.1639 PNS24246 1044 881.715 48.3104 8.30411 PNS24248 1044 881.715 48.3104 8.30411 PNS24244 1471 1308.72 38.6554 4.47657 PNS24243 293 136.655 3 3.32718 KQK14069 1603 1440.72 2656.68 279.475 KQK14071 474 313.568 204.988 99.0782 ==> SRR1635430.se.tsv <== BRADI_1g14170v3 3058 BRADI_1g53295v3 37 BRADI_1g59795v3 235 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 1614 BRADI_1g74790v3 281 BRADI_1g09890v3 5 BRADI_1g77505v3 177 BRADI_1g48960v3 1 SRR1635430 completed mapping pipeline successfully