Starting /dee2/code/volunteer_pipeline.sh SRR17229374 current disk space = 1548399546368 free memory = 1600456632 SRR17229374 SRAfilesize 923d03d67f791328b59f6d2b0293e958 SRR17229374.sra SRR17229374.sra file validated SRR17229374 is paired end SRR17229374 is conventional basespace SRR17229374 read1 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6925 32.0 32.0 32.0 32.0 32.0 2 31.44875 32.0 32.0 32.0 32.0 32.0 3 34.39625 37.0 32.0 37.0 32.0 37.0 4 36.13875 37.0 37.0 37.0 32.0 37.0 5 36.4125 37.0 37.0 37.0 37.0 37.0 6 39.44875 41.0 41.0 41.0 37.0 41.0 7 39.635 41.0 41.0 41.0 37.0 41.0 8 39.6685 41.0 41.0 41.0 37.0 41.0 9 40.209 41.0 41.0 41.0 37.0 41.0 10-14 39.832699999999996 41.0 41.0 41.0 37.0 41.0 15-19 39.9605 41.0 41.0 41.0 37.0 41.0 20-24 39.718849999999996 41.0 41.0 41.0 37.0 41.0 25-29 39.60795 41.0 41.0 41.0 37.0 41.0 30-34 38.670399999999994 41.0 39.4 41.0 33.0 41.0 35-39 39.27317133019302 41.0 41.0 41.0 35.0 41.0 40-44 39.288613895990395 41.0 40.2 41.0 36.0 41.0 45-49 39.04766000119125 41.0 40.2 41.0 35.0 41.0 50-54 39.53331384614293 41.0 41.0 41.0 36.0 41.0 55-59 39.54499038487814 41.0 41.0 41.0 37.0 41.0 60-64 39.24516293274688 41.0 40.2 41.0 35.0 41.0 65-69 37.519267168865795 41.0 38.4 41.0 29.0 41.0 70-74 38.615367582679966 41.0 39.4 41.0 33.0 41.0 75-79 38.80801365701234 41.0 40.2 41.0 33.0 41.0 80-84 38.38478278251816 41.0 39.4 41.0 31.0 41.0 85-89 39.04681116602068 41.0 40.2 41.0 34.0 41.0 90-94 37.965493843181186 40.2 38.2 41.0 31.0 41.0 95-99 38.17011962017549 41.0 37.8 41.0 32.0 41.0 100-104 38.52366656527339 41.0 38.6 41.0 32.0 41.0 105-109 38.42688189815364 41.0 38.6 41.0 33.0 41.0 110-114 37.17323585666199 41.0 36.0 41.0 27.0 41.0 115-119 36.276636907957254 40.2 34.0 41.0 24.0 41.0 120-124 36.30095140060374 40.2 34.0 41.0 26.0 41.0 125-129 36.57184711871978 41.0 35.0 41.0 25.0 41.0 130-134 34.90657900429286 38.6 32.0 41.0 22.0 41.0 135-139 36.209073071230456 40.2 35.0 41.0 25.0 41.0 140-144 36.45788890036273 39.2 32.8 41.0 29.0 41.0 145-149 37.753119909336334 40.2 36.0 41.0 30.0 41.0 150-151 35.070842490842494 37.0 32.0 41.0 19.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 4.0 28 16.0 29 26.0 30 61.0 31 82.0 32 99.0 33 124.0 34 172.0 35 240.0 36 300.0 37 418.0 38 527.0 39 704.0 40 1223.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.775 28.075 21.925 23.225 2 25.35633908477119 30.83270817704426 20.930232558139537 22.88072018004501 3 26.275 31.025000000000002 21.25 21.45 4 24.85 29.325000000000003 22.650000000000002 23.175 5 24.65 30.825000000000003 21.725 22.8 6 26.224999999999998 28.325 22.125 23.325000000000003 7 25.35 30.525000000000002 21.775 22.35 8 26.924999999999997 29.425 21.925 21.725 9 16.625 28.525 28.050000000000004 26.8 10-14 25.2 23.465 25.765 25.569999999999997 15-19 25.935000000000002 25.124999999999996 27.894999999999996 21.044999999999998 20-24 26.66 24.985 30.314999999999998 18.04 25-29 25.740000000000002 25.71 26.424999999999997 22.125 30-34 25.935000000000002 25.89 24.265 23.91 35-39 25.725580464371493 26.261008807045638 24.134307445956765 23.8791032826261 40-44 26.299678843837814 25.66740264953834 24.5383380168607 23.49458048976315 45-49 25.654555505301772 26.041509623599175 24.393185587215438 23.91074928388361 50-54 26.250880902043694 25.91865498842243 23.613208496929428 24.21725561260445 55-59 26.04444892405382 25.83278738094038 24.36123570024694 23.761527994758858 60-64 26.17124394184168 25.762318255250406 24.227584814216478 23.83885298869144 65-69 26.542396920271504 25.888967683112146 24.035052173032113 23.533583223584237 70-74 26.007511927723076 25.59638615368998 24.657395188305756 23.73870673028119 75-79 25.960561089652366 26.046960764383005 23.897133563732467 24.095344582232162 80-84 26.035563254700158 26.56035053752484 24.04340958883171 23.360676618943295 85-89 26.558265582655828 25.908881730326737 23.909597586541903 23.623255100475532 90-94 26.76121473716664 25.944196084476644 24.525975026977033 22.768614151379683 95-99 26.71413093948305 25.274725274725274 24.165505855646703 23.84563793014497 100-104 27.143227143227143 25.185185185185183 24.185444185444187 23.486143486143483 105-109 26.33581817234009 25.22024709378095 24.95438669655424 23.489548037324713 110-114 27.209522806278308 25.81375750553039 23.522595596755504 23.454124091435794 115-119 27.325799368003857 25.5958438219699 23.726634888329496 23.35172192169675 120-124 26.882252653577517 25.193862398944066 24.324918880272783 23.59896606720563 125-129 27.07545070109059 26.658134876474517 23.403071444469177 22.863342977965726 130-134 26.954791015069663 26.181404606198466 23.252772249075917 23.611032129655957 135-139 26.750961426407176 26.3489103834052 23.4529775084489 23.447150681738723 140-144 27.11375412152614 26.136363636363637 24.140367404616107 22.609514837494114 145-149 26.704545454545453 25.65696022727273 24.49100378787879 23.14749053030303 150-151 26.003734827264243 27.01525054466231 23.04699657640834 23.93401805166511 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 2.0 29 5.5 30 8.5 31 10.0 32 11.0 33 13.0 34 13.0 35 18.5 36 24.0 37 34.0 38 60.0 39 82.0 40 101.5 41 133.0 42 179.0 43 208.5 44 213.0 45 226.0 46 248.5 47 234.5 48 225.5 49 219.5 50 185.0 51 172.5 52 155.0 53 117.5 54 104.0 55 108.0 56 103.0 57 97.0 58 82.0 59 77.0 60 81.0 61 78.5 62 73.0 63 59.0 64 52.5 65 53.0 66 49.0 67 35.0 68 26.5 69 25.0 70 16.0 71 12.0 72 10.5 73 7.0 74 4.5 75 2.5 76 1.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 11.0 40-44 7.0 45-49 8.0 50-54 4.0 55-59 4.0 60-64 14.0 65-69 8.0 70-74 7.0 75-79 7.0 80-84 13.0 85-89 15.0 90-94 20.0 95-99 14.0 100-104 17.0 105-109 41.0 110-114 31.0 115-119 117.0 120-124 55.0 125-129 46.0 130-134 111.0 135-139 41.0 140-144 23.0 145-149 110.0 150-152 3276.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.03837239248004 94.19999999999999 2 2.910121040432655 5.65 3 0.05150656708730364 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGTA 10 0.008241477 136.175 6 ACTGTAC 10 0.008241477 136.175 7 ACGCATG 10 0.008241477 136.175 5 TATGCTA 25 4.4701665E-8 136.175 8 GTGTACC 25 4.4701665E-8 136.175 8 GATGCTA 15 1.4654697E-4 136.175 8 TAATGCT 25 4.4701665E-8 136.175 7 GCGTGTA 10 0.008241477 136.175 6 GAATGCT 15 1.4654697E-4 136.175 7 ATAATGC 20 2.568935E-6 136.175 6 CCACTGG 10 0.008241477 136.175 8 ATAAATG 10 0.008241477 136.175 5 GCTGTAC 10 0.008241477 136.175 7 TCATGTA 15 1.4654697E-4 136.175 6 CGAATGC 10 0.008241477 136.175 6 ATGCTAT 140 0.0 136.175 9 GCATGCT 20 2.568935E-6 136.175 7 TATCACT 15 1.4654697E-4 136.175 6 ATCACTG 20 2.568935E-6 136.175 7 GAACACT 10 0.008241477 136.175 6 >>END_MODULE SRR17229374 read2 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.36875 32.0 32.0 32.0 12.0 32.0 2 31.215 32.0 32.0 32.0 32.0 32.0 3 34.53 37.0 32.0 37.0 32.0 37.0 4 28.71875 32.0 12.0 37.0 12.0 37.0 5 28.72 32.0 12.0 37.0 12.0 37.0 6 33.6375 37.0 32.0 41.0 12.0 41.0 7 37.49325 41.0 37.0 41.0 32.0 41.0 8 37.8195 41.0 37.0 41.0 32.0 41.0 9 38.81575 41.0 41.0 41.0 32.0 41.0 10-14 38.2764 41.0 39.4 41.0 33.0 41.0 15-19 37.6109 40.2 36.6 41.0 30.0 41.0 20-24 39.00265 41.0 41.0 41.0 36.0 41.0 25-29 37.50585 41.0 37.6 41.0 27.0 41.0 30-34 37.49365 41.0 37.0 41.0 28.0 41.0 35-39 36.055554370972445 39.2 32.0 41.0 27.0 41.0 40-44 36.87456706592587 40.2 36.0 41.0 25.0 41.0 45-49 36.40762784338754 40.2 35.0 41.0 24.0 41.0 50-54 34.52179510229001 37.4 30.0 41.0 23.0 41.0 55-59 36.41941113483403 40.2 35.0 41.0 24.0 41.0 60-64 38.04977814455941 41.0 37.0 41.0 32.0 41.0 65-69 37.82379132787308 41.0 37.0 41.0 30.0 41.0 70-74 37.58372579755882 41.0 36.0 41.0 29.0 41.0 75-79 33.0769757051335 36.6 26.0 41.0 21.0 41.0 80-84 37.39757946209314 41.0 36.0 41.0 28.0 41.0 85-89 37.986567151000116 41.0 37.8 41.0 31.0 41.0 90-94 38.30446134206917 41.0 37.8 41.0 32.0 41.0 95-99 37.63518343005053 41.0 37.6 41.0 27.0 41.0 100-104 38.569102525938696 41.0 37.8 41.0 32.0 41.0 105-109 37.64276867865273 41.0 37.0 41.0 30.0 41.0 110-114 33.98166803153905 37.0 28.0 41.0 19.0 41.0 115-119 37.68618273911007 41.0 37.0 41.0 31.0 41.0 120-124 36.98870296079345 41.0 37.0 41.0 28.0 41.0 125-129 36.268409170837906 41.0 34.0 41.0 27.0 41.0 130-134 32.8555655246938 36.8 29.0 41.0 15.0 41.0 135-139 33.487184662783235 36.0 28.0 41.0 20.0 41.0 140-144 34.09585259709503 38.6 29.0 41.0 21.0 41.0 145-149 32.03556137380528 33.0 26.0 40.2 19.0 41.0 150-151 26.12237447371525 24.5 17.0 32.0 17.0 39.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 5.0 24 15.0 25 35.0 26 40.0 27 52.0 28 69.0 29 100.0 30 136.0 31 168.0 32 205.0 33 255.0 34 318.0 35 362.0 36 382.0 37 468.0 38 504.0 39 560.0 40 321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.5 14.825 37.675 32.0 2 23.200000000000003 11.3 27.275 38.224999999999994 3 22.675 11.35 31.95 34.025 4 23.025000000000002 10.05 34.475 32.45 5 23.724999999999998 10.2 35.575 30.5 6 23.375 14.274999999999999 36.075 26.275 7 22.575 23.65 32.75 21.025 8 19.825 24.85 33.025 22.3 9 18.425 28.475 31.525 21.575 10-14 19.81 25.965 30.89 23.335 15-19 20.7 25.955000000000002 28.515 24.83 20-24 21.6 25.679999999999996 27.084999999999997 25.635 25-29 20.87 24.75 27.41 26.97 30-34 21.895 25.759999999999998 26.810000000000002 25.535000000000004 35-39 21.272964561790985 25.28862563999598 26.92500752936452 26.51340226884851 40-44 22.098214285714285 24.396306818181817 26.87195616883117 26.63352272727273 45-49 21.812132070642438 25.61556181213207 26.716150499104174 25.856155618121317 50-54 22.893696692323694 24.57873933846474 27.37154150197628 25.156022467235285 55-59 21.979353207626673 24.786684925734754 26.582745180659433 26.65121668597914 60-64 22.187433665888346 25.440458501379748 26.342602419868395 26.029505412863514 65-69 22.25311447361386 25.39164839865262 26.21504571459124 26.140191413142276 70-74 22.14223857977917 24.729378653388178 27.078371941978784 26.050010824853864 75-79 22.308935838118067 25.569987178772507 27.119683371425385 25.00139361168404 80-84 21.9159511974695 24.7910076818798 26.897876186172613 26.395164934478082 85-89 22.237365133446904 24.877910278250994 26.44520159000568 26.43952299829642 90-94 21.942014067593067 25.270200720535257 26.539715217018355 26.248069994853317 95-99 21.83041877588587 25.08053382420617 26.55315232397607 26.535895075931894 100-104 22.508541316810472 24.471596502403152 25.98876599687301 27.031096183913373 105-109 22.65483626174771 24.808826104722435 27.044539139571537 25.491798493958324 110-114 22.612763915547024 25.09596928982726 26.36756238003839 25.923704414587334 115-119 22.535211267605636 24.28658909981629 26.472749540722596 26.705450091855482 120-124 21.714534377719758 25.183389282605994 26.824567947283352 26.277508392390896 125-129 22.58495609011073 25.079546900852744 26.148657248313604 26.186839760722926 130-134 22.92560070791641 24.014702879313866 26.764685862092435 26.295010550677283 135-139 22.442049313450465 24.804370293813673 26.517053004576997 26.236527388158866 140-144 22.482417497488214 24.507303501043356 26.709946672849526 26.300332328618904 145-149 22.74311317623631 23.97112512446067 27.231994689678064 26.053767009624956 150-151 23.471170646476413 25.276645311589984 29.7029702970297 21.549213744903902 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 1.5 27 4.0 28 6.0 29 7.0 30 11.0 31 16.5 32 18.5 33 27.5 34 36.0 35 43.0 36 69.0 37 96.5 38 116.0 39 142.0 40 179.5 41 192.5 42 195.5 43 241.5 44 253.5 45 231.5 46 223.5 47 221.0 48 210.0 49 178.5 50 157.5 51 154.5 52 141.5 53 116.5 54 104.5 55 89.0 56 77.5 57 75.5 58 70.5 59 59.5 60 59.0 61 61.0 62 60.0 63 56.0 64 46.5 65 38.0 66 31.5 67 32.5 68 28.0 69 28.0 70 28.0 71 19.0 72 10.5 73 9.0 74 8.5 75 10.5 76 12.5 77 9.5 78 7.0 79 5.0 80 2.5 81 3.0 82 3.5 83 1.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 50.0 40-44 26.0 45-49 53.0 50-54 58.0 55-59 35.0 60-64 23.0 65-69 31.0 70-74 99.0 75-79 74.0 80-84 22.0 85-89 21.0 90-94 22.0 95-99 24.0 100-104 20.0 105-109 65.0 110-114 91.0 115-119 46.0 120-124 65.0 125-129 98.0 130-134 304.0 135-139 129.0 140-144 125.0 145-149 650.0 150-152 1869.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.21792260692465 96.45 2 1.7311608961303464 3.4000000000000004 3 0.05091649694501018 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGTA 10 0.009253405 131.0 8 >>END_MODULE Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741062 spots for SRR17229374.sra Written 2741062 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra Read 2741045 spots for SRR17229374.sra Written 2741045 spots for SRR17229374.sra SRR ids: ['SRR17229374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tf0rl0ia SRR17229374.sra spots: 54820917 blocks: [[1, 2741045], [2741046, 5482090], [5482091, 8223135], [8223136, 10964180], [10964181, 13705225], [13705226, 16446270], [16446271, 19187315], [19187316, 21928360], [21928361, 24669405], [24669406, 27410450], [27410451, 30151495], [30151496, 32892540], [32892541, 35633585], [35633586, 38374630], [38374631, 41115675], [41115676, 43856720], [43856721, 46597765], [46597766, 49338810], [49338811, 52079855], [52079856, 54820917]] SRR17229374 file size 18266378 SRR17229374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17229374 SRR17229374_1.fastq SRR17229374_2.fastq Input file: SRR17229374_1.fastq Paired file: SRR17229374_2.fastq trimmed: SRR17229374-trimmed-pair1.fastq, SRR17229374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:59:30 2024 >> started Fri Dec 6 23:00:55 2024 >> done (84.846s) 54820917 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 5 ( 0.00%) empty read pairs filtered out after trimming by size control 54820908 (100.00%) read pairs available; of these: 13072 ( 0.02%) trimmed read pairs available after processing 54807836 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 664 0.00% 37 1459 0.00% 38 2245 0.00% 39 3088 0.01% 40 3587 0.01% 41 4309 0.01% 42 5004 0.01% 43 5432 0.01% 44 5885 0.01% 45 6711 0.01% 46 7777 0.01% 47 8352 0.02% 48 8844 0.02% 49 9434 0.02% 50 9722 0.02% 51 10320 0.02% 52 10698 0.02% 53 11550 0.02% 54 11773 0.02% 55 11989 0.02% 56 12855 0.02% 57 13359 0.02% 58 13600 0.02% 59 13989 0.03% 60 14626 0.03% 61 14875 0.03% 62 14999 0.03% 63 15960 0.03% 64 16559 0.03% 65 16972 0.03% 66 17249 0.03% 67 17570 0.03% 68 18192 0.03% 69 18583 0.03% 70 19300 0.04% 71 19716 0.04% 72 20404 0.04% 73 20748 0.04% 74 21041 0.04% 75 21506 0.04% 76 22139 0.04% 77 22670 0.04% 78 23435 0.04% 79 24480 0.04% 80 25300 0.05% 81 25925 0.05% 82 26897 0.05% 83 28117 0.05% 84 29453 0.05% 85 30077 0.05% 86 32123 0.06% 87 33200 0.06% 88 35051 0.06% 89 36478 0.07% 90 38705 0.07% 91 39666 0.07% 92 42725 0.08% 93 127808 0.23% 94 194413 0.35% 95 198179 0.36% 96 194322 0.35% 97 190155 0.35% 98 184657 0.34% 99 179647 0.33% 100 175666 0.32% 101 179128 0.33% 102 184207 0.34% 103 184942 0.34% 104 178017 0.32% 105 170474 0.31% 106 166699 0.30% 107 177276 0.32% 108 183219 0.33% 109 176719 0.32% 110 177384 0.32% 111 171284 0.31% 112 173089 0.32% 113 180116 0.33% 114 173296 0.32% 115 167570 0.31% 116 177478 0.32% 117 174646 0.32% 118 164963 0.30% 119 154680 0.28% 120 161102 0.29% 121 167866 0.31% 122 165394 0.30% 123 156693 0.29% 124 149789 0.27% 125 144853 0.26% 126 147551 0.27% 127 152080 0.28% 128 157028 0.29% 129 156312 0.29% 130 156415 0.29% 131 164586 0.30% 132 173080 0.32% 133 171597 0.31% 134 185753 0.34% 135 195957 0.36% 136 220676 0.40% 137 269612 0.49% 138 295105 0.54% 139 318498 0.58% 140 336104 0.61% 141 341533 0.62% 142 367322 0.67% 143 377445 0.69% 144 390039 0.71% 145 402376 0.73% 146 395893 0.72% 147 338072 0.62% 148 364031 0.66% 149 537894 0.98% 150 6632728 12.10% 151 34870098 63.61% 54820908 reads passed initial QC criterion=sequence-density sequence-density=24.33 sequence-density-rank=1 fanout-score=62.38 fanout-score-rank=13 prefix-density=25.06 prefix-fanout=60.6 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.27 sequence-density-rank=26 fanout-score=168.85 fanout-score-rank=1 prefix-density=24.65 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.29 prefix-fanout=2.0 sequence=CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=301.88 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=28.4 sequence=CTCTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x CACTGGATACAC -y CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCAC -o SRR17229374 SRR17229374_1.fastq SRR17229374_2.fastq Input file: SRR17229374_1.fastq Paired file: SRR17229374_2.fastq trimmed: SRR17229374-trimmed-pair1.fastq, SRR17229374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): CACTGGATACAC -- paired 3' end adapter sequence (-y): CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:08:22 2024 >> started Fri Dec 6 23:09:35 2024 >> done (72.363s) 46386922 read pairs processed; of these: 783 ( 0.00%) short read pairs filtered out after trimming by size control 729 ( 0.00%) empty read pairs filtered out after trimming by size control 46385410 (100.00%) read pairs available; of these: 7021 ( 0.02%) trimmed read pairs available after processing 46378389 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 546 0.00% 37 1220 0.00% 38 1922 0.00% 39 2607 0.01% 40 3060 0.01% 41 3672 0.01% 42 4255 0.01% 43 4600 0.01% 44 5014 0.01% 45 5689 0.01% 46 6562 0.01% 47 7096 0.02% 48 7447 0.02% 49 7974 0.02% 50 8225 0.02% 51 8698 0.02% 52 9055 0.02% 53 9768 0.02% 54 10009 0.02% 55 10132 0.02% 56 10870 0.02% 57 11230 0.02% 58 11513 0.02% 59 11919 0.03% 60 12388 0.03% 61 12571 0.03% 62 12673 0.03% 63 13527 0.03% 64 13989 0.03% 65 14376 0.03% 66 14606 0.03% 67 14866 0.03% 68 15363 0.03% 69 15811 0.03% 70 16359 0.04% 71 16700 0.04% 72 17288 0.04% 73 17611 0.04% 74 17793 0.04% 75 18197 0.04% 76 18808 0.04% 77 19143 0.04% 78 19837 0.04% 79 20737 0.04% 80 21386 0.05% 81 21915 0.05% 82 22802 0.05% 83 23796 0.05% 84 24970 0.05% 85 25458 0.05% 86 27144 0.06% 87 28075 0.06% 88 29704 0.06% 89 30891 0.07% 90 32760 0.07% 91 33482 0.07% 92 36207 0.08% 93 108532 0.23% 94 164683 0.36% 95 167690 0.36% 96 164138 0.35% 97 160899 0.35% 98 156447 0.34% 99 151919 0.33% 100 148794 0.32% 101 151721 0.33% 102 155887 0.34% 103 156785 0.34% 104 150843 0.33% 105 143962 0.31% 106 141275 0.30% 107 149825 0.32% 108 155157 0.33% 109 149599 0.32% 110 150275 0.32% 111 144804 0.31% 112 146509 0.32% 113 152761 0.33% 114 146640 0.32% 115 141744 0.31% 116 150473 0.32% 117 147867 0.32% 118 139639 0.30% 119 130816 0.28% 120 136189 0.29% 121 141969 0.31% 122 139799 0.30% 123 132727 0.29% 124 126708 0.27% 125 122725 0.26% 126 124906 0.27% 127 128772 0.28% 128 133017 0.29% 129 132392 0.29% 130 132290 0.29% 131 139092 0.30% 132 146462 0.32% 133 145450 0.31% 134 157248 0.34% 135 166037 0.36% 136 186484 0.40% 137 228043 0.49% 138 249513 0.54% 139 269467 0.58% 140 284443 0.61% 141 288948 0.62% 142 310809 0.67% 143 319748 0.69% 144 330593 0.71% 145 339322 0.73% 146 335298 0.72% 147 286081 0.62% 148 307763 0.66% 149 455031 0.98% 150 5611423 12.10% 151 29502656 63.60% criterion=sequence-density sequence-density=24.19 sequence-density-rank=1 fanout-score=62.75 fanout-score-rank=13 prefix-density=25.01 prefix-fanout=60.7 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.21 sequence-density-rank=29 fanout-score=172.16 fanout-score-rank=1 prefix-density=24.52 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.0 sequence=CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=455.99 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=24.0 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC SRR17229374 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 06 23:53:16 Started mapping on | Dec 06 23:53:21 Finished on | Dec 06 23:57:59 Mapping speed, Million of reads per hour | 709.40 Number of input reads | 54781192 Average input read length | 267 UNIQUE READS: Uniquely mapped reads number | 52233779 Uniquely mapped reads % | 95.35% Average mapped length | 266.57 Number of splices: Total | 47589870 Number of splices: Annotated (sjdb) | 44319514 Number of splices: GT/AG | 46775171 Number of splices: GC/AG | 589217 Number of splices: AT/AC | 24087 Number of splices: Non-canonical | 201395 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 627837 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 58819 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2179819 2179819 2179819 N_multimapping 627837 627837 627837 N_noFeature 2485858 3161793 50362884 N_ambiguous 1476494 289175 12644 UnstrandedReadsAssigned:48271427 PositiveStrandReadsAssigned:48782811 NegativeStrandReadsAssigned:1858251 Dataset is classified positive stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR17229374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR17229374-trimmed-pair1.fastq SRR17229374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,781,192 reads, 49,033,138 reads pseudoaligned [quant] estimated average fragment length: 302.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR17229374.ke.tsv 35125 SRR17229374.se.tsv 88098 total ==> SRR17229374.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 634.968 0 0 PNS24247 1044 742.409 76.5311 2.75979 PNS24249 1928 1626.41 353.182 5.81366 PNS24246 1044 742.409 76.5311 2.75979 PNS24248 1044 742.409 76.5311 2.75979 PNS24244 1471 1169.41 697.225 15.962 PNS24243 293 68.3906 0 0 KQK14069 1603 1301.41 14462.4 297.514 KQK14071 474 190.76 447.062 62.7425 ==> SRR17229374.se.tsv <== BRADI_1g14170v3 25079 BRADI_1g53295v3 595 BRADI_1g59795v3 2800 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 777 BRADI_1g74790v3 553 BRADI_1g09890v3 0 BRADI_1g77505v3 872 BRADI_1g48960v3 0 SRR17229374 completed mapping pipeline successfully