Starting /dee2/code/volunteer_pipeline.sh SRR17229372 current disk space = 1548544921600 free memory = 1416816476 SRR17229372 SRAfilesize 551211e61efaa99e06b263ecd5934689 SRR17229372.sra SRR17229372.sra file validated SRR17229372 is paired end SRR17229372 is conventional basespace SRR17229372 read1 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.29 32.0 12.0 32.0 12.0 32.0 2 31.81375 32.0 32.0 32.0 32.0 32.0 3 34.32 37.0 32.0 37.0 32.0 37.0 4 35.96625 37.0 37.0 37.0 32.0 37.0 5 36.44875 37.0 37.0 37.0 37.0 37.0 6 39.70475 41.0 41.0 41.0 37.0 41.0 7 39.779 41.0 41.0 41.0 37.0 41.0 8 40.103 41.0 41.0 41.0 37.0 41.0 9 40.1 41.0 41.0 41.0 37.0 41.0 10-14 40.203849999999996 41.0 41.0 41.0 37.8 41.0 15-19 39.83245 41.0 41.0 41.0 37.0 41.0 20-24 39.29485 41.0 41.0 41.0 37.0 41.0 25-29 39.6278 41.0 41.0 41.0 37.0 41.0 30-34 40.09845 41.0 41.0 41.0 37.0 41.0 35-39 39.70603860280778 41.0 41.0 41.0 37.0 41.0 40-44 39.58476915835219 41.0 41.0 41.0 37.0 41.0 45-49 39.197137773646666 41.0 40.2 41.0 35.0 41.0 50-54 40.05441000029672 41.0 41.0 41.0 37.0 41.0 55-59 39.35124079726633 41.0 40.2 41.0 35.0 41.0 60-64 39.72342148146798 41.0 41.0 41.0 37.0 41.0 65-69 39.19599397182822 41.0 39.4 41.0 35.0 41.0 70-74 36.0001380239415 40.2 34.8 41.0 24.0 41.0 75-79 35.96788152867033 39.4 33.0 41.0 27.0 41.0 80-84 37.84045915596353 41.0 38.6 41.0 29.0 41.0 85-89 33.877078911006535 37.6 27.8 41.0 20.0 41.0 90-94 38.200062350195594 41.0 37.6 41.0 31.0 41.0 95-99 39.54155254435184 41.0 41.0 41.0 36.0 41.0 100-104 36.53329844440665 39.2 32.6 41.0 29.0 41.0 105-109 39.178681497084256 41.0 41.0 41.0 35.0 41.0 110-114 37.43726721959532 40.2 36.6 41.0 29.0 41.0 115-119 39.121862954104564 41.0 41.0 41.0 35.0 41.0 120-124 39.38139753968231 41.0 40.2 41.0 36.0 41.0 125-129 38.76394403662705 41.0 38.6 41.0 34.0 41.0 130-134 34.86133941344307 38.6 31.0 41.0 22.0 41.0 135-139 34.46059102385685 37.8 31.0 41.0 21.0 41.0 140-144 32.943421418140396 36.0 26.0 40.2 18.0 41.0 145-149 33.69557686080536 36.8 29.0 41.0 18.0 41.0 150-151 37.461266563032055 39.0 34.5 41.0 29.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 2.0 28 14.0 29 10.0 30 32.0 31 66.0 32 73.0 33 135.0 34 182.0 35 266.0 36 372.0 37 568.0 38 778.0 39 851.0 40 651.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.525 28.825 22.400000000000002 22.25 2 26.513256628314156 28.289144572286144 22.511255627813906 22.686343171585793 3 26.575 29.25 21.925 22.25 4 25.55 28.225 21.8 24.425 5 25.4 29.5 21.375 23.724999999999998 6 25.15 29.175 21.825 23.849999999999998 7 25.25 30.175 21.45 23.125 8 26.525 31.55 21.275 20.65 9 16.825000000000003 28.075 27.575 27.525 10-14 25.405 23.51 25.605 25.480000000000004 15-19 25.465 25.679999999999996 27.515 21.34 20-24 26.064999999999998 24.66 31.39 17.885 25-29 25.924999999999997 26.06 26.93 21.085 30-34 26.279999999999998 26.105 25.05 22.564999999999998 35-39 26.220488195278115 26.175470188075227 24.314725890356144 23.289315726290518 40-44 26.393828582878324 25.702549716976407 25.031307919651358 22.872313780493915 45-49 26.508143977478383 25.59823044439976 24.72853408405389 23.165091494067966 50-54 26.513359834951945 26.256730237004984 24.254012982438482 22.97589694560459 55-59 26.46895926690499 25.58783545642213 24.968531292482755 22.974673984190122 60-64 26.033203814906393 25.927234192864713 24.77166069536257 23.267901296866327 65-69 26.044350154063743 26.12011920998131 24.377430923877355 23.458099712077587 70-74 26.419035972689294 25.221644756955058 25.14521553041883 23.214103739936817 75-79 26.384163315805754 25.739766986287243 24.87885349005052 22.99721620785648 80-84 26.512326496788894 25.901180857675577 24.243836751605553 23.34265589392998 85-89 26.538016615837627 25.770322852034916 25.155116205699862 22.536544326427595 90-94 26.21179212798644 25.72442655082905 24.294114530910633 23.769666790273877 95-99 26.418496128963838 26.163962244140414 24.366316682575036 23.051224944320715 100-104 26.953934434939697 25.933797354019443 24.46203708623346 22.650231124807398 105-109 26.388222115538483 25.918813676854963 24.771963514162266 22.921000693444284 110-114 26.68772418223674 26.221960490390277 24.134054285561326 22.95626104181166 115-119 26.6112600536193 26.16621983914209 24.284182305630026 22.93833780160858 120-124 26.747311827956988 25.79032258064516 24.50537634408602 22.956989247311828 125-129 26.08296919674165 26.498354642067216 24.469978960996926 22.948697200194207 130-134 27.048864948056945 26.427746935634584 23.767383059418457 22.756005056890015 135-139 27.50499001996008 26.164813230681496 23.484459652124322 22.845737097234103 140-144 26.699234063084255 26.331343103552257 24.166214341716422 22.803208491647066 145-149 26.73097670876436 26.48346766516469 24.41454591610078 22.37100970997017 150-151 27.516778523489933 27.56711409395973 23.30536912751678 21.610738255033556 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 2.0 13 2.5 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 1.0 23 1.5 24 1.0 25 1.0 26 1.5 27 1.5 28 3.5 29 4.5 30 5.5 31 7.5 32 9.5 33 16.5 34 23.0 35 31.5 36 37.5 37 43.0 38 75.0 39 104.0 40 118.5 41 146.5 42 169.5 43 195.0 44 212.0 45 220.5 46 239.5 47 244.0 48 221.0 49 201.0 50 184.5 51 152.0 52 129.5 53 122.0 54 119.5 55 110.0 56 98.0 57 84.5 58 82.5 59 85.5 60 75.0 61 75.0 62 72.0 63 63.5 64 58.0 65 46.5 66 39.0 67 36.0 68 29.0 69 22.5 70 19.5 71 13.0 72 8.5 73 7.0 74 5.0 75 4.0 76 1.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 4.0 40-44 13.0 45-49 7.0 50-54 2.0 55-59 7.0 60-64 6.0 65-69 9.0 70-74 68.0 75-79 13.0 80-84 25.0 85-89 69.0 90-94 5.0 95-99 2.0 100-104 15.0 105-109 17.0 110-114 4.0 115-119 10.0 120-124 11.0 125-129 27.0 130-134 127.0 135-139 145.0 140-144 235.0 145-149 63.0 150-152 3116.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.66877804169965 89.67500000000001 2 5.093692267088942 9.65 3 0.23752969121140144 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATGCT 10 0.008171767 136.5625 7 ACTGTAC 10 0.008171767 136.5625 7 CAATGCT 15 1.4489758E-4 136.5625 7 GTCACTG 10 0.008171767 136.5625 7 GAGTGTA 10 0.008171767 136.5625 6 TTGTACC 15 1.4489758E-4 136.5625 8 TATGCTA 35 1.2732926E-11 136.5625 8 GATGTAC 10 0.008171767 136.5625 7 TTTTCAC 10 0.008171767 136.5625 5 TTTCACT 10 0.008171767 136.5625 6 CACTGGA 75 0.0 136.5625 9 TCTGTAC 10 0.008171767 136.5625 7 AGTGTAC 10 0.008171767 136.5625 7 ATGCTAT 125 0.0 136.5625 9 TCATGCT 10 0.008171767 136.5625 7 CGCAGAT 15 1.4489758E-4 136.5625 8 ATATGCT 15 1.4489758E-4 136.5625 7 CTTGTAC 10 0.008171767 136.5625 7 CGCACTG 10 0.008171767 136.5625 7 TGTACCG 135 0.0 126.44676 9 >>END_MODULE SRR17229372 read2 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6775 32.0 32.0 32.0 27.0 32.0 2 30.89125 32.0 32.0 32.0 32.0 32.0 3 33.89 37.0 32.0 37.0 32.0 37.0 4 35.4175 37.0 37.0 37.0 32.0 37.0 5 33.39125 37.0 32.0 37.0 22.0 37.0 6 38.2445 41.0 37.0 41.0 32.0 41.0 7 39.07225 41.0 41.0 41.0 37.0 41.0 8 39.42675 41.0 41.0 41.0 37.0 41.0 9 38.96075 41.0 41.0 41.0 37.0 41.0 10-14 37.48435 41.0 36.8 41.0 29.0 41.0 15-19 36.26265 40.2 33.8 41.0 25.0 41.0 20-24 35.8939 39.4 33.8 41.0 24.0 41.0 25-29 37.04455 41.0 36.0 41.0 25.0 41.0 30-34 36.91375000000001 40.2 35.0 41.0 26.0 41.0 35-39 34.395273107431976 36.6 30.0 40.2 22.0 41.0 40-44 34.82454500390434 38.6 32.0 41.0 22.0 41.0 45-49 37.70580027075477 41.0 37.8 41.0 29.0 41.0 50-54 35.540904794713455 39.2 32.0 41.0 25.0 41.0 55-59 29.961205712498042 30.8 21.0 38.4 17.0 40.2 60-64 37.39902266734045 41.0 36.0 41.0 28.0 41.0 65-69 38.11808260653844 41.0 38.6 41.0 31.0 41.0 70-74 38.27890662675111 41.0 37.0 41.0 31.0 41.0 75-79 35.331365625266116 39.4 33.0 41.0 23.0 41.0 80-84 36.08678595822486 40.2 34.0 41.0 24.0 41.0 85-89 37.597864976117854 41.0 36.0 41.0 29.0 41.0 90-94 35.942515828860536 40.2 34.0 41.0 22.0 41.0 95-99 38.45863266624244 41.0 37.8 41.0 31.0 41.0 100-104 38.24121328737026 41.0 37.8 41.0 30.0 41.0 105-109 36.53296259016459 40.2 36.0 41.0 27.0 41.0 110-114 36.676898480353756 40.2 35.0 41.0 26.0 41.0 115-119 36.633026403863724 40.2 35.0 41.0 26.0 41.0 120-124 32.26826309259452 35.8 27.0 40.2 20.0 41.0 125-129 35.04127199675769 37.8 33.0 41.0 23.0 41.0 130-134 33.59841691709498 35.8 28.0 41.0 21.0 41.0 135-139 29.40993280155454 31.0 23.0 38.4 13.2 41.0 140-144 31.026319153695887 33.0 26.0 39.2 17.2 41.0 145-149 31.643994677200038 33.0 28.0 38.4 22.0 40.2 150-151 33.03053458151366 34.5 27.0 39.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 5.0 23 12.0 24 17.0 25 27.0 26 43.0 27 74.0 28 94.0 29 121.0 30 160.0 31 180.0 32 234.0 33 307.0 34 340.0 35 420.0 36 495.0 37 539.0 38 526.0 39 325.0 40 79.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.899999999999999 14.224999999999998 39.75 31.125000000000004 2 23.075000000000003 12.5 27.275 37.15 3 22.7 11.075 33.15 33.074999999999996 4 21.625 10.5 34.2 33.675 5 21.4 10.775 35.675000000000004 32.15 6 22.35 14.7 35.925000000000004 27.025 7 21.349999999999998 22.275 33.4 22.975 8 19.15 24.575 32.05 24.224999999999998 9 17.25 30.425 32.425 19.900000000000002 10-14 19.31 26.229999999999997 31.330000000000002 23.13 15-19 20.855 25.45 29.345 24.349999999999998 20-24 20.585 25.759999999999998 27.915 25.740000000000002 25-29 20.91 25.0 27.83 26.26 30-34 20.93 26.11 26.525 26.435 35-39 21.789278371195024 24.66776992126774 27.621483375959077 25.921468331578158 40-44 21.402777071359544 24.907176644117797 28.05045521590967 25.639591068612987 45-49 21.449126413155188 24.830421377183967 28.00616649537513 25.71428571428571 50-54 21.315051417887194 25.485613379038124 26.804819777708527 26.394515425366155 55-59 21.397590361445783 25.702811244979916 27.86077643908969 25.038821954484604 60-64 21.774807086186286 25.45375502662754 27.578524073470273 25.1929138137159 65-69 21.57023438780528 25.280008741736324 26.700540894935255 26.44921597552314 70-74 21.87895112967951 24.79247979770216 26.61755813314276 26.711010939475564 75-79 21.538974758145223 25.636606249305018 27.443567218948072 25.38085177360169 80-84 21.524410869320104 24.57436013079265 27.72014883301387 26.18108016687338 85-89 21.908869091528118 23.94030528286898 26.845599500652558 27.305226124950348 90-94 21.970176751684033 24.670389774886292 26.921526858195637 26.437906615234034 95-99 22.606830173363484 24.810111903519452 26.91482576680002 25.66823215631704 100-104 22.09532688497844 24.50763314299033 26.56450297168162 26.83253700034961 105-109 21.941896024464832 25.6292637026582 26.740766878381557 25.688073394495415 110-114 21.27799343087489 25.111973723499553 26.98716034637205 26.622872499253507 115-119 22.021726010863006 24.44176222088111 26.578153289076646 26.95835847917924 120-124 22.26952980377638 24.916697519437246 26.51487103541898 26.298901641367394 125-129 22.198179851078727 25.18296951568765 26.538534971043088 26.080315662190547 130-134 22.163623178851605 24.8796888390797 26.738743490012524 26.217944492056166 135-139 21.79541897851757 26.034997865983783 26.141698676909947 26.027884478588703 140-144 22.154328241284762 25.82060321190756 26.408147277712494 25.616921269095183 145-149 22.577594359900267 24.984954002235405 26.437967500644827 25.999484137219497 150-151 22.546419098143236 26.525198938992045 25.07836990595611 25.85001205690861 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 1.5 24 2.0 25 2.5 26 4.5 27 5.5 28 5.5 29 9.5 30 17.0 31 24.0 32 30.0 33 36.5 34 48.0 35 57.5 36 77.5 37 104.0 38 126.5 39 155.5 40 173.0 41 201.0 42 215.5 43 221.0 44 245.0 45 243.5 46 227.5 47 230.0 48 214.5 49 185.0 50 161.5 51 138.5 52 132.5 53 125.5 54 124.0 55 107.5 56 86.0 57 69.0 58 57.0 59 55.0 60 47.5 61 49.0 62 47.5 63 39.5 64 32.0 65 28.0 66 29.0 67 29.5 68 25.0 69 21.0 70 18.0 71 15.0 72 14.5 73 12.0 74 10.0 75 10.5 76 12.0 77 11.0 78 7.0 79 2.5 80 0.5 81 1.0 82 1.5 83 1.5 84 1.0 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 42.0 40-44 54.0 45-49 32.0 50-54 100.0 55-59 84.0 60-64 18.0 65-69 24.0 70-74 25.0 75-79 63.0 80-84 25.0 85-89 29.0 90-94 48.0 95-99 18.0 100-104 21.0 105-109 43.0 110-114 42.0 115-119 57.0 120-124 85.0 125-129 97.0 130-134 162.0 135-139 248.0 140-144 332.0 145-149 120.0 150-152 2231.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.08837928368978 94.19999999999999 2 2.75702138624066 5.35 3 0.1545993300695697 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015051 spots for SRR17229372.sra Written 3015051 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra Read 3015041 spots for SRR17229372.sra Written 3015041 spots for SRR17229372.sra SRR ids: ['SRR17229372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5lmjnd3r SRR17229372.sra spots: 60300830 blocks: [[1, 3015041], [3015042, 6030082], [6030083, 9045123], [9045124, 12060164], [12060165, 15075205], [15075206, 18090246], [18090247, 21105287], [21105288, 24120328], [24120329, 27135369], [27135370, 30150410], [30150411, 33165451], [33165452, 36180492], [36180493, 39195533], [39195534, 42210574], [42210575, 45225615], [45225616, 48240656], [48240657, 51255697], [51255698, 54270738], [54270739, 57285779], [57285780, 60300830]] SRR17229372 file size 20244446 SRR17229372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17229372 SRR17229372_1.fastq SRR17229372_2.fastq Input file: SRR17229372_1.fastq Paired file: SRR17229372_2.fastq trimmed: SRR17229372-trimmed-pair1.fastq, SRR17229372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:55:00 2024 >> started Fri Dec 6 22:56:53 2024 >> done (113.742s) 60300830 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 3 ( 0.00%) empty read pairs filtered out after trimming by size control 60300824 (100.00%) read pairs available; of these: 13689 ( 0.02%) trimmed read pairs available after processing 60287135 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 3 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 350 0.00% 37 764 0.00% 38 1204 0.00% 39 1580 0.00% 40 1864 0.00% 41 2255 0.00% 42 2475 0.00% 43 2865 0.00% 44 3118 0.01% 45 3499 0.01% 46 4208 0.01% 47 4609 0.01% 48 4921 0.01% 49 5335 0.01% 50 5447 0.01% 51 5709 0.01% 52 5797 0.01% 53 6076 0.01% 54 6234 0.01% 55 6280 0.01% 56 6721 0.01% 57 6879 0.01% 58 7210 0.01% 59 7459 0.01% 60 7678 0.01% 61 7893 0.01% 62 8247 0.01% 63 8326 0.01% 64 8614 0.01% 65 8865 0.01% 66 9141 0.02% 67 9244 0.02% 68 9489 0.02% 69 9698 0.02% 70 10118 0.02% 71 10391 0.02% 72 10626 0.02% 73 11181 0.02% 74 11264 0.02% 75 11366 0.02% 76 11778 0.02% 77 12029 0.02% 78 12705 0.02% 79 13056 0.02% 80 13673 0.02% 81 14203 0.02% 82 14862 0.02% 83 15215 0.03% 84 16190 0.03% 85 16971 0.03% 86 17606 0.03% 87 18432 0.03% 88 19502 0.03% 89 20432 0.03% 90 21248 0.04% 91 22264 0.04% 92 24859 0.04% 93 118526 0.20% 94 189297 0.31% 95 188065 0.31% 96 178427 0.30% 97 171302 0.28% 98 170181 0.28% 99 159872 0.27% 100 159546 0.26% 101 154595 0.26% 102 152525 0.25% 103 149561 0.25% 104 146020 0.24% 105 142271 0.24% 106 142366 0.24% 107 139207 0.23% 108 131407 0.22% 109 124824 0.21% 110 125235 0.21% 111 132493 0.22% 112 131857 0.22% 113 140707 0.23% 114 143359 0.24% 115 137228 0.23% 116 137517 0.23% 117 131316 0.22% 118 127957 0.21% 119 127442 0.21% 120 130120 0.22% 121 128935 0.21% 122 123906 0.21% 123 116583 0.19% 124 111071 0.18% 125 110566 0.18% 126 111059 0.18% 127 109760 0.18% 128 109976 0.18% 129 110720 0.18% 130 111780 0.19% 131 117694 0.20% 132 121236 0.20% 133 111827 0.19% 134 129840 0.22% 135 156369 0.26% 136 167533 0.28% 137 219124 0.36% 138 229603 0.38% 139 233614 0.39% 140 252375 0.42% 141 267129 0.44% 142 288210 0.48% 143 304589 0.51% 144 312555 0.52% 145 317575 0.53% 146 322467 0.53% 147 263232 0.44% 148 286436 0.48% 149 440890 0.73% 150 6615506 10.97% 151 43375401 71.93% 60300824 reads passed initial QC criterion=sequence-density sequence-density=24.13 sequence-density-rank=1 fanout-score=62.44 fanout-score-rank=13 prefix-density=24.86 prefix-fanout=60.6 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.17 sequence-density-rank=29 fanout-score=174.33 fanout-score-rank=1 prefix-density=24.43 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.1 sequence=CTGTAATCATCGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=435.76 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=25.4 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x CACTGGATACAC -y CTGTAATCATCGGT -o SRR17229372 SRR17229372_1.fastq SRR17229372_2.fastq Input file: SRR17229372_1.fastq Paired file: SRR17229372_2.fastq trimmed: SRR17229372-trimmed-pair1.fastq, SRR17229372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): CACTGGATACAC -- paired 3' end adapter sequence (-y): CTGTAATCATCGGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:09:02 2024 >> started Fri Dec 6 23:10:08 2024 >> done (65.953s) 51023774 read pairs processed; of these: 678 ( 0.00%) short read pairs filtered out after trimming by size control 210 ( 0.00%) empty read pairs filtered out after trimming by size control 51022886 (100.00%) read pairs available; of these: 7578 ( 0.01%) trimmed read pairs available after processing 51015308 (99.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 285 0.00% 37 637 0.00% 38 1008 0.00% 39 1332 0.00% 40 1579 0.00% 41 1914 0.00% 42 2083 0.00% 43 2428 0.00% 44 2618 0.01% 45 2922 0.01% 46 3546 0.01% 47 3907 0.01% 48 4155 0.01% 49 4505 0.01% 50 4620 0.01% 51 4815 0.01% 52 4865 0.01% 53 5142 0.01% 54 5323 0.01% 55 5289 0.01% 56 5642 0.01% 57 5776 0.01% 58 6126 0.01% 59 6273 0.01% 60 6563 0.01% 61 6696 0.01% 62 6984 0.01% 63 7116 0.01% 64 7231 0.01% 65 7488 0.01% 66 7802 0.02% 67 7746 0.02% 68 8018 0.02% 69 8188 0.02% 70 8553 0.02% 71 8795 0.02% 72 8971 0.02% 73 9415 0.02% 74 9540 0.02% 75 9602 0.02% 76 9939 0.02% 77 10170 0.02% 78 10804 0.02% 79 11007 0.02% 80 11579 0.02% 81 12079 0.02% 82 12512 0.02% 83 12828 0.03% 84 13684 0.03% 85 14377 0.03% 86 14945 0.03% 87 15659 0.03% 88 16559 0.03% 89 17334 0.03% 90 18011 0.04% 91 18868 0.04% 92 20976 0.04% 93 100380 0.20% 94 159701 0.31% 95 158950 0.31% 96 150878 0.30% 97 144829 0.28% 98 143901 0.28% 99 135333 0.27% 100 134857 0.26% 101 130792 0.26% 102 129059 0.25% 103 126737 0.25% 104 123596 0.24% 105 120281 0.24% 106 120374 0.24% 107 117761 0.23% 108 111141 0.22% 109 105647 0.21% 110 106172 0.21% 111 111939 0.22% 112 111323 0.22% 113 118998 0.23% 114 121502 0.24% 115 115751 0.23% 116 116362 0.23% 117 111122 0.22% 118 108217 0.21% 119 108016 0.21% 120 110263 0.22% 121 109150 0.21% 122 104644 0.21% 123 98599 0.19% 124 93871 0.18% 125 93482 0.18% 126 94052 0.18% 127 92927 0.18% 128 93098 0.18% 129 93797 0.18% 130 94491 0.19% 131 99727 0.20% 132 102512 0.20% 133 94428 0.19% 134 109962 0.22% 135 132414 0.26% 136 141508 0.28% 137 185445 0.36% 138 194412 0.38% 139 197360 0.39% 140 213167 0.42% 141 226038 0.44% 142 243693 0.48% 143 258152 0.51% 144 265230 0.52% 145 267231 0.52% 146 272646 0.53% 147 222332 0.44% 148 242462 0.48% 149 373083 0.73% 150 5596204 10.97% 151 36706045 71.94% criterion=sequence-density sequence-density=24.07 sequence-density-rank=1 fanout-score=62.46 fanout-score-rank=13 prefix-density=24.81 prefix-fanout=60.6 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.18 sequence-density-rank=30 fanout-score=173.78 fanout-score-rank=1 prefix-density=24.40 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=38 prefix-density=0.30 prefix-fanout=2.1 sequence=CTGTAATCATCGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=476.82 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=25.6 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC SRR17229372 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:14:00 Started mapping on | Dec 06 23:14:00 Finished on | Dec 06 23:18:46 Mapping speed, Million of reads per hour | 759.02 Number of input reads | 60299936 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 58360266 Uniquely mapped reads % | 96.78% Average mapped length | 271.35 Number of splices: Total | 59760320 Number of splices: Annotated (sjdb) | 55746529 Number of splices: GT/AG | 58558550 Number of splices: GC/AG | 758426 Number of splices: AT/AC | 33510 Number of splices: Non-canonical | 409834 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 725205 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 25936 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1348791 1348791 1348791 N_multimapping 725205 725205 725205 N_noFeature 2530621 3085509 56678057 N_ambiguous 1450124 335139 12940 UnstrandedReadsAssigned:54379521 PositiveStrandReadsAssigned:54939618 NegativeStrandReadsAssigned:1669269 Dataset is classified positive stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR17229372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR17229372-trimmed-pair1.fastq SRR17229372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,299,936 reads, 55,500,273 reads pseudoaligned [quant] estimated average fragment length: 323.731 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR17229372.ke.tsv 35125 SRR17229372.se.tsv 88098 total ==> SRR17229372.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 613.913 0 0 PNS24247 1044 721.269 101.731 3.53524 PNS24249 1928 1605.27 443.573 6.92599 PNS24246 1044 721.269 101.731 3.53524 PNS24248 1044 721.269 101.731 3.53524 PNS24244 1471 1148.27 472.235 10.3081 PNS24243 293 59.4733 0 0 KQK14069 1603 1280.27 17635.5 345.264 KQK14071 474 176.139 351.687 50.0454 ==> SRR17229372.se.tsv <== BRADI_1g14170v3 30285 BRADI_1g53295v3 654 BRADI_1g59795v3 2832 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 431 BRADI_1g74790v3 566 BRADI_1g09890v3 0 BRADI_1g77505v3 870 BRADI_1g48960v3 1 SRR17229372 completed mapping pipeline successfully