Starting /dee2/code/volunteer_pipeline.sh SRR17229373 current disk space = 1548409151488 free memory = 1599961548 SRR17229373 SRAfilesize b4efcd68ec9ae452a49ff391b38467cf SRR17229373.sra SRR17229373.sra file validated SRR17229373 is paired end SRR17229373 is conventional basespace SRR17229373 read1 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63375 32.0 32.0 32.0 32.0 32.0 2 31.47 32.0 32.0 32.0 32.0 32.0 3 34.51 37.0 32.0 37.0 32.0 37.0 4 35.9625 37.0 37.0 37.0 32.0 37.0 5 36.36125 37.0 37.0 37.0 37.0 37.0 6 39.4005 41.0 41.0 41.0 37.0 41.0 7 39.55875 41.0 41.0 41.0 37.0 41.0 8 39.608 41.0 41.0 41.0 37.0 41.0 9 40.13225 41.0 41.0 41.0 37.0 41.0 10-14 39.65495 41.0 41.0 41.0 36.0 41.0 15-19 39.81695 41.0 41.0 41.0 37.0 41.0 20-24 39.53645 41.0 41.0 41.0 36.0 41.0 25-29 39.427 41.0 41.0 41.0 37.0 41.0 30-34 38.27885 41.0 39.4 41.0 32.0 41.0 35-39 38.87928870717629 41.0 39.4 41.0 34.0 41.0 40-44 38.94902338799533 41.0 40.2 41.0 34.0 41.0 45-49 38.73148222190382 41.0 39.4 41.0 34.0 41.0 50-54 39.27752942603179 41.0 40.2 41.0 36.0 41.0 55-59 39.31567032983594 41.0 41.0 41.0 36.0 41.0 60-64 39.0843630194223 41.0 40.2 41.0 34.0 41.0 65-69 37.00393272695929 40.2 35.6 41.0 26.0 41.0 70-74 38.23057095378658 41.0 38.4 41.0 31.0 41.0 75-79 38.45955985770784 41.0 38.6 41.0 32.0 41.0 80-84 37.963369318625716 41.0 38.4 41.0 30.0 41.0 85-89 38.7691352471923 41.0 39.4 41.0 34.0 41.0 90-94 37.46987017694532 40.2 37.2 41.0 30.0 41.0 95-99 37.7201478779444 41.0 37.8 41.0 29.0 41.0 100-104 38.00762818254394 41.0 37.8 41.0 30.0 41.0 105-109 37.95715233872329 41.0 37.8 41.0 30.0 41.0 110-114 36.44527520214253 41.0 35.0 41.0 25.0 41.0 115-119 35.4986518464782 39.4 33.0 41.0 23.0 41.0 120-124 35.56758890030156 40.2 33.0 41.0 24.0 41.0 125-129 35.82026714516614 40.2 34.0 41.0 21.0 41.0 130-134 34.0331561579825 37.6 30.0 41.0 19.0 41.0 135-139 35.491330900183776 38.6 33.0 41.0 23.0 41.0 140-144 35.93094283368532 39.2 32.0 40.2 28.0 41.0 145-149 37.309665101328314 40.2 36.0 41.0 29.0 41.0 150-151 34.334057376207056 37.0 29.5 41.0 19.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 9.0 28 11.0 29 37.0 30 62.0 31 86.0 32 144.0 33 161.0 34 228.0 35 279.0 36 371.0 37 457.0 38 526.0 39 620.0 40 1006.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.15 29.95 21.6 23.3 2 25.1 30.325000000000003 22.2 22.375 3 25.474999999999998 31.0 20.95 22.575 4 25.174999999999997 30.425 20.925 23.474999999999998 5 25.55 29.725 21.475 23.25 6 24.275 30.175 22.35 23.200000000000003 7 25.15 28.449999999999996 22.2 24.2 8 25.6 30.475 22.725 21.2 9 16.6 28.499999999999996 26.35 28.549999999999997 10-14 25.66 23.419999999999998 25.759999999999998 25.16 15-19 25.14 26.095000000000002 27.555000000000003 21.21 20-24 25.319999999999997 25.255 31.14 18.285 25-29 25.874999999999996 25.5 27.13 21.495 30-34 25.75 25.540000000000003 25.540000000000003 23.169999999999998 35-39 25.727158948685858 25.817271589486857 24.700876095118897 23.754693366708384 40-44 26.65896998293344 25.554663186427067 25.138038349563296 22.648328481076195 45-49 25.494439132404008 26.05807458104776 24.50304463791455 23.94444164863369 50-54 26.40985510173171 25.94032412783359 24.173272075528853 23.47654869490584 55-59 26.206129260645294 25.5942146252655 24.749671285526446 23.44998482856276 60-64 26.313121070776717 25.907523828837963 24.949300344757656 22.830054755627664 65-69 26.229508196721312 25.094185928113227 24.763262396904594 23.91304347826087 70-74 26.214187222307338 25.39706858689546 24.850620499463766 23.538123691333436 75-79 26.347060028682645 25.087072321245646 24.651710715017412 23.914156935054294 80-84 25.825671580461247 26.37012686835482 23.991987261800812 23.81221428938312 85-89 26.316331787738278 25.352910870685214 24.72952086553323 23.601236476043276 90-94 26.080215009303288 26.03369857349597 24.03349183378127 23.852594583419474 95-99 25.857231920199503 25.623441396508728 24.231088944305903 24.288237738985867 100-104 26.19284034491769 25.022210608831983 25.053566762477136 23.73138228377319 105-109 26.138217800936893 25.39607347755145 24.517079846307702 23.94862887520396 110-114 27.13137014750519 25.842696629213485 23.909686351775918 23.116246871505407 115-119 26.234063419418113 25.93984962406015 24.376157785768772 23.44992917075297 120-124 26.310707185458675 25.827889804032942 24.64072706617438 23.220675944333998 125-129 27.411167512690355 25.680664513151825 24.030918320258422 22.8772496538994 130-134 26.817102137767222 24.83372921615202 25.053444180522565 23.295724465558195 135-139 27.204892966360855 25.168195718654435 24.030581039755354 23.596330275229356 140-144 26.342064714946073 26.292758089368256 24.338983050847457 23.026194144838215 145-149 26.441561665942526 25.634659549376202 24.436720253243127 23.487058531438148 150-151 27.2398487588361 25.727437119842183 23.869801084990957 23.162913036330757 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 2.0 10 5.5 11 5.0 12 5.0 13 5.5 14 3.0 15 2.0 16 2.5 17 1.5 18 1.5 19 3.0 20 2.0 21 1.5 22 2.0 23 2.0 24 2.0 25 2.0 26 1.0 27 1.5 28 2.0 29 1.5 30 3.0 31 6.5 32 6.5 33 10.5 34 20.5 35 23.0 36 26.0 37 43.0 38 62.5 39 93.0 40 120.0 41 135.0 42 163.5 43 206.0 44 213.5 45 208.0 46 225.0 47 223.0 48 230.0 49 214.0 50 181.0 51 171.0 52 145.5 53 133.0 54 127.0 55 121.5 56 113.0 57 98.0 58 94.5 59 84.5 60 75.5 61 67.5 62 65.5 63 55.5 64 53.0 65 56.0 66 39.5 67 29.0 68 26.0 69 22.0 70 13.0 71 9.0 72 9.0 73 6.0 74 4.0 75 1.0 76 0.0 77 1.0 78 2.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 11.0 40-44 11.0 45-49 12.0 50-54 10.0 55-59 8.0 60-64 15.0 65-69 11.0 70-74 14.0 75-79 7.0 80-84 14.0 85-89 10.0 90-94 18.0 95-99 24.0 100-104 22.0 105-109 42.0 110-114 45.0 115-119 166.0 120-124 75.0 125-129 62.0 130-134 136.0 135-139 34.0 140-144 20.0 145-149 128.0 150-152 3105.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.56535110199897 95.175 2 2.3577652485904665 4.6 3 0.0768836494105587 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACTG 10 0.007954334 137.8 7 CACACTG 20 2.4216497E-6 137.8 7 TATATGC 10 0.007954334 137.8 6 ACATGCT 10 0.007954334 137.8 7 TTGTACC 30 7.1122486E-10 137.8 8 ACCATGC 10 0.007954334 137.8 6 GTGTACC 10 0.007954334 137.8 8 CCATGCT 15 1.397833E-4 137.8 7 TAATGCT 10 0.007954334 137.8 7 TAGCAGA 10 0.007954334 137.8 7 ACACACT 10 0.007954334 137.8 6 AGCAGAT 35 1.2732926E-11 137.8 8 CCACTGG 25 4.1643943E-8 137.8 8 TCTGTAC 15 1.397833E-4 137.8 7 GCAGATC 45 0.0 137.8 9 ATGCTAT 140 0.0 137.8 9 AGATGTA 10 0.007954334 137.8 6 ATATGCT 15 1.397833E-4 137.8 7 GCCACTG 10 0.007954334 137.8 7 CTAGCAG 10 0.007954334 137.8 6 >>END_MODULE SRR17229373 read2 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.47125 32.0 32.0 32.0 12.0 32.0 2 31.265 32.0 32.0 32.0 32.0 32.0 3 34.55625 37.0 32.0 37.0 32.0 37.0 4 28.355 32.0 12.0 37.0 12.0 37.0 5 28.2525 32.0 12.0 37.0 12.0 37.0 6 32.90725 37.0 32.0 41.0 12.0 41.0 7 37.1225 41.0 37.0 41.0 32.0 41.0 8 37.644 41.0 37.0 41.0 32.0 41.0 9 38.71 41.0 41.0 41.0 32.0 41.0 10-14 38.0755 41.0 39.4 41.0 31.0 41.0 15-19 37.53935 40.2 36.6 41.0 29.0 41.0 20-24 38.9781 41.0 40.2 41.0 36.0 41.0 25-29 37.32075 41.0 36.8 41.0 27.0 41.0 30-34 37.222950000000004 41.0 37.0 41.0 27.0 41.0 35-39 35.796377589850955 38.4 32.0 41.0 26.0 41.0 40-44 36.45425650856454 40.2 35.0 41.0 25.0 41.0 45-49 36.03115518437365 40.2 34.0 41.0 23.0 41.0 50-54 34.16838142120662 37.4 29.0 40.2 21.0 41.0 55-59 36.10678835846012 40.2 35.0 41.0 24.0 41.0 60-64 37.943355545192276 41.0 37.0 41.0 30.0 41.0 65-69 37.55128801754584 41.0 36.0 41.0 30.0 41.0 70-74 37.47405494188375 41.0 36.0 41.0 29.0 41.0 75-79 32.68710772911341 34.8 26.0 40.2 20.0 41.0 80-84 37.10363136978002 41.0 36.0 41.0 28.0 41.0 85-89 37.777850460771184 41.0 37.0 41.0 29.0 41.0 90-94 38.167005237007444 41.0 37.8 41.0 32.0 41.0 95-99 37.33403995069116 40.2 36.8 41.0 28.0 41.0 100-104 38.40048593686333 41.0 37.0 41.0 32.0 41.0 105-109 37.281816890544654 41.0 37.0 41.0 29.0 41.0 110-114 33.6458390528155 37.0 28.0 41.0 18.0 41.0 115-119 37.349400204258224 41.0 37.0 41.0 30.0 41.0 120-124 36.57007567435828 41.0 35.0 41.0 28.0 41.0 125-129 35.88094071071273 41.0 34.0 41.0 24.0 41.0 130-134 32.48816480223798 36.8 29.0 41.0 15.0 41.0 135-139 32.98645532426686 36.0 27.0 41.0 18.0 41.0 140-144 33.55715408003 37.0 29.0 41.0 19.0 41.0 145-149 31.628848131134852 33.0 26.0 38.6 18.0 41.0 150-151 25.951729320306395 24.5 17.0 32.0 17.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 7.0 23 4.0 24 15.0 25 24.0 26 43.0 27 61.0 28 87.0 29 115.0 30 169.0 31 192.0 32 227.0 33 275.0 34 283.0 35 374.0 36 428.0 37 445.0 38 486.0 39 484.0 40 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.7 15.299999999999999 39.475 30.525000000000002 2 25.124999999999996 12.45 25.8 36.625 3 23.775 11.275 32.2 32.75 4 23.225 9.5 33.85 33.425 5 23.95 10.4 33.75 31.900000000000002 6 23.724999999999998 15.0 33.725 27.55 7 23.025000000000002 23.7 32.125 21.15 8 20.150000000000002 25.85 30.675 23.325000000000003 9 18.125 30.599999999999998 30.725 20.549999999999997 10-14 20.115 26.895000000000003 29.955 23.035 15-19 20.875 26.650000000000002 28.810000000000002 23.665 20-24 21.09 26.584999999999997 26.229999999999997 26.095000000000002 25-29 21.385 25.569999999999997 26.765 26.279999999999998 30-34 21.115000000000002 26.245 26.625 26.015 35-39 21.665579037196927 26.263741780031125 26.34907886150294 25.721600321269012 40-44 21.80986273512964 25.592272496187086 26.166751398068122 26.43111337061515 45-49 22.165107432918678 26.395599876632055 26.102601007504884 25.33669168294438 50-54 22.046749986926738 25.48763269361502 27.066882811274382 25.398734508183864 55-59 21.951090127844676 25.16577369900801 26.242639647764044 26.640496525383266 60-64 21.594862188921596 25.92989028632593 27.04843457318705 25.426812951565424 65-69 22.039296124365755 25.396739717154272 26.616646874662635 25.94731728381734 70-74 22.03630796150481 25.410104986876643 26.31233595800525 26.2412510936133 75-79 22.81327894856107 25.787446181735778 26.74484477679583 24.65443009290732 80-84 21.889374425023 25.735970561177552 25.764719411223552 26.609935602575895 85-89 21.711248483447918 25.894043561153158 26.084695822982262 26.31001213241666 90-94 22.284219703574543 25.527462946817785 26.381865736704448 25.806451612903224 95-99 22.15670247547875 25.467071461933678 25.60719290051378 26.769033162073796 100-104 22.33454801927824 25.514282355707063 25.596567532620195 26.554602092394497 105-109 22.854946484536693 25.433150020696587 25.787948672461713 25.923954822305006 110-114 22.969357976653697 26.215953307392997 25.164153696498055 25.65053501945525 115-119 22.544323483670293 25.860031104199066 26.13374805598756 25.461897356143083 120-124 22.042908676666034 25.561673311815706 26.099613948484272 26.295804063033984 125-129 22.741514360313317 25.29373368146214 25.802872062663184 26.161879895561356 130-134 22.971916103803768 25.090650551013155 26.05758976182012 25.87984358336296 135-139 22.43217814019131 25.482201662223613 26.10945585698604 25.976164340599027 140-144 22.92496679946879 25.904714475431607 25.24070385126162 25.92961487383798 145-149 22.3614240648941 25.299684542586753 27.201442091031996 25.13744930148716 150-151 23.512567610563156 25.930639516385618 28.698695513840278 21.858097359210944 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 1.0 18 1.0 19 0.0 20 3.0 21 3.5 22 0.5 23 1.0 24 2.0 25 2.5 26 3.5 27 4.5 28 7.0 29 8.0 30 11.0 31 24.0 32 33.0 33 35.0 34 48.5 35 62.0 36 69.5 37 87.5 38 109.5 39 128.0 40 160.0 41 185.5 42 207.0 43 247.5 44 235.0 45 203.0 46 218.5 47 226.0 48 201.5 49 190.5 50 185.5 51 169.0 52 153.0 53 137.0 54 119.0 55 93.5 56 85.0 57 77.0 58 65.5 59 63.5 60 61.5 61 53.0 62 45.0 63 42.5 64 42.5 65 40.0 66 36.5 67 31.5 68 24.5 69 23.0 70 22.5 71 19.0 72 13.0 73 15.5 74 15.0 75 8.0 76 8.5 77 7.5 78 5.0 79 6.0 80 5.0 81 3.0 82 2.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 48.0 40-44 37.0 45-49 63.0 50-54 60.0 55-59 48.0 60-64 22.0 65-69 37.0 70-74 114.0 75-79 84.0 80-84 18.0 85-89 22.0 90-94 14.0 95-99 24.0 100-104 12.0 105-109 68.0 110-114 97.0 115-119 42.0 120-124 77.0 125-129 133.0 130-134 362.0 135-139 144.0 140-144 136.0 145-149 644.0 150-152 1694.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11512990320938 96.3 2 1.8848700967906264 3.6999999999999997 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183611 spots for SRR17229373.sra Written 3183611 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra Read 3183606 spots for SRR17229373.sra Written 3183606 spots for SRR17229373.sra SRR ids: ['SRR17229373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x5m73ady SRR17229373.sra spots: 63672125 blocks: [[1, 3183606], [3183607, 6367212], [6367213, 9550818], [9550819, 12734424], [12734425, 15918030], [15918031, 19101636], [19101637, 22285242], [22285243, 25468848], [25468849, 28652454], [28652455, 31836060], [31836061, 35019666], [35019667, 38203272], [38203273, 41386878], [41386879, 44570484], [44570485, 47754090], [47754091, 50937696], [50937697, 54121302], [54121303, 57304908], [57304909, 60488514], [60488515, 63672125]] SRR17229373 file size 21190318 SRR17229373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17229373 SRR17229373_1.fastq SRR17229373_2.fastq Input file: SRR17229373_1.fastq Paired file: SRR17229373_2.fastq trimmed: SRR17229373-trimmed-pair1.fastq, SRR17229373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:58:30 2024 >> started Fri Dec 6 23:00:21 2024 >> done (110.682s) 63672125 read pairs processed; of these: 5 ( 0.00%) short read pairs filtered out after trimming by size control 2 ( 0.00%) empty read pairs filtered out after trimming by size control 63672118 (100.00%) read pairs available; of these: 22725 ( 0.04%) trimmed read pairs available after processing 63649393 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 4 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 730 0.00% 37 1639 0.00% 38 2598 0.00% 39 3305 0.01% 40 4054 0.01% 41 4756 0.01% 42 5315 0.01% 43 6024 0.01% 44 6660 0.01% 45 7508 0.01% 46 8375 0.01% 47 8961 0.01% 48 9578 0.02% 49 10141 0.02% 50 10879 0.02% 51 11313 0.02% 52 11886 0.02% 53 12197 0.02% 54 13008 0.02% 55 13401 0.02% 56 13912 0.02% 57 14676 0.02% 58 14830 0.02% 59 15466 0.02% 60 15760 0.02% 61 16129 0.03% 62 17291 0.03% 63 17418 0.03% 64 18023 0.03% 65 18656 0.03% 66 19516 0.03% 67 20088 0.03% 68 20464 0.03% 69 21189 0.03% 70 21774 0.03% 71 22716 0.04% 72 23247 0.04% 73 24057 0.04% 74 24306 0.04% 75 24956 0.04% 76 25559 0.04% 77 26622 0.04% 78 27404 0.04% 79 28271 0.04% 80 29369 0.05% 81 30455 0.05% 82 31476 0.05% 83 32943 0.05% 84 34291 0.05% 85 35690 0.06% 86 37468 0.06% 87 39515 0.06% 88 41484 0.07% 89 43565 0.07% 90 45370 0.07% 91 46900 0.07% 92 50345 0.08% 93 142654 0.22% 94 215463 0.34% 95 218727 0.34% 96 214504 0.34% 97 209007 0.33% 98 203652 0.32% 99 199323 0.31% 100 195916 0.31% 101 200735 0.32% 102 201468 0.32% 103 205633 0.32% 104 196883 0.31% 105 190693 0.30% 106 187900 0.30% 107 200332 0.31% 108 208498 0.33% 109 201940 0.32% 110 201009 0.32% 111 196937 0.31% 112 198672 0.31% 113 206906 0.32% 114 201251 0.32% 115 194906 0.31% 116 205242 0.32% 117 204955 0.32% 118 194209 0.31% 119 183730 0.29% 120 190295 0.30% 121 198492 0.31% 122 194703 0.31% 123 184939 0.29% 124 176331 0.28% 125 173254 0.27% 126 176747 0.28% 127 181917 0.29% 128 187631 0.29% 129 188002 0.30% 130 189284 0.30% 131 197846 0.31% 132 208102 0.33% 133 194837 0.31% 134 208894 0.33% 135 221844 0.35% 136 249308 0.39% 137 331530 0.52% 138 362709 0.57% 139 384363 0.60% 140 410690 0.65% 141 413650 0.65% 142 444588 0.70% 143 459081 0.72% 144 478826 0.75% 145 492943 0.77% 146 494775 0.78% 147 382015 0.60% 148 407580 0.64% 149 600309 0.94% 150 7609222 11.95% 151 40552731 63.69% 63672118 reads passed initial QC criterion=sequence-density sequence-density=24.13 sequence-density-rank=1 fanout-score=63.12 fanout-score-rank=10 prefix-density=25.16 prefix-fanout=60.5 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.07 sequence-density-rank=31 fanout-score=178.58 fanout-score-rank=1 prefix-density=23.88 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=32 prefix-density=0.34 prefix-fanout=2.7 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=553.32 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=23.9 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x CACTGGATACAC -y CTCCGATCCCGA -o SRR17229373 SRR17229373_1.fastq SRR17229373_2.fastq Input file: SRR17229373_1.fastq Paired file: SRR17229373_2.fastq trimmed: SRR17229373-trimmed-pair1.fastq, SRR17229373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): CACTGGATACAC -- paired 3' end adapter sequence (-y): CTCCGATCCCGA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:08:43 2024 >> started Fri Dec 6 23:09:38 2024 >> done (55.339s) 53876408 read pairs processed; of these: 713 ( 0.00%) short read pairs filtered out after trimming by size control 337 ( 0.00%) empty read pairs filtered out after trimming by size control 53875358 (100.00%) read pairs available; of these: 13713 ( 0.03%) trimmed read pairs available after processing 53861645 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 4 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 633 0.00% 37 1390 0.00% 38 2200 0.00% 39 2794 0.01% 40 3401 0.01% 41 4045 0.01% 42 4516 0.01% 43 5119 0.01% 44 5609 0.01% 45 6372 0.01% 46 7094 0.01% 47 7608 0.01% 48 8114 0.02% 49 8554 0.02% 50 9172 0.02% 51 9638 0.02% 52 10070 0.02% 53 10298 0.02% 54 11013 0.02% 55 11328 0.02% 56 11813 0.02% 57 12523 0.02% 58 12570 0.02% 59 13081 0.02% 60 13315 0.02% 61 13693 0.03% 62 14619 0.03% 63 14833 0.03% 64 15251 0.03% 65 15704 0.03% 66 16612 0.03% 67 16932 0.03% 68 17266 0.03% 69 17981 0.03% 70 18455 0.03% 71 19148 0.04% 72 19744 0.04% 73 20394 0.04% 74 20718 0.04% 75 21036 0.04% 76 21514 0.04% 77 22454 0.04% 78 23142 0.04% 79 23915 0.04% 80 24853 0.05% 81 25768 0.05% 82 26604 0.05% 83 27801 0.05% 84 29023 0.05% 85 30274 0.06% 86 31641 0.06% 87 33372 0.06% 88 35039 0.07% 89 36814 0.07% 90 38462 0.07% 91 39425 0.07% 92 42539 0.08% 93 120921 0.22% 94 182390 0.34% 95 185220 0.34% 96 181367 0.34% 97 176906 0.33% 98 172409 0.32% 99 168950 0.31% 100 165655 0.31% 101 169649 0.31% 102 170617 0.32% 103 173825 0.32% 104 166457 0.31% 105 161322 0.30% 106 158917 0.29% 107 169244 0.31% 108 176388 0.33% 109 170914 0.32% 110 170009 0.32% 111 166306 0.31% 112 168087 0.31% 113 174872 0.32% 114 170457 0.32% 115 164978 0.31% 116 173320 0.32% 117 173591 0.32% 118 164273 0.30% 119 155362 0.29% 120 161208 0.30% 121 167821 0.31% 122 164632 0.31% 123 156438 0.29% 124 149239 0.28% 125 146391 0.27% 126 149597 0.28% 127 154065 0.29% 128 159000 0.30% 129 159014 0.30% 130 160213 0.30% 131 167265 0.31% 132 176214 0.33% 133 164605 0.31% 134 176808 0.33% 135 187698 0.35% 136 210989 0.39% 137 280443 0.52% 138 306929 0.57% 139 325267 0.60% 140 347133 0.64% 141 349796 0.65% 142 376283 0.70% 143 389067 0.72% 144 407250 0.76% 145 414768 0.77% 146 419157 0.78% 147 322995 0.60% 148 345125 0.64% 149 508282 0.94% 150 6438026 11.95% 151 34313932 63.69% criterion=sequence-density sequence-density=23.91 sequence-density-rank=1 fanout-score=62.92 fanout-score-rank=11 prefix-density=24.86 prefix-fanout=60.5 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.08 sequence-density-rank=30 fanout-score=180.07 fanout-score-rank=1 prefix-density=24.09 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=27 prefix-density=0.33 prefix-fanout=2.7 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=475.01 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=25.6 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC SRR17229373 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 07 00:00:18 Started mapping on | Dec 07 00:00:22 Finished on | Dec 07 00:12:16 Mapping speed, Million of reads per hour | 320.80 Number of input reads | 63626218 Average input read length | 267 UNIQUE READS: Uniquely mapped reads number | 55527690 Uniquely mapped reads % | 87.27% Average mapped length | 267.15 Number of splices: Total | 55051503 Number of splices: Annotated (sjdb) | 51931408 Number of splices: GT/AG | 54135356 Number of splices: GC/AG | 670470 Number of splices: AT/AC | 36835 Number of splices: Non-canonical | 208842 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 728794 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 74192 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.06% % of reads unmapped: other | 1.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7623580 7623580 7623580 N_multimapping 728794 728794 728794 N_noFeature 2389828 2990491 53764192 N_ambiguous 1378332 219691 10331 UnstrandedReadsAssigned:51759530 PositiveStrandReadsAssigned:52317508 NegativeStrandReadsAssigned:1753167 Dataset is classified positive stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR17229373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR17229373-trimmed-pair1.fastq SRR17229373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 63,626,218 reads, 52,832,371 reads pseudoaligned [quant] estimated average fragment length: 288.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52973 SRR17229373.ke.tsv 35125 SRR17229373.se.tsv 88098 total ==> SRR17229373.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.985 0 0 PNS24247 1044 756.428 69.2933 2.4394 PNS24249 1928 1640.43 233.595 3.79198 PNS24246 1044 756.428 69.2933 2.4394 PNS24248 1044 756.428 69.2933 2.4394 PNS24244 1471 1183.43 803.525 18.0808 PNS24243 293 73.2321 0 0 KQK14069 1603 1315.43 4072.69 82.4468 KQK14071 474 203.024 66.0098 8.65808 ==> SRR17229373.se.tsv <== BRADI_1g14170v3 5295 BRADI_1g53295v3 267 BRADI_1g59795v3 1880 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 521 BRADI_1g74790v3 868 BRADI_1g09890v3 0 BRADI_1g77505v3 1041 BRADI_1g48960v3 0 SRR17229373 completed mapping pipeline successfully