Starting /dee2/code/volunteer_pipeline.sh SRR17229371 current disk space = 1548596748288 free memory = 1597664968 SRR17229371 SRAfilesize 16932927905f9e6d93c2a71124953486 SRR17229371.sra SRR17229371.sra file validated SRR17229371 is paired end SRR17229371 is conventional basespace SRR17229371 read1 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.67375 32.0 32.0 32.0 32.0 32.0 2 31.45625 32.0 32.0 32.0 32.0 32.0 3 34.62 37.0 32.0 37.0 32.0 37.0 4 36.0275 37.0 37.0 37.0 32.0 37.0 5 36.3675 37.0 37.0 37.0 37.0 37.0 6 39.43975 41.0 41.0 41.0 37.0 41.0 7 39.56575 41.0 41.0 41.0 37.0 41.0 8 39.78825 41.0 41.0 41.0 37.0 41.0 9 40.172 41.0 41.0 41.0 37.0 41.0 10-14 39.695049999999995 41.0 41.0 41.0 36.0 41.0 15-19 39.900099999999995 41.0 41.0 41.0 37.0 41.0 20-24 39.58965 41.0 41.0 41.0 36.0 41.0 25-29 39.50165 41.0 41.0 41.0 37.0 41.0 30-34 38.088 41.0 38.4 41.0 29.0 41.0 35-39 38.839192676656225 41.0 39.4 41.0 34.0 41.0 40-44 38.93781655441775 41.0 40.2 41.0 34.0 41.0 45-49 38.69468823103879 41.0 39.4 41.0 33.0 41.0 50-54 39.26493326418109 41.0 40.2 41.0 36.0 41.0 55-59 39.33152577508568 41.0 41.0 41.0 37.0 41.0 60-64 39.057389472151826 41.0 40.2 41.0 34.0 41.0 65-69 36.94568139989241 40.2 35.6 41.0 26.0 41.0 70-74 38.108907178712855 41.0 37.6 41.0 32.0 41.0 75-79 38.24748689349706 41.0 37.6 41.0 31.0 41.0 80-84 37.76030755994038 41.0 36.8 41.0 28.0 41.0 85-89 38.74512601433729 41.0 39.4 41.0 34.0 41.0 90-94 37.21909023999302 40.2 36.4 41.0 29.0 41.0 95-99 37.47750557945466 41.0 37.8 41.0 28.0 41.0 100-104 37.84439860962255 41.0 37.8 41.0 30.0 41.0 105-109 37.8996691045371 41.0 37.8 41.0 30.0 41.0 110-114 36.112732633674945 41.0 35.0 41.0 21.0 41.0 115-119 35.02599236149071 39.4 32.0 41.0 22.0 41.0 120-124 35.09938370071014 39.4 31.0 41.0 23.0 41.0 125-129 35.40601981838089 40.2 32.0 41.0 21.0 41.0 130-134 33.43524649248915 36.8 28.0 41.0 17.0 41.0 135-139 35.15241663951325 38.6 33.0 41.0 23.0 41.0 140-144 35.861584678091944 38.2 32.0 40.2 28.0 41.0 145-149 37.22535268813961 40.2 36.0 41.0 29.0 41.0 150-151 33.99547574528111 37.0 29.5 41.0 19.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 6.0 27 4.0 28 14.0 29 45.0 30 67.0 31 88.0 32 146.0 33 155.0 34 242.0 35 277.0 36 388.0 37 500.0 38 572.0 39 630.0 40 866.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.25 28.249999999999996 22.225 24.275 2 24.474999999999998 30.5 22.325 22.7 3 25.25 31.65 20.925 22.175 4 25.1 29.925 21.0 23.974999999999998 5 25.1 30.15 20.75 24.0 6 25.974999999999998 29.325000000000003 22.275 22.425 7 25.4 29.575000000000003 22.075 22.95 8 26.8 30.375000000000004 22.275 20.549999999999997 9 16.650000000000002 28.749999999999996 26.275 28.325 10-14 25.53 23.565 25.77 25.135 15-19 25.130000000000003 25.869999999999997 27.505000000000003 21.495 20-24 25.650000000000002 24.525 31.290000000000003 18.535 25-29 24.65 26.490000000000002 26.565 22.295 30-34 24.6 25.95 26.41 23.04 35-39 25.12268402603906 26.384576865297948 25.047571357035554 23.44516775162744 40-44 25.070408368537517 26.644538322269163 25.030175015087508 23.25487829410581 45-49 24.866337133057602 26.576213053566022 24.97730253202865 23.580147281347724 50-54 25.316071609183776 26.140386365935065 24.99747142712653 23.54607059775463 55-59 25.069666109337792 25.946192430460556 24.851801185590517 24.132340274611135 60-64 25.00507511165246 25.994721883881443 24.883272431993504 24.116930572472594 65-69 25.364238410596023 26.12328069281712 24.747834946510444 23.764645950076414 70-74 25.467110314819553 25.897107755310984 24.642948553877655 23.99283337599181 75-79 25.391206197732284 26.401929095479964 24.118824072648913 24.08804063413883 80-84 25.356609506153767 26.386528657500385 24.455430248725474 23.80143158762037 85-89 25.63811098480934 26.531983052598946 23.819365505838586 24.010540456753127 90-94 25.037621296248247 26.391987961185198 24.902703544185563 23.66768719838099 95-99 26.385113945222667 25.522684507631194 24.670708760192348 23.421492786953795 100-104 26.01262493424513 25.954760652288268 24.281956864807995 23.7506575486586 105-109 25.46428950440412 25.846333439456647 24.40836251724504 24.281014538894194 110-114 26.128649929964443 26.23100958948389 24.437021872643033 23.203318607908628 115-119 25.795617222772822 26.203061336857175 24.600814888228168 23.400506552141835 120-124 25.97216654258061 26.166886203539313 24.105148616917702 23.75579863696237 125-129 26.08975108098633 26.42281173308402 24.383545635152508 23.103891550777142 130-134 26.2900892211237 25.45213407282373 24.74680491921871 23.510971786833856 135-139 25.378811498409924 26.794288208517802 24.63677745214192 23.19012284093035 140-144 25.41252046857287 26.35722383171684 25.30545408741655 22.92480161229374 145-149 26.139759649011257 25.94900489603866 25.10332549119349 22.807909963756597 150-151 25.892553553213194 26.538592315538935 24.430465827949675 23.1383883032982 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.5 10 3.0 11 3.0 12 3.5 13 3.0 14 2.0 15 1.5 16 1.5 17 3.0 18 3.0 19 2.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 4.0 28 4.5 29 6.5 30 10.5 31 10.0 32 9.5 33 13.0 34 22.5 35 29.5 36 34.0 37 51.0 38 69.0 39 83.0 40 96.5 41 134.5 42 187.5 43 216.0 44 223.0 45 212.0 46 209.5 47 220.5 48 225.0 49 213.0 50 201.0 51 192.5 52 163.0 53 144.0 54 139.0 55 126.0 56 104.0 57 87.5 58 92.0 59 81.0 60 63.5 61 65.5 62 64.0 63 52.0 64 39.5 65 35.5 66 33.5 67 27.5 68 20.0 69 15.5 70 13.5 71 8.0 72 7.5 73 4.5 74 0.5 75 1.5 76 1.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 17.0 40-44 12.0 45-49 14.0 50-54 6.0 55-59 6.0 60-64 12.0 65-69 22.0 70-74 9.0 75-79 12.0 80-84 14.0 85-89 12.0 90-94 26.0 95-99 22.0 100-104 35.0 105-109 44.0 110-114 56.0 115-119 152.0 120-124 87.0 125-129 68.0 130-134 151.0 135-139 32.0 140-144 31.0 145-149 139.0 150-152 3021.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.125 #Duplication Level Percentage of deduplicated Percentage of total 1 97.16859716859717 94.375 2 2.7027027027027026 5.25 3 0.1287001287001287 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACACT 10 0.0076271 139.75 6 GTGTCTG 10 0.0076271 139.75 4 GGATGCT 10 0.0076271 139.75 7 TCGATGC 10 0.0076271 139.75 6 ACCACTG 10 0.0076271 139.75 7 TTGTACC 25 3.8293365E-8 139.75 8 TGTCTGT 10 0.0076271 139.75 5 TATGCTA 45 0.0 139.75 8 ACGCACT 10 0.0076271 139.75 6 CGAAGGC 10 0.0076271 139.75 4 TCGTGTC 10 0.0076271 139.75 2 GACACTG 10 0.0076271 139.75 7 TAGCAGA 20 2.2580607E-6 139.75 7 AGCAGAT 40 0.0 139.75 8 CCACTGG 25 3.8293365E-8 139.75 8 AAGATGC 10 0.0076271 139.75 6 GCAGATC 80 0.0 139.75 9 TCCACTG 10 0.0076271 139.75 7 AAGGCAG 10 0.0076271 139.75 6 AGATGCT 10 0.0076271 139.75 7 >>END_MODULE SRR17229371 read2 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.27875 32.0 32.0 32.0 12.0 32.0 2 31.14 32.0 32.0 32.0 32.0 32.0 3 34.39125 37.0 32.0 37.0 32.0 37.0 4 28.225 32.0 12.0 37.0 12.0 37.0 5 27.06375 32.0 12.0 37.0 12.0 37.0 6 32.36825 37.0 32.0 41.0 12.0 41.0 7 36.85225 41.0 37.0 41.0 32.0 41.0 8 37.43175 41.0 37.0 41.0 32.0 41.0 9 38.62375 41.0 37.0 41.0 32.0 41.0 10-14 37.9507 41.0 38.4 41.0 30.0 41.0 15-19 37.182249999999996 40.2 36.6 41.0 28.0 41.0 20-24 38.9843 41.0 40.2 41.0 36.0 41.0 25-29 37.085800000000006 40.2 35.8 41.0 26.0 41.0 30-34 36.84815 41.0 37.0 41.0 27.0 41.0 35-39 35.67469501623276 38.4 31.0 41.0 25.0 41.0 40-44 36.37782814667101 40.2 35.0 41.0 25.0 41.0 45-49 35.66438483782876 40.2 33.0 41.0 22.0 41.0 50-54 33.82692362754341 36.6 29.0 40.2 20.0 41.0 55-59 36.051868498206794 40.2 35.0 41.0 24.0 41.0 60-64 37.97961336001349 41.0 37.0 41.0 32.0 41.0 65-69 37.39835165344077 41.0 36.0 41.0 29.0 41.0 70-74 37.23663813491936 40.2 36.0 41.0 27.0 41.0 75-79 31.95995869095021 33.8 25.0 38.6 20.0 41.0 80-84 36.899000971584385 41.0 35.0 41.0 27.0 41.0 85-89 37.64300561130023 41.0 37.0 41.0 29.0 41.0 90-94 37.97450404483234 41.0 37.0 41.0 30.0 41.0 95-99 37.06712904460659 40.2 35.0 41.0 27.0 41.0 100-104 38.24226902257938 41.0 37.0 41.0 31.0 41.0 105-109 37.11503895290091 41.0 37.0 41.0 27.0 41.0 110-114 32.906292993651064 37.0 28.0 41.0 18.0 41.0 115-119 37.16230340400165 40.2 37.0 41.0 29.0 41.0 120-124 36.36911429808058 40.2 35.0 41.0 27.0 41.0 125-129 35.479163853385344 37.8 32.0 41.0 22.0 41.0 130-134 31.81610062948821 34.8 24.0 41.0 15.0 41.0 135-139 32.36820309067655 36.0 27.0 41.0 16.0 41.0 140-144 33.0655450244286 36.0 29.0 41.0 17.0 41.0 145-149 31.18268689458069 33.0 26.0 38.6 18.0 41.0 150-151 25.40655090562469 24.5 17.0 32.0 17.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 11.0 24 18.0 25 35.0 26 44.0 27 59.0 28 101.0 29 124.0 30 149.0 31 188.0 32 221.0 33 322.0 34 354.0 35 365.0 36 504.0 37 435.0 38 463.0 39 407.0 40 198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.35 14.274999999999999 39.5 30.875000000000004 2 25.224999999999998 12.3 27.925 34.55 3 25.900000000000002 10.5 31.225 32.375 4 24.75 9.425 34.599999999999994 31.225 5 24.775 10.95 34.449999999999996 29.825000000000003 6 26.125 15.0 33.225 25.650000000000002 7 24.95 22.125 33.6 19.325 8 20.424999999999997 25.5 31.1 22.975 9 19.925 27.450000000000003 32.65 19.975 10-14 20.724999999999998 26.284999999999997 31.11 21.88 15-19 21.65 26.279999999999998 28.360000000000003 23.71 20-24 22.759999999999998 25.985000000000003 26.375 24.88 25-29 21.959999999999997 25.919999999999998 27.155 24.965 30-34 22.475 25.779999999999998 27.465 24.279999999999998 35-39 22.23003515821195 26.03214465092918 27.614264188849823 24.123556002009042 40-44 22.378724702532292 25.282212956371403 26.955151022068545 25.383911319027764 45-49 22.546350983513943 26.18252786194854 26.51122181706127 24.759899337476245 50-54 23.46574190836486 25.141866330390922 27.12799495586381 24.26439680538041 55-59 22.656083528659707 25.277008310249304 26.773918602173453 25.29298955891754 60-64 22.26208964815509 25.887645263214264 26.632035559363786 25.218229529266857 65-69 22.195909580193756 25.748116254036596 26.31324004305705 25.742734122712598 70-74 22.66739248775177 25.91725639629831 26.271094175285793 25.14425694066413 75-79 22.332915860184446 25.48673573949676 28.076966867812818 24.103381532505978 80-84 22.813115513845442 25.45475611169042 26.393233692503763 25.338894681960376 85-89 23.18832116788321 24.642335766423358 26.756204379562043 25.413138686131386 90-94 23.190277696236716 25.397757294663297 26.366465097164326 25.045499911935654 95-99 23.31444090211359 25.144645176526154 25.965285157633723 25.57562876372653 100-104 23.097019356370975 25.460159125994537 26.350789692435576 25.09203182519891 105-109 22.997121611897338 25.491724634204843 26.667066442792038 24.84408731110578 110-114 23.908216136195414 25.19121638292623 26.134961756723413 24.765605724154945 115-119 23.373738655835503 24.846100145966872 26.23595862156502 25.544202576632607 120-124 23.047001620745544 25.555915721231763 26.249594813614262 25.147487844408428 125-129 23.631104533835597 25.97874344140993 25.561684380465493 24.82846764428898 130-134 22.45274660366214 25.295333727111636 26.712935617247492 25.538984051978737 135-139 22.650205761316872 25.876543209876544 26.090534979423868 25.382716049382715 140-144 23.602702465561112 25.30490479950864 26.217425638325874 24.87496709660437 145-149 22.93879127244642 25.043444680440242 27.01293686039776 25.004827186715584 150-151 25.43332154227096 26.388397594623275 29.18287937743191 18.99540148567386 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 2.5 16 2.0 17 0.5 18 0.0 19 1.0 20 1.0 21 2.0 22 3.5 23 2.0 24 1.0 25 2.0 26 2.5 27 3.0 28 6.5 29 8.5 30 10.0 31 16.5 32 28.0 33 35.5 34 44.5 35 60.0 36 79.5 37 98.0 38 124.0 39 147.5 40 169.5 41 188.0 42 189.5 43 213.5 44 238.0 45 229.5 46 229.5 47 234.0 48 207.0 49 197.0 50 198.5 51 171.5 52 144.5 53 134.5 54 118.5 55 98.5 56 87.5 57 74.5 58 61.0 59 62.0 60 63.0 61 56.0 62 49.5 63 43.0 64 40.0 65 32.5 66 31.0 67 29.0 68 22.0 69 18.5 70 16.0 71 17.5 72 15.0 73 12.0 74 13.5 75 10.0 76 5.5 77 4.0 78 3.0 79 5.0 80 4.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 53.0 40-44 32.0 45-49 72.0 50-54 74.0 55-59 28.0 60-64 13.0 65-69 27.0 70-74 127.0 75-79 109.0 80-84 32.0 85-89 19.0 90-94 18.0 95-99 18.0 100-104 25.0 105-109 57.0 110-114 126.0 115-119 46.0 120-124 101.0 125-129 136.0 130-134 378.0 135-139 167.0 140-144 136.0 145-149 665.0 150-152 1541.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4505969011938 96.89999999999999 2 1.4986029972059944 2.9499999999999997 3 0.05080010160020319 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 50 0.0026650187 21.65368 135-139 >>END_MODULE Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991126 spots for SRR17229371.sra Written 2991126 spots for SRR17229371.sra Read 2991142 spots for SRR17229371.sra Written 2991142 spots for SRR17229371.sra SRR ids: ['SRR17229371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l3mn1n1u SRR17229371.sra spots: 59822536 blocks: [[1, 2991126], [2991127, 5982252], [5982253, 8973378], [8973379, 11964504], [11964505, 14955630], [14955631, 17946756], [17946757, 20937882], [20937883, 23929008], [23929009, 26920134], [26920135, 29911260], [29911261, 32902386], [32902387, 35893512], [35893513, 38884638], [38884639, 41875764], [41875765, 44866890], [44866891, 47858016], [47858017, 50849142], [50849143, 53840268], [53840269, 56831394], [56831395, 59822536]] SRR17229371 file size 19877480 SRR17229371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17229371 SRR17229371_1.fastq SRR17229371_2.fastq Input file: SRR17229371_1.fastq Paired file: SRR17229371_2.fastq trimmed: SRR17229371-trimmed-pair1.fastq, SRR17229371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:50:23 2024 >> started Fri Dec 6 22:51:30 2024 >> done (66.934s) 59822536 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 59822531 (100.00%) read pairs available; of these: 19812 ( 0.03%) trimmed read pairs available after processing 59802719 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 727 0.00% 37 1695 0.00% 38 2520 0.00% 39 3209 0.01% 40 4132 0.01% 41 4753 0.01% 42 5477 0.01% 43 6228 0.01% 44 6756 0.01% 45 7645 0.01% 46 8734 0.01% 47 9380 0.02% 48 9860 0.02% 49 10497 0.02% 50 11211 0.02% 51 11519 0.02% 52 12461 0.02% 53 12658 0.02% 54 13334 0.02% 55 14021 0.02% 56 14663 0.02% 57 14968 0.03% 58 15635 0.03% 59 15999 0.03% 60 16424 0.03% 61 17066 0.03% 62 17679 0.03% 63 18047 0.03% 64 18904 0.03% 65 19519 0.03% 66 19945 0.03% 67 20593 0.03% 68 21144 0.04% 69 21715 0.04% 70 22286 0.04% 71 22866 0.04% 72 23644 0.04% 73 24025 0.04% 74 24776 0.04% 75 25266 0.04% 76 26348 0.04% 77 27268 0.05% 78 28251 0.05% 79 28930 0.05% 80 30257 0.05% 81 31248 0.05% 82 32688 0.05% 83 33694 0.06% 84 35504 0.06% 85 36619 0.06% 86 37981 0.06% 87 39813 0.07% 88 41639 0.07% 89 43854 0.07% 90 45820 0.08% 91 47058 0.08% 92 50758 0.08% 93 140417 0.23% 94 212003 0.35% 95 215707 0.36% 96 210978 0.35% 97 204666 0.34% 98 201443 0.34% 99 199185 0.33% 100 195052 0.33% 101 200254 0.33% 102 200734 0.34% 103 205119 0.34% 104 195176 0.33% 105 188295 0.31% 106 187248 0.31% 107 199069 0.33% 108 206160 0.34% 109 197509 0.33% 110 197995 0.33% 111 192950 0.32% 112 195696 0.33% 113 203109 0.34% 114 196696 0.33% 115 191323 0.32% 116 202103 0.34% 117 198712 0.33% 118 188937 0.32% 119 179785 0.30% 120 184947 0.31% 121 191280 0.32% 122 188063 0.31% 123 180616 0.30% 124 171357 0.29% 125 168218 0.28% 126 171444 0.29% 127 175483 0.29% 128 181682 0.30% 129 181418 0.30% 130 181818 0.30% 131 189429 0.32% 132 199495 0.33% 133 190374 0.32% 134 205128 0.34% 135 217204 0.36% 136 241835 0.40% 137 312806 0.52% 138 341184 0.57% 139 364761 0.61% 140 386440 0.65% 141 390774 0.65% 142 420995 0.70% 143 433743 0.73% 144 448412 0.75% 145 459427 0.77% 146 460219 0.77% 147 363868 0.61% 148 388037 0.65% 149 574719 0.96% 150 7230009 12.09% 151 37551308 62.77% 59822531 reads passed initial QC criterion=sequence-density sequence-density=23.89 sequence-density-rank=1 fanout-score=64.63 fanout-score-rank=11 prefix-density=25.16 prefix-fanout=61.3 sequence=ATGCTATCTGGT criterion=fanout-score sequence-density=2.16 sequence-density-rank=29 fanout-score=174.47 fanout-score-rank=1 prefix-density=24.29 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=117.18 fanout-score-rank=6 prefix-density=0.80 prefix-fanout=18.5 sequence=TTCTTCTTCTTCGCCTTCATACCAACTTCATGCACCAAACCAGAATCAGCAACAACCTTCGAAGTACCCGCCAAATCCCAACTCAGAGAGCTTCAGGTGTGCCTCAGCATAGTCAGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=216.42 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=28.5 sequence=TCATCATCATCC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x ATGCTATCTGGT -y TTCTTCTTCTTCGCCTTCATACCAACTTCATGCACCAAACCAGAATCAGCAACAACCTTCGAAGTACCCGCCAAATCCCAACTCAGAGAGCTTCAGGTGTGCCTCAGCATAGTCAGCA -o SRR17229371 SRR17229371_1.fastq SRR17229371_2.fastq Input file: SRR17229371_1.fastq Paired file: SRR17229371_2.fastq trimmed: SRR17229371-trimmed-pair1.fastq, SRR17229371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): ATGCTATCTGGT -- paired 3' end adapter sequence (-y): TTCTTCTTCTTCGCCTTCATACCAACTTCATGCACCAAACCAGAATCAGCAACAACCTTCGAAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:56:13 2024 >> started Fri Dec 6 22:57:06 2024 >> done (52.820s) 50619065 read pairs processed; of these: 643 ( 0.00%) short read pairs filtered out after trimming by size control 616 ( 0.00%) empty read pairs filtered out after trimming by size control 50617806 (100.00%) read pairs available; of these: 5122 ( 0.01%) trimmed read pairs available after processing 50612684 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 613 0.00% 37 1449 0.00% 38 2124 0.00% 39 2715 0.01% 40 3477 0.01% 41 4049 0.01% 42 4620 0.01% 43 5262 0.01% 44 5681 0.01% 45 6477 0.01% 46 7376 0.01% 47 7927 0.02% 48 8359 0.02% 49 8864 0.02% 50 9556 0.02% 51 9719 0.02% 52 10479 0.02% 53 10779 0.02% 54 11271 0.02% 55 11828 0.02% 56 12384 0.02% 57 12719 0.03% 58 13238 0.03% 59 13548 0.03% 60 13884 0.03% 61 14401 0.03% 62 14966 0.03% 63 15292 0.03% 64 15997 0.03% 65 16492 0.03% 66 16842 0.03% 67 17393 0.03% 68 17891 0.04% 69 18396 0.04% 70 18882 0.04% 71 19322 0.04% 72 20006 0.04% 73 20337 0.04% 74 20945 0.04% 75 21363 0.04% 76 22262 0.04% 77 23001 0.05% 78 23800 0.05% 79 24444 0.05% 80 25637 0.05% 81 26556 0.05% 82 27692 0.05% 83 28429 0.06% 84 30001 0.06% 85 30935 0.06% 86 32093 0.06% 87 33738 0.07% 88 35130 0.07% 89 36970 0.07% 90 38808 0.08% 91 39684 0.08% 92 42832 0.08% 93 118871 0.23% 94 179426 0.35% 95 182331 0.36% 96 178531 0.35% 97 173053 0.34% 98 170211 0.34% 99 168332 0.33% 100 164816 0.33% 101 169311 0.33% 102 169829 0.34% 103 173545 0.34% 104 164956 0.33% 105 159388 0.31% 106 158315 0.31% 107 168563 0.33% 108 174787 0.35% 109 167231 0.33% 110 167378 0.33% 111 163373 0.32% 112 165782 0.33% 113 171805 0.34% 114 166618 0.33% 115 162061 0.32% 116 170788 0.34% 117 168251 0.33% 118 159899 0.32% 119 152319 0.30% 120 156389 0.31% 121 162156 0.32% 122 158963 0.31% 123 152657 0.30% 124 145095 0.29% 125 142435 0.28% 126 144855 0.29% 127 148208 0.29% 128 153570 0.30% 129 153681 0.30% 130 153895 0.30% 131 160319 0.32% 132 168776 0.33% 133 161182 0.32% 134 173753 0.34% 135 183613 0.36% 136 204475 0.40% 137 264718 0.52% 138 288614 0.57% 139 308140 0.61% 140 326974 0.65% 141 330378 0.65% 142 356325 0.70% 143 367638 0.73% 144 381869 0.75% 145 385138 0.76% 146 389001 0.77% 147 308080 0.61% 148 328804 0.65% 149 486449 0.96% 150 6119217 12.09% 151 31773729 62.77% criterion=sequence-density sequence-density=23.67 sequence-density-rank=1 fanout-score=64.83 fanout-score-rank=11 prefix-density=25.02 prefix-fanout=61.3 sequence=ATGCTATCTGGT criterion=fanout-score sequence-density=2.18 sequence-density-rank=28 fanout-score=172.48 fanout-score-rank=1 prefix-density=24.21 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=2.1 sequence=CCATGCTAATGTAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=174.49 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=16.5 sequence=TTCTTCTTCTTTCTCGTCGTAATCCCGATGAATTTCGTCGAATTTGCTGGATCAGATCAGATCCTGGACGGGATGAGGGGCGTGGCATTGGAAAGGTACGCGGCGGCAGCTGCCACGCCGCTCCCCAGCTTCACCGGGTACCCGACGTCCTT SRR17229371 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 06 23:45:59 Started mapping on | Dec 06 23:46:03 Finished on | Dec 07 00:13:13 Mapping speed, Million of reads per hour | 132.02 Number of input reads | 59776155 Average input read length | 267 UNIQUE READS: Uniquely mapped reads number | 40733299 Uniquely mapped reads % | 68.14% Average mapped length | 267.08 Number of splices: Total | 37932248 Number of splices: Annotated (sjdb) | 35613700 Number of splices: GT/AG | 37298312 Number of splices: GC/AG | 457870 Number of splices: AT/AC | 23157 Number of splices: Non-canonical | 152909 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494047 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 51118 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.58% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 18738705 18738705 18738705 N_multimapping 494047 494047 494047 N_noFeature 1865190 2325968 39353045 N_ambiguous 1100988 186052 8154 UnstrandedReadsAssigned:37767121 PositiveStrandReadsAssigned:38221279 NegativeStrandReadsAssigned:1372100 Dataset is classified positive stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR17229371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR17229371-trimmed-pair1.fastq SRR17229371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 59,776,155 reads, 38,747,905 reads pseudoaligned [quant] estimated average fragment length: 288.928 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 SRR17229371.ke.tsv 35125 SRR17229371.se.tsv 88098 total ==> SRR17229371.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.523 0 0 PNS24247 1044 756.072 80.6199 3.92043 PNS24249 1928 1640.07 242.759 5.44212 PNS24246 1044 756.072 80.6199 3.92043 PNS24248 1044 756.072 80.6199 3.92043 PNS24244 1471 1183.07 841.381 26.1479 PNS24243 293 72.5397 0 0 KQK14069 1603 1315.07 7219.7 201.848 KQK14071 474 202.522 154.78 28.0993 ==> SRR17229371.se.tsv <== BRADI_1g14170v3 10574 BRADI_1g53295v3 348 BRADI_1g59795v3 1718 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 514 BRADI_1g74790v3 1214 BRADI_1g09890v3 0 BRADI_1g77505v3 669 BRADI_1g48960v3 0 SRR17229371 completed mapping pipeline successfully